Published online 25 June 2004
Nucleic Acids Research, Vol. 32 No. 11 © Oxford University Press 2004; all rights reserved
RNase P ribozyme inhibits cytomegalovirus replication by blocking the expression of viral capsid proteins
Program in Infectious Diseases and Immunity, Program in Comparative Biochemistry, School of Public Health, 140 Warren Hall, University of California, Berkeley, CA 94720, USA
* To whom correspondence should be addressed. Tel: +1 510 643 2436; Fax: +1 510 643 9955; Email: liu_fy{at}uclink4.berkeley.edu
Received March 12, 2004; Revised May 8, 2004; Accepted June 2, 2004
| ABSTRACT |
|---|
|
|
|---|
By linking a guide sequence to the catalytic RNA subunit of RNase P (M1 RNA), we constructed a functional ribozyme (M1GS RNA) that targets the overlapping mRNA region of two human cytomegalovirus (HCMV) capsid proteins, the capsid scaffolding protein (CSP) and assemblin, which are essential for viral capsid formation. The ribozyme efficiently cleaved the target mRNA sequence in vitro. Moreover, a reduction of >85% in the expression of CSP and assemblin and a reduction of 4000-fold in viral growth were observed in the HCMV-infected cells that expressed the functional ribozyme. In contrast, there was no significant reduction in viral gene expression and growth in virus-infected cells that either did not express the ribozyme or produced a disabled ribozyme carrying mutations that abolished its catalytic activity. Characterization of the effects of the ribozyme on the HCMV lytic replication cycle further indicates that the expression of the functional ribozyme specifically inhibits the expression of CSP and assemblin, and consequently blocks viral capsid formation and growth. Our results provide the direct evidence that RNase P ribozymes can be used as an effective gene-targeting agent for antiviral applications, including abolishing HCMV growth by blocking the expression of the virus-encoded capsid proteins.
| INTRODUCTION |
|---|
|
|
|---|
Human cytomegalovirus (HCMV) causes significant morbidity and mortality in immunocompromised or immunologically immature individuals, including neonates and AIDS patients (1,2). The emergence of drug-resistant strains of HCMV has posed a need for the development of new drugs and novel treatment strategies. RNA enzymes are being developed as promising gene-targeting agents to specifically cleave RNA sequences of choice (3,4). These ribozymes contain both a catalytic RNA domain that cleaves the target mRNA and a substrate-binding domain with a sequence antisense to the target mRNA sequence. Therefore, these gene-targeting ribozymes bind to the mRNA sequence through WatsonCrick interactions between the target sequence and the antisense sequence in the substrate-binding domain of the ribozyme. Both hammerhead and hairpin ribozymes have been shown to cleave viral mRNA sequences and inhibit viral replication in cells infected with human viruses, while a ribozyme derived from a group I intron has been used to repair mutant mRNAs in cells (58). These results have demonstrated that ribozymes can be used as a tool in both basic research and clinical applications (4,9).
RNase P is a ribonucleoprotein complex responsible for the 5' maturation of tRNA (10,11). It catalyzes a hydrolysis reaction to remove a 5' leader sequence from tRNA precursors (ptRNA) and several other small RNAs. In Escherichia coli, RNase P consists of a catalytic RNA subunit (M1 RNA) and a protein subunit (C5 protein) (10,11). In vitro, RNase P ribozyme can cleave its pre-tRNA substrate at high divalent ion concentrations (e.g. 100 mM Mg2+) in the absence of C5 protein (12). Moreover, M1 RNA cleaves an mRNA sequence efficiently if an additional small RNA [termed external guide sequence (EGS)], which contains a sequence complementary to the substrate and a 3' proximal CCA, is present (Figure 1A) (13). EGSs are antisense oligoribonucleotides that have been used to diminish gene expression in mammalian cells and in bacteria with the aid of either RNase P or its catalytic subunit (e.g. M1 RNA) (1416). The EGS-based technology takes advantage of RNase P or M1 RNA to cleave a targeted mRNA when the EGS hybridizes to the target RNA and forms a structure resembling a portion of the natural tRNA substrates (e.g. the acceptor and T-stem) (Figure 1A). Recent studies have shown that expression of EGSs in tissue culture inhibits the gene expression of herpes simplex virus and influenza virus and furthermore, abolish the replication of influenza virus (17,18). To increase the targeting efficiency, the EGS can be covalently linked to M1 RNA (e.g. to the 3' end) to generate a sequence-specific ribozyme, M1GS RNA (Figure 1A) (15,19). In principle, any RNA could be targeted by a custom-designed M1GS for specific cleavage. When introduced in human cells, M1GS ribozyme can function independently from the endogenous human RNase P to cleave its target mRNA that base pairs with the guide sequence. Thus, RNase P ribozyme can be used as a tool both in basic research, such as the regulation of gene expression during developmental processes, and in clinical applications, such as gene therapy.
|
In the present study, we linked EGSs to M1 RNA to construct M1GS ribozymes to target the region of the mRNA encoding HCMV capsid scaffolding protein (CSP), and investigated the antiviral activity of the constructed ribozymes. CSP completely overlaps with and is within the 3' coding sequence of another viral capsid protein, assemblin (20). Both CSP and assemblin are believed to be essential for viral capsid formation and CMV replication, based on genetic and biochemical studies of the homologues of these proteins in other herpesviruses such as human herpes simplex virus 1 (HSV-1) (2123). Thus, CSP and assemblin may serve as targets for novel drug development to combat HCMV infection (24). We showed that the constructed ribozyme cleaves the target mRNA sequence in vitro. Moreover, intracellular expression of the ribozyme using retroviral expression vectors leads to a significant inhibition of the expression of viral CSP and assemblin. A 4000-fold reduction in viral growth was observed in the ribozyme-expressing cells. Our study provides the direct evidence that RNase P ribozymes are highly effective in inhibiting HCMV gene expression and growth by targeting the CSP mRNA. These results also demonstrate the feasibility of developing highly effective RNase P ribozymes as a novel class of antiviral agents for treatment of human viral diseases.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies, viruses and cells
The polyclonal antibodies against HCMV assemblin and capsid scaffolding protein were kindly provided by Annette Meyer of Warner Lambert Co (Ann Arbor, MI). The monoclonal antibodies that react with HCMV UL44 and gH were purchased from Goodwin Institute for Cancer Research (Plantation, FL), while the monoclonal antibody against human actin was purchased from Sigma Inc (St Louis, MO). Cells (human fibroblasts and U373MG cells, and murine PA317 cells) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (v/v) fetal bovine serum. The propagation of HCMV (AD169) in human cells was carried out as described previously (25).
Ribozyme and substrate constructs
The DNA sequence that encodes substrate csp39 was constructed by PCR using pGEM3zf(+) as a template and oligonucleotides AF25 (5'-GGAATTCTAATACGACTCACTATAG-3') and sAP3 (5'-CGGGATCCGTAACGCTCCCATCCGGACGGTGGTTCATCCTATAGTGAGTCGTATTA-3') as 5' and 3' primers, respectively. Plasmid pFL117 and pC102 contain the DNA sequence coding for M1 RNA and mutant C102 driven by the T7 RNA polymerase promoter (26,27). C102 contains several point mutations (e.g. A347C348
C347U348, C353C354C355G356
G353G354A355U356) at the P4 catalytic domain of M1 RNA (26). The DNA sequences that encode ribozymes M1-F and M1-I were constructed by PCR using the DNA sequences of the M1 and C102 ribozymes as the templates and oligonucleotides AF25 and M1AP3 (5'-CCCGCTCGAGAAAAAATGGTGTCCGGATGGGAGCGTTATGTGGAATTGTG -3') as 5' and 3' primers, respectively.
In vitro assaying ribozyme activity
M1GS RNAs and the csp39 mRNA substrate were synthesized in vitro by T7 RNA polymerase (Promega Inc., Madison, WI) and further purified on 8% polyacrylamide gels containing 8 M urea. The procedures to measure the equilibrium dissociation constants (Kd) of the M1GS-csp39 complexes were modified from Pyle et al. (28) and have been described previously (25). The values of Kd were the average of three experiments. The cleavage reactions were carried out by incubating the ribozyme and [32P]-labeled mRNA substrate at 37°C in a volume of 10 µl for 30 min in buffer A (50 mM Tris, pH 7.5, 100 mM NH4Cl, and 100 mM MgCl2) (27). Cleavage products were separated in denaturing gels and quantitated with a STORM840 phosphorimager (Molecular Dynamics, Sunnyvale, CA).
Construction of ribozyme-expressing cells
The construction of U373MG cells expressing different ribozymes was carried out following the procedures as described previously (15). Amphotropic PA317 cells were transfected with retroviral vector DNAs (LXSN-M1-F and LXSN-M1-I) with the aid of a mammalian transfection kit purchased from GIBCO BRL (Grand Island, NY). Culture supernatants that contained retroviral vectors were then collected and used to infect U373MG cells. The retrovirus-infected cells were incubated in culture medium that contained 600 µg/ml neomycin, and subsequently selected in the presence of neomycin for two weeks and neomycin-resistant cells were cloned.
For northern analyses of the expression of the ribozymes, RNA fractions from M1GS-expressing cells were isolated, separated in gels that contained formaldehyde, transferred to nitrocellulose membranes, hybridized with the [32P]-radiolabeled DNA probes that contained the DNA sequence coding for M1 RNA and H1 RNA, and finally analyzed with a STORM840 phosphorimager. The radiolabeled DNA probe used to detect M1GS RNAs was synthesized from plasmid pFL117, by using a random primed labeling kit (Boehringer Manheim, Co., Indianapolis, IN).
Studies of viral gene expression and growth
5 x 105 cells were either mock-infected or infected with HCMV, then incubated for 872 h. Viral mRNAs and proteins were isolated as described previously (25). The multiplicity of infection (MOI) is specified as that in the Results section. To measure the levels of viral immediate-early (IE) transcripts, some of the cells were also treated with 100 µg/ml cycloheximide prior to and during infection. The RNA fractions were separated in agarose gels that contained formaldehyde, transferred to nitrocellulose membranes, hybridized with the [32P]-radiolabeled DNA probes that contained the HCMV or human ß-actin DNA sequences, and analyzed with a STORM840 Phosphorimager. The DNA probes used to detect M1GS RNAs, human ß-actin mRNA, HCMV immediate-early 5 kb RNA transcript, IE1 mRNA, US2 mRNA and CSP mRNA were synthesized from plasmids pFL117, pß-actin RNA, pCig27, pIE1, pCig38 and pCSP, respectively.
For western analyses, the polypeptides from cell lysates were separated on either SDS/7.5% polyacrylamide gels or SDS/9% polyacrylamide gels cross-linked with N,N''-methylenebisacylamide, and transferred electrically to nitrocellulose membranes. We stained the membranes using the antibodies against HCMV proteins and human actin in the presence of a chemiluminescent substrate (Amersham Inc., Arlington Heights, IL), and analyzed the stained membranes with a STORM840 phosphorimager. Quantitation was performed in the linear range of RNA and protein detection.
To determine the level of the inhibition of viral growth, 5 x 105 cells were either mock-infected or infected with HCMV at an MOI of 15 (25). The cells and medium were harvested at 1, 2, 3, 4, 5, 6 and 7 days postinfection. Viral stocks were prepared and their titers were determined by performing plaque assays on human foreskin fibroblasts (25). The values obtained were the average from triplicate experiments.
Assaying the level of viral genome replication
5 x 105 cells were mock-infected or infected with HCMV and were harvested at 4896 h postinfection. Total and encapsidated (DNase I-treated) DNAs were isolated essentially as described (21,22) and used as the PCR templates.
Viral DNA was detected by PCR amplification of the viral IE1 sequence, using human ß-actin sequence as the internal control. The 5' and 3' primers were CMV3 (5'-CCAAGCGGCCTCTGATAACCAAGCC-3') and CMV4 (5'-CAGCACCATCCTCCTCTTCCTCTGG-3'), respectively (29), while those used to amplify the actin sequence were Actin5 (5'-TGACGGGGTCACCCACACTGTGCCCATCTA-3') and Actin3 (5'-CTAGAAGCATTGCGGTGGCAGATGGAGGG-3'), respectively (30). PCR cycles and other conditions were optimized to assure that the amplification was within the linear range.
The PCR reactions were performed in the presence of
-[32P]-dCTP and the radiolabeled DNA samples were separated on polyacrylamide gels and then scanned with a STORM840 phosphorimager. A standard (dilution) curve was generated by amplifying different dilutions of the template DNA. The plot of counts for both HCMV and ß-actin versus dilutions of DNA did not reach a plateau for the saturation curve (data not shown) under the conditions described above, indicating that quantitation of viral DNA could be accomplished. Moreover, we observed that the ratio of viral DNA to ß-actin remained constant with respect to each DNA dilution in the standard curve, suggesting that the assay is adequately accurate and reproducible. The PCR results were derived from three independent experiments.
| RESULTS |
|---|
|
|
|---|
In vitro cleavage of HCMV mRNA sequence by M1GS ribozyme
To achieve efficient ribozyme-mediated cleavage, the targeted mRNA sequence should be accessible and should not be associated with proteins or in a highly organized and folded conformation. Our initial experiment was to find a targeted region of the CSP mRNA that is accessible to binding of ribozymes. Using dimethyl sulfate (DMS), we employed an in vivo mapping approach (15,31,32) to determine the accessibility of the region of the CSP mRNA in HCMV-infected cells, and chosen a position, 441 nucleotides downstream from the CSP translational initiation codon (33) as the cleavage site for M1GS RNA. This site appears to be one of the regions most accessible to DMS modification, and presumably to ribozyme binding as well.
A functional ribozyme, M1-F, was constructed by covalently linking the 3' terminus of M1 RNA with a guide sequence of 18 nt that is complementary to the targeted mRNA sequence. An inactive ribozyme, M1-I, which served as a control, was also constructed in a similar way and included in the study. M1-I was derived from C102 RNA, a M1 mutant that contained several point mutations at the catalytic P4 domain and was at least 104-fold less active than M1 RNA in cleaving a pre-tRNA (26). A substrate, csp39, which contained the targeted mRNA sequence of 39 nt, was used (Figure 1B). The ribozymes and RNA substrates were synthesized in vitro, and then incubated for assaying ribozyme cleavage. In the absence of M1 RNAs (Figure 2, lane 1), no cleavage of csp39 was detected. Efficient cleavage of the substrate by functional ribozyme M1-F was observed (Figure 2, lane 3). In contrast, cleavage by inactive ribozyme M1-I was barely detected (Figure 2, lane 2). Experiments with gel shift assays (25,28) indicate that the binding affinity of M1-I to substrate csp39 (Kd = 0.12 ± 0.03 nM), measured as the dissociation constant (Kd), is similar to that of M1-F (Kd = 0.10 ± 0.02 nM). Since M1-I contains the same antisense guide sequence and similar affinity to csp39 as M1-F but is catalytically inactive, this ribozyme can be used as a control for the antisense effect in our experiments in cultured cells (see below).
|
Ribozyme expression in human cells
The DNA sequences coding for M1-F and M1-I were cloned into retroviral vector LXSN and placed under the control of the small nuclear U6 RNA promoter. This promoter, which has previously been shown to express M1GS RNA and other RNAs steadily, is transcribed by RNA polymerase III, and its transcripts are highly expressed (15,16,34,35). To construct cell lines that express M1GS ribozymes, amphotropic packaging cells (PA317) (36) were transfected with LXSN-M1GS DNAs to produce retroviral vectors that contained the genes for M1GS RNA. Human U373MG cells were then infected with these vectors, and cells expressing the ribozymes were cloned. To determine whether M1GS RNA with an incorrect guide sequence could target the CMV mRNA in tissue culture, we also constructed an additional cell line that expressed ribozyme M1-TK, which targeted the mRNA for thymidine kinase (TK) of herpes simplex virus (HSV-1) (27). No cleavage of substrate csp39 by M1-TK was observed in vitro (Figure 2, lane 4).
Northern analyses were used to determine the level of M1GS RNA in each cell clone. The M1GS RNAs were expressed in the cells as they were detected in the RNA fractions using H1 RNA, which is the RNA subunit of human RNase P (10), as the internal control (Figure 3). The different levels of ribozyme expression between the two cloned cell lines (compare Figure 3, lanes 2 and 3) are presumably due to the incorporation of the LXSN-M1GS sequence into different locations of the host chromosome, and its expression is influenced by the flanking sequence at the insertion site. Only the cell lines that expressed similar levels of these ribozymes were used for further studies in tissue culture.
|
Ribozyme inhibition of viral gene expression
To determine if M1GS inhibits CMV gene expression, cells were infected with HCMV at a multiplicity of infection of 0.051. Total RNAs were isolated from the infected cells at 872 h postinfection. The expression levels of CSP and assemblin mRNAs were determined by northern analyses. The level of the 5 kb long viral immediate-early transcript (5 kb RNA), which expression is not regulated by assemblin and CSP under the assay conditions (37), was used as an internal control for the quantitation of expression of the target mRNAs (Figure 4A). A reduction of about 90 ± 8% and 90 ± 7% (average of three experiments) in the expression levels of CSP and assemblin mRNA was observed in cells that expressed M1-F, respectively (Figure 4B, Table 1). In contrast, a reduction of <10% in the expression levels of these two mRNAs was observed in cells that expressed M1-I or M1-TK. Our experiments also showed that the protein levels of CSP in M1-F-expressing cells are reduced. Proteins were isolated from cells at 2472 h postinfection, separated in SDSpolyacrylamide gels, and transferred to identical membranes. One of these membranes was stained with an anti-CSP antibody and another membrane was stained with a monoclonal antibody against human actin (anti-Actin) (Figure 4C and D). The latter serves as an internal control for the quantitation of the CSP protein expression. A reduction of
85% in the protein level of CSP (from three independent experiments) was observed in cells that expressed M1-F while a reduction of <10% was found in cells that expressed M1-I or M1-TK RNAs. The low level of inhibition found in cells that expressed M1-I is presumably due to an antisense effect because M1-I exhibits similar binding affinity to the target sequence as M1-F but is catalytically inactive. These results suggest that the significant reduction of CSP mRNA expression in cells that expressed M1-F is due to the targeted cleavage by the ribozyme.
|
|
Ribozyme-mediated inhibition of HCMV growth
To determine whether the growth of HCMV is inhibited in the ribozyme-expressing cells, the cells were infected by HCMV at an MOI of 15. We harvested the infected cultures (cells and culture medium together) at 1 day intervals through 7 days postinfection and determined the viral titers of these samples. No significant reduction was found in those that expressed M1-I or M1-TK (Figure 5, data not shown). However, after 5 days postinfection, a reduction of at least 4000-fold in viral yield was observed in cells that expressed M1-F (Figure 5). These results suggest that M1GS-mediated targeting of viral CSP mRNA effectively inhibits HCMV growth.
|
Blocking viral capsid maturation by ribozyme expression
CSP and its homologs from other herpesviruses, such as HSV-1, are believed to be essential for viral capsid maturation and assembly (21,22,24). Meanwhile, it is possible that the observed reduction of viral growth in the M1-F-expressing cells is not necessarily due to specific M1GS RNA-mediated cleavage of CSP mRNA but is due to other effects of the ribozyme on viral lytic replication that are unrelated to the consequence of the ribozyme cleavage or the inhibition of viral CSP expression. To further determine the antiviral mechanism of the M1GS-directed cleavage, two sets of experiments were performed to investigate the step of the viral lytic cycles that is blocked in the M1-F-expressing cells. First, we examined the expression of other viral genes. Inhibition of CSP/assemblin expression is not expected to affect the expression of other viral genes, including immediate-early (
), early (ß) and late (
) genes (1). Using northern analyses, we determined the expression levels of the IE1 (an
transcript) and US2 mRNA (a ß transcript) (Table 1). Western analyses were also used to assay the expression level of viral protein UL44, a viral late (ß
) protein and gH, a viral late (
) protein (Table 1). We observed no significant difference in the expression level of these genes in cells that expressed M1-F, M1-I or M1-TK (Table 1), suggesting that M1-F specifically inhibits the expression of its target, and does not affect the overall viral gene expression. The second set of experiments was performed to determine whether viral genomic replication as well as capsid maturation is affected in the ribozyme-expressing cells. Total DNA was isolated from HCMV-infected cell lysates and the level of intracellular viral DNA was determined by PCR detection of HCMV IE1 sequence, using the level of ß-actin DNA as the internal control. The amount of the intracellular viral DNA detected by the PCR assay should represent the replication level of the viral genome since HCMV only replicates in an episomal form and does not integrate its DNA into the host genome (1). To determine the level of mature capsid assembled in the infected cells and examine viral capsid formation, we assayed the level of encapsidated viral DNA. DNA samples were isolated from HCMV-infected cell lysates that were treated with DNase I. The encapsidated viral DNAs will be resistant to DNase I digestion while those that are not packaged in the capsid will be susceptible to degradation. We determined the levels of intracellular total and encapsidated viral DNA by PCR detection of HCMV IE1 sequence. When the DNA samples from cell lysates that were not treated with DNase I were assayed, no significant difference in the level of total intracellular (both encapsidated and uncapsidated) viral DNA were observed (Figure 6, lanes 46). However, when the samples were first treated with DNase I and then assayed, the encapsidated DNA was hardly detected in the cells that expressed M1-F (Figure 6, lanes 13). These observations suggest that M1GS-mediated inhibition of gene expression does not affect the replication of viral DNA but blocks DNA encapsidation and capsid formation.
|
| DISCUSSION |
|---|
|
|
|---|
Nucleic-acid-based gene interference strategies, such as antisense oligonucleotides, ribozymes or DNAzymes and RNA interference (RNAi), represent powerful research tools and promising therapeutic agents for human diseases (3). Each of these approaches has its own advantages and limitations in term of targeting efficacy, sequence specificity, toxicity and delivery efficiency in vivo. The M1GS-based technology represents an attractive approach for gene inactivation since it generates catalytic and irreversible cleavage of the target RNA by using M1 RNA, a highly active RNA enzyme found in nature (10,11). These properties, as well as the simple design of the guide sequence, make M1GS an attractive and unique gene-targeting agent that can be generally used for antiviral as well as other in vivo applications. For M1GS ribozyme to be successful as a therapeutic tool, the enzyme has to be highly active and the mechanism of delivery has to be extremely efficient. We have designed a M1GS RNA targeting the overlapping region of HCMV CSP and assemblin mRNAs. The ribozyme cleaved the target mRNAs efficiently in vitro and furthermore, reduced their expression levels by 8590% and inhibited viral growth by 4000-fold in cells that expressed the ribozyme. In contrast, a reduction of <10% in the levels of CSP expression and viral growth was observed in cells that expressed M1-I or M1-TK. M1-TK targets an unrelated mRNA and M1-I is catalytically inactive and contains the identical guide sequence to M1-F. Thus, the observed reduction in viral gene expression and inhibition of viral growth in the M1-F-expressing cells is primarily attributed to the specific targeted cleavage by the ribozyme as opposed to the antisense effect of the guide sequence.
Several lines of evidence presented in our study indicate that the activity of RNase P ribozymes is specific. First, expression of the ribozymes only inhibits the expression of CSP/assemblin. No reductions in the expression levels of other viral genes examined (e.g. IE1, UL44 and gH) were observed in M1GS-expressing cells (Table 1). Second, the ribozyme expression does not affect the replication of viral genomic DNA (Figure 6). Third, the inhibition of viral growth and capsid maturation appears to result from the reduction of CSP and assemblin. We observed that the levels of DNA encapsidation and the expression of CSP were greatly decreased in the M1-F-expressing cells but not in the control cells expressing M1-I or M1-TK (Figures 4 and 6, data not shown). Fourth, no significant differences in terms of growth and viability of the constructed ribozyme-expressing cell lines and the parental cells were found for up to three months (data not shown), suggesting that the ribozymes do not significantly interfere with cellular gene expression and that expression of the ribozymes did not exhibit significant cytotoxicity. Together, these results suggest that M1GS RNA specifically inhibit only the expression of its target mRNA and does not affect the expression of other viral genes and genome replication.
HCMV is a member of the human herpesvirus family, which includes seven other different viruses such as herpes simplex virus and EpsteinBarr virus (1,38,39). Homologs of CSP can be found in other herpesviruses and are believed to be involved in capsid assembly and formation (1). Our results presented in this study indicate that M1GS RNA-mediated inhibition of the expression of HCMV CSP leads to a
4000-fold reduction of viral growth, and suggest that blocking of its expression leads to effective antiviral therapy.
We have previously shown that M1GS RNA inhibited the expression of HCMV IE1/IE2 and HSV-1 ICP4 protein as well as the replication of HCMV and HSV-1 (25,40). The levels of inhibition of CSP/assemblin expression observed in this study are similar to those of inhibition of the expression of HSV-1 ICP4 protein and HCMV IE1/IE2. However, the level of inhibition (4000-fold) of HCMV growth by M1-F is 4-fold better than that of inhibition of HSV-1 replication and at least 40-fold higher than that by the ribozyme against IE1/IE2 mRNAs (25,40). Thus, the efficacy of the ribozyme in inhibiting viral growth might be dependent on the nature of the gene target. Moreover, our results suggest that CSP may serve as the better targets for M1GS-mediated gene targeting approach for the treatment of herpesvirus infections.
To successfully use M1GS ribozyme for clinical applications, the ribozymes need to be delivered specifically into target tissues and cell types. In our study, using a retroviral expression vector, the ribozymes were delivered into cultured cells and were stably expressed in the cells. Further studies on developing novel viral expression vectors, including lentiviral and adeno-associate virus-based expression vectors, as well as using tissue- and cell-type-specific promoter expression cassettes will lead to specific and efficient delivery and expression of the ribozymes in a target tissue and cell type. These studies, in combination with further engineering M1GS RNAs to increase their cleavage activity and specificity, will significantly facilitate the development of more active and effective RNase P ribozymes for gene targeting applications including therapy of human cancer and viral diseases.
| ACKNOWLEDGEMENTS |
|---|
We thank Annette Meyer of Warner Lambert Co. for anti-CMV antibodies. P.T. is a recipient of a predoctoral fellowship from American Heart Association (Western States Affiliate). K.K. is partially supported by a Block Grant Predoctoral Fellowship (UC-Berkeley). F.L. is a Scholar of Leukemia and Lymphoma Society, and a recipient of an Established Investigator Award of American Heart Association. The research has been supported by grants from March of Dimes Birth Defects Foundation, American Heart Association, and NIH.
| REFERENCES |
|---|
|
|
|---|
- Mocarski,E.S. and Courcelle,C.T. ( (2001) ) Cytomegaloviruses and their replication. In Knipe,D.M. and Howley,P.M. (eds), Fields Virology. Lippincott-Williams & Wilkins, Philadelphia, PA, pp. 26292673.
- Pass,R.F. ( (2001) ) Cytomegalovirus. In Knipe,D.M. and Howley,P.M. (eds), Fields Virology. Lippincott-Williams & Wilkins, Philadelphia, PA, pp. 26752706.
- Scherer,L.J. and Rossi,J.J. ( (2003) ) Approaches for the sequence-specific knockdown of mRNA. Nat. Biotechnol., , 21, , 14571465.[CrossRef][Web of Science][Medline]
- Wong-Staal,F., Poeschla,E.M. and Looney,D.J. ( (1998) ) A controlled, Phase 1 clinical trial to evaluate the safety and effects in HIV-1 infected humans of autologous lymphocytes transduced with a ribozyme that cleaves HIV-1 RNA. Hum. Gene Ther., , 9, , 24072425.[Web of Science][Medline]
- Yu,M., Ojwang,J., Yamada,O., Hampel,A., Rapapport,J., Looney,D. and Wong-Staal,F. ( (1993) ) A hairpin ribozyme inhibits expression of diverse strains of human immunodeficiency virus type 1. Proc. Natl Acad. Sci. USA, , 90, , 63406344.
[Abstract/Free Full Text] - zu Putlitz,J., Yu,Q., Burke,J.M. and Wands,J.R. ( (1999) ) Combinatorial screening and intracellular antiviral activity of hairpin ribozymes directed against hepatitis B virus. J. Virol., , 73, , 53815387.
[Abstract/Free Full Text] - Sarver,N., Cantin,E.M., Chang,P.S., Zaia,J.A., Ladne,P.A., Stephens,D.A. and Rossi,J.J. ( (1990) ) Ribozymes as potential anti-HIV-1 therapeutic agents. Science, , 247, , 12221225.
[Abstract/Free Full Text] - Lan,N., Howrey,R.P., Lee,S.W., Smith,C.A. and Sullenger,B.A. ( (1998) ) Ribozyme-mediated repair of sickle beta-globin mRNAs in erythrocyte precursors. Science, , 280, , 15931596.
[Abstract/Free Full Text] - Rossi,J.J. ( (1999) ) Ribozymes, genomics and therapeutics. Chem. Biol., , 6, , R33R37.[CrossRef][Web of Science][Medline]
- Altman,S. and Kirsebom,L.A. ( (1999) ) Ribonuclease P. In Gesteland,R.F., Cech,T.R., and Atkins,J.F. (eds), The RNA world. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp. 351380.
- Frank,D.N. and Pace,N.R. ( (1998) ) Ribonuclease P: unity and diversity in a tRNA processing ribozyme. Annu. Rev. Biochem., , 67, , 153180.[CrossRef][Web of Science][Medline]
- Guerrier-Takada,C., Gardiner,K., Marsh,T., Pace,N. and Altman,S. ( (1983) ) The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell, , 35, , 849857.[CrossRef][Web of Science][Medline]
- Forster,A.C. and Altman,S. ( (1990) ) External guide sequences for an RNA enzyme. Science, , 249, , 783786.
[Abstract/Free Full Text] - Guerrier-Takada,C., Li,Y. and Altman,S. ( (1995) ) Artificial regulation of gene expression in Escherichia coli by RNase P. Proc. Natl Acad. Sci. USA, , 92, , 1111511119.
[Abstract/Free Full Text] - Liu,F. and Altman,S. ( (1995) ) Inhibition of viral gene expression by the catalytic RNA subunit of RNase P from Escherichia coli. Genes Dev., , 9, , 471480.
[Abstract/Free Full Text] - Yuan,Y., Hwang,E. and Altman,S. ( (1992) ) Targeted cleavage of mRNA by human RNase P. Proc. Natl Acad. Sci. USA, , 89, , 80068010.
[Abstract/Free Full Text] - Plehn-Dujowich,D. and Altman,S. ( (1998) ) Effective inhibition of influenza virus production in cultured cells by external guide sequences and ribonuclease P. Proc. Natl Acad. Sci. USA, , 95, , 73277332.
[Abstract/Free Full Text] - Kawa,D., Wang,J., Yuan,Y. and Liu,F. ( (1998) ) Inhibition of viral gene expression by human ribonuclease P. RNA, , 4, , 13971406.[Abstract]
- Frank,D., Harris,M. and Pace,N.R. ( (1994) ) Rational design of self-cleaving pre-tRNA-Ribonuclease P RNA conjugates. Biochemistry, , 33, , 1080010808.[CrossRef][Medline]
- Welch,A.R., Woods,A.S., McNally,L.M., Cotter,R.J. and Gibson,W. ( (1991) ) A herpesvirus maturational proteinase, assemblin: identification of its gene, putative active site domain, and cleavage site. Proc. Natl Acad. Sci. USA, , 88, , 1079210796.
[Abstract/Free Full Text] - Gao,M., Matusick-Kumar,L., Hurlburt,W., DiTusa,S.F., Newcomb,W.W., Brown,J.C., McCann,P.J., Deckman,I. and Colonno,R.J. ( (1994) ) The protease of herpes simplex virus type 1 is essential for functional capsid formation and viral growth. J. Virol., , 68, , 37023712.
[Abstract/Free Full Text] - Matusick-Kumar,L., Hurlburt,W., Weinheimer,S.P., Newcomb,W.W., Brown,J.C. and Gao,M. ( (1994) ) Phenotype of the herpes simplex virus type 1 protease substrate ICP35 mutant virus. J. Virol., , 68, , 53845394.
[Abstract/Free Full Text] - Preston,V.G., Coates,J.A. and Rixon,F.J. ( (1983) ) Identification and characterization of a herpes simplex virus gene product required for encapsidation of virus DNA. J. Virol., , 45, , 10561064.
[Abstract/Free Full Text] - Gibson,W., Welch,A.R. and Ludford,J.M. ( (1994) ) Transient transfection assay of the herpesvirus maturational proteinase, assemblin. Meth. Enzymol., , 244, , 399411.[Web of Science][Medline]
- Trang,P., Lee,M., Nepomuceno,E., Kim,J., Zhu,H. and Liu,F. ( (2000) ) Effective inhibition of human cytomegalovirus gene expression and replication by a ribozyme derived from the catalytic RNA subunit of RNase P from Escherichia coli. Proc. Natl Acad. Sci. USA, , 97, , 58125817.
[Abstract/Free Full Text] - Kim,J.J., Kilani,A.F., Zhan,X., Altman,S. and Liu,F. ( (1997) ) The protein cofactor allows the sequence of an RNase P ribozyme to diversify by maintaining the catalytically active structure of the enzyme. RNA, , 3, , 613623.[Abstract]
- Kilani,A.F., Trang,P., Jo,S., Hsu,A., Kim,J., Nepomuceno,E., Liou,K. and Liu,F. ( (2000) ) RNase P ribozymes selected in vitro to cleave a viral mRNA effectively inhibit its expression in cell culture. J. Biol. Chem., , 275, , 1061110622.
[Abstract/Free Full Text] - Pyle,A.M., McSwiggen,J.A. and Cech,T.R. ( (1990) ) Direct measurement of oligonucleotide substrate binding to wild-type and mutant ribozymes from Tetrahymena. Proc. Natl Acad. Sci. USA, , 87, , 81878191.
[Abstract/Free Full Text] - Demmler,G.J., Buffone,G.J., Schimbor,C.M. and May,R.A. ( (1988) ) Detection of cytomegalovirus in urine from newborns by using polymerase chain reaction DNA amplification. J. Infect. Dis., , 158, , 11771184.[Web of Science][Medline]
- Daftarian,P.M., Kumar,A., Kryworuchko,M. and Diaz-Mitoma,F. ( (1996) ) IL-10 production is enhanced in human T cells by IL-12 and IL-6 and in monocytes by tumor necrosis factor-alpha. J. Immunol., , 157, , 1220.[Abstract]
- Ares,M. and Igel,A.H. ( (1990) ) Lethal and temperature-sensitive mutations and their suppressors identify an essential structural element in U2 small nuclear RNA. Genes Dev., , 4, , 21322145.
[Abstract/Free Full Text] - Zaug,A.J. and Cech,T.R. ( (1995) ) Analysis of the structure of Tetrahymena nuclear RNAs in vivo: telomerase RNA, the self-splicing rRNA intron, and U2 snRNA. RNA, , 1, , 363374.[Abstract]
- Chee,M.S., Bankier,A.T., Beck,S., Bohni,R., Brown,C.M., Cerny,R., Horsnell,T., Hutchison,C.A., Kouzarides,T. and Martignetti,J.A. ( (1990) ) Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Curr. Top. Microbiol. Immunol., , 154, , 125169.[Web of Science][Medline]
- Bertrand,E., Castanotto,D., Zhou,C., Carbonnelle,C., Lee,N.S., Good,P., Chatterjee,S., Grange,T., Pictet,R., Kohn,D., Engelke,D. and Rossi,J.J. ( (1997) ) The expression cassette determines the functional activity of ribozymes in mammalian cells by controlling their intracellular localization. RNA, , 3, , 7588.[Medline]
- Das,G., Henning,D., Wright,D. and Reddy,R. ( (1988) ) Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III. EMBO J., , 7, , 503512.[Web of Science][Medline]
- Miller,A.D. and Rosman,G.J. ( (1989) ) Improved retroviral vectors for gene transfer and expression. BioTechniques, , 7, , 980990.[Web of Science][Medline]
- Zhu,H., Cong,J.P. and Shenk,T. ( (1997) ) Use of differential display analysis to assess the effect of human cytomegalovirus infection on the accumulation of cellular RNAs: induction of interferon-responsive RNAs. Proc. Natl Acad. Sci. USA, , 94, , 1398513990.
[Abstract/Free Full Text] - Roizman,B. and Knipe,D.M. ( (2001) ) Herpes simplex viruses and their replication. In Knipe,D.M. and Howley,P.M. (eds), Fields Virology. 3rd edn. Lippincott-Williams & Wilkins, Philadelphia, PA, Vol. 2, pp. 23992460.
- Kieff,E. and Rickinson,A.B. ( (2001) ) EpsteinBarr viruses and its replication. In Knipe,D.M. and Howley,P.M. (eds), Fields Virology, 3rd edn. Lippincott-Williams & Wilkins, Philadelphia, PA., Vol. 2, pp. 25112573.
- Trang,P., Kilani,A.F., Kim,J. and Liu,F. ( (2000) ) A ribozyme derived from the catalytic subunit of RNase P from Escherichia coli is highly effective in inhibiting replication of herpes simplex virus 1. J. Mol. Biol., , 301, , 817826.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





