Skip Navigation

Nucleic Acids Research 2004 32(18):5693-5702; doi:10.1093/nar/gkh906
This Article
Right arrow Abstract Freely available
Right arrow Print PDF (392K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (37)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Hollenhorst, P. C.
Right arrow Articles by Graves, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hollenhorst, P. C.
Right arrow Articles by Graves, B. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published online 21 October 2004

Nucleic Acids Research, Vol. 32 No. 18 © Oxford University Press 2004; all rights reserved

Expression profiles frame the promoter specificity dilemma of the ETS family of transcription factors

Peter C. Hollenhorst, David A. Jones and Barbara J. Graves*

Department of Oncological Sciences, Huntsman Cancer Institute, 2000 Circle of Hope, University of Utah, Salt Lake City, UT 84112, USA

* To whom correspondence should be addressed. Tel: +1 801 581 7308; Fax: +1 801 585 1980; Email: Barbara.Graves{at}utah.edu

Received September 16, 2004; Revised and Accepted October 7, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sequence-specific DNA binding proteins that function as transcription factors are frequently encoded by gene families. Such proteins display highly conserved DNA binding properties, yet are expected to retain promoter selectivity. In this report we investigate this problem using the ets gene family, a group of metazoan genes whose members regulate cell growth and differentiation and are mutated in human cancers. We tested whether the level of mRNA can serve as a specificity determinant. The mRNA levels of the 27 paralogous human ets genes were measured in 23 tissues and cell lines. Real-time RT–PCR provided accurate measurement of absolute mRNA levels for each gene down to one copy per cell. Surprisingly, at least 16 paralogs were expressed in each cell sample and over half were expressed ubiquitously. Tissues and complementary cell lines showed similar expression patterns, indicating that tissue complexity was not a limitation. There was no unique, highly expressed gene for each cell type. Instead, one of only eight ets genes showed the highest expression in all samples. DNA binding studies illustrate both overlapping and unique specificities for ubiquitous ETS proteins. These findings establish the parameters of the promoter specificity dilemma within the ets family of transcription factors.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expansion of the repertoire of functional gene products during evolution has relied upon conservation of protein domains. Consequently, in many eukaryotic genomes, relatively large gene families encode proteins that have highly conserved domains. The functional redundancies of these domains bring into question how individual proteins can participate in biological regulation. The activity of each family member in an individual cell depends on both its molecular properties and relative expression level. Therefore, a catalog of the expression levels of each family member is a necessary backdrop for answering the question of biological specificity.

Specificity is a particularly vexing issue in a gene family that encodes DNA binding transcription factors. The conserved DNA binding domain directs the protein to transcriptional targets, a process that represents the most critical route to specific biological function. The ets gene family illustrates this dilemma. These metazoan genes encode proteins with a well characterized DNA binding domain, termed the ETS domain (1,2). Structural studies illustrate that the mode of DNA binding is strongly conserved among ETS domains and indicate that amino acid sequence differences do not dramatically alter the DNA–protein interface (1). Indeed, site selection experiments with 12 different ETS domains reveal that each prefers a consensus sequence with the same core motif, 5'-GGA(A/T)-3', and additional preferences outside this core often show similarity (2,3). Although preference for sequences flanking this core motif can distinguish some family members in in vitro DNA binding assays, these sequences may not preclude the binding of any ETS protein in vivo. Based on this functional similarity, we propose that multiple ETS proteins could recognize a 5'-GGA(A/T)-3' motif within a particular promoter.

The functional diversity of ETS proteins suggests that target site selection is critical for biological regulation. There are 26 paralogous ets genes in the mouse genome (4), 8 in Drosophila (5) and 10 in Caenorhabditis elegans (6). The human genome has 27 human ets genes, including an apparent ortholog of every mouse ets gene, plus TEL2. The ets genes are subdivided into subgroups by a sequence comparison within the predicted ETS domain [(2,7), see also Figure 2]. Outside the ETS domain, there is significant sequence divergence, allowing ETS proteins to be either activators or repressors and to respond uniquely to signaling pathways (1,2,8). The diverse functions of ets family members are also revealed in genetic studies in mouse (1), Drosophila (5) and C.elegans (9), in which mutation of individual ets genes causes distinct phenotypes. In spite of considerable evidence for non-redundant function, biological roles of ets genes are linked to regulation of specific genes only in a few cases.

The targeting of an ETS protein to a specific promoter depends on the active protein concentration and the affinity for the promoter. The apparent affinity is determined by intrinsic affinity for the sequence of the binding site as well as interactions with other proteins, with both processes subject to regulation by post-translational modifications (1,2,10,11). Cooperative DNA binding offers a particularly attractive mechanism to facilitate promoter selectivity. However, the potency of this regulatory strategy can vary. For example, whereas GABP{alpha}/GABPß and PU.1/PIP1 partnerships appear specific (1214), SRF can bind DNA cooperatively with three ETS proteins (ELK1, SAP1, and NET) (1), and PAX5 with five (ETS1, FLI1, GABP{alpha}, NET, and ELK1) (15,16). Such promiscuities indicate that deciphering promoter selectivity requires a more global understanding of ets biology, including a comprehensive tally of which ets genes are expressed and which targets are regulated in any cell type.

To catalog the expression pattern of each ets gene, a quantitative RT–PCR strategy was developed that measured absolute levels of ets mRNA in 23 human tissues and cell lines. Each cell sample contained mRNAs for approximately two-thirds of the 27 human ets paralogs. About half of the ets genes were expressed in all cell types examined and, thus, were classified as ubiquitous. Our results placed previously reported tissue specificities into a broader context and uncovered additional cell type specific expression. These findings highlight the severity of the promoter selectivity problem in the ets gene family and provide direction for its investigation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PCR primers and templates
Gene specific oligonucleotides used for RT–PCR (Table 1) were designed by the Primer III software at http://www.broad.mit.edu/cgi-bin/primer/primer3_www.cgi (17). Default parameters were used except a GC clamp of 2 bp. Primers were designed to flank an intron to detect any genomic DNA contamination. In genes that are alternatively spliced, have alternate transcription start sites, or display alternative polyadenylation sites, primers were designed to amplify a common element in all alternative products. Blast searches were used to ensure that primers were specific for each individual ets gene. Primer sets amplified a single product of the correct size from a complex cDNA pool [total human RNA reverse transcribed with a mixture of random hexamers and oligo-d(T)] as measured by melting curve analysis on the light cycler system (Roche) and agarose gel electrophoresis.


View this table:
[in this window]
[in a new window]
 
Table 1. Primers used for real-time PCR

 
Only one primer set, FEV, displayed multiple products. Sequencing revealed templating from FEV cDNA and ERG cDNA. We were unable to identify a better primer set possibly due to high GC content around the only two introns in FEV. Only the FEV product was observed in prostate and small intestine. The ERG product was observed in endothelial cells.

Gene specific PCR products from RT–PCR were cloned into the Sma1 site of puc19. Purified plasmid DNA was linearized, gel purified, then quantified by UV spectrometry to generate reagents for standard curves. One plasmid concentration from each standard curve was compared by real-time PCR with primers specific to the puc19 backbone. Consistent UV spectrometry and DNA dilution was judged by <10% variation between a sample point from each standard curve.

cDNA preparation
RNA was prepared from cell lines and primary umbilical vein endothelial cells by Trizol extraction according to instructions (Invitrogen). BD Biosciences Clontech provided whole tissue total RNA. These tissue RNAs were pooled from between 3 and 45 individuals with the exception of heart, brain and stomach, which were individual samples. Reverse transcription reactions were performed at 55°C with Superscript III reverse transcriptase (Invitrogen) according to the instructions except that no dithiothreitol was used. Each reaction included sequence specific primers for ≤14 ets genes plus 18S rRNA to create a cDNA pool. An aliquot of 1 pmol of the most 3' primer for each gene was included in the reaction. In controls using a subset of ets mRNAs, reverse transcription with alternative 3' primers revealed minor efficiency differences (standard errors were <5% of the mean). Reverse transcriptase processivity was observed over a distance of up to one kilo base, the longest distance from the reverse primer that was used for PCR. cDNA products were further processed by digesting RNA for 20 min with 4 U of RNase H (Fermentas), and then purified using a PCR cleanup kit (Qiagen). For the purposes of quantification, we assumed that RNA preparation and reverse transcription was 100% efficient.

Real-time PCR
Real-time PCR was performed with the LightCycler FastStart DNA Master SYBR Green I system (Roche). PCR was performed according to instructions with 3 mM MgCl2, an annealing time of 5 s and an extension time of 12 s. Annealing temperature was 63°C, except for assays with primer sets ETS2-a, ER81-a, SAP1 and ESE3-a that were performed at 57°C. Each cDNA assay included a primer set and the cDNA template, derived from 30 ng of total RNA. Each experiment included a minus-template control and five assays to create a standard curve that contained 103, 104, 105, 106 and 107 copies of the gene specific linear plasmid as template. All primers generated standard curves with excellent linear fits (R values = 1.00) and showed a single sharp melting peak. cDNA levels in each sample were measured using the Fit Points Method of the LightCycler Software. A noise band was set in the log-linear phase of each sample curve. The software plotted the cycle number of the crossing point of each standard versus the copy number present in the standard. The copy number of each cDNA sample was extrapolated from this standard curve. Simple repetitions of a subset of measurements revealed excellent reproducibility with standard errors that averaged <5% of the mean and never exceeded 15%. In light of the ~2-fold error inherent in this assay (Figure 1), we judged this experimental repetition with its minimal error to be unnecessary. Three criteria required for the accuracy shown in Figure 1 included the use of gene specific oligonucleotides rather than random hexamers or oligo d(T) for reverse transcription, the use of plasmids rather than PCR products for standard curves, and the use of primer sets that gave a product with a single sharp peak in the melting curve.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 1. Absolute values for mRNA levels are accurate to one copy per cell. The expression of ETS2, ER81, E1AF, ESE2 and SPIB in 23 cell samples was measured by real-time RT–PCR with gene specific primers (Table 1). Values were converted to mRNA copies per cell by the use of a standard curve and 18S rRNA as an internal control. Each cDNA measurement was repeated with an independent primer set. The fold difference (value 1/value 2) between the two measurements was 2-fold or less in the gray area. Of 61 measurements equal to or greater than one copy per cell, 59 (97%) showed <2-fold error. This error was not significantly different for each individual gene and can therefore be considered gene independent.

 
Use of 18S rRNA as a standard
The mean of two measurements of the reverse transcribed product of 18S rRNA was used to standardize cDNA copy number for each cell sample. The standard error between these measurements was ≤11% of the mean. The 18S rRNA copy number per cell was estimated only for cell lines. Cell number was counted using plates prepared in parallel to those used for RNA harvest. The number of cell equivalents present in each real-time PCR reaction was used to calculate 18S rRNA copy number per cell. The 18S rRNA copy number per cell ranged from 4 x 105 to 4 x 106 with a mean of 2 x 106. This estimate was similar to a previous estimate of 3 x 106 ribosomes in a HeLa cell (18).

Chromatin immunoprecipitation
Crosslinking of 1 x 107 cells was performed as described previously (19) for 15 min at room temperature. Nuclei were prepared from fixed cells as described previously (20). Nuclei were resuspended in 0.5 ml of sonication buffer (19) and sonicated four (HCT116 cells) or six (Jurkat cells) times for 30 s resulting in chromatin averaging 1000 bp. Chromatin was diluted with 5 ml dilution buffer, 20 mM Tris (pH 7.9), 2 mM EDTA, 150 mM NaCl, 1% Triton X-100 and mammalian protease inhibitors (Sigma). Chromatin was precleared with 300 µl of a 50% slurry of a 1:1 mixture of pre-blocked Protein A and G agarose beads (Upstate Biotechnology) for 1 h at 4°C. One milliliter of precleared chromatin was rotated overnight at 4°C with 10 µl of the rabbit polyclonal antibodies ETS1 (21), ETS2 (22), ETS1/2 (sc-351 Santa Cruz), ELK1 (sc-355 Santa Cruz) or rabbit IgG (Santa Cruz). Chromatin/antibody was rotated with 60 µl of the Protein A/G mixture for 6 h. Agarose beads were washed six times with IP wash buffer, 10 mM Tris (pH 7.9), 1 mM EDTA, 0.5 mM EGTA, 200 mM NaCl, 0.05% SDS, 0.25% NP-40. Immunoprecipitated DNA was prepared and PCR was performed as described previously (23) with the following primers; albumin 5' ggtatgcctggcccaagtactc; 3' gatccctgtcccacatgtacaaagc; 5' EGR1 cttatttgggcagcaccttatttgg; 3' ggatccgcctctatttgaagg; CDC2L2 primers as described previously (24). Real-time PCR was used to analyze enrichment of albumin and CDC2L2 DNA using the same primer sets except that 3' albumin was ctccttatcgtcagccttgc.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Measurement of ets mRNA levels by real-time RT–PCR
To facilitate comparison of mRNA levels across multiple cell samples for multiple genes we measured both absolute and relative levels of mRNA by real-time RT–PCR. Data were tabulated in two dimensions for comparative purposes. The first, termed the ets family profile, compared the relative expression of each ets gene in a single cell type and required the measurement of absolute levels of different cDNAs from the same cell sample. The second dimension, the ets gene profile compared the relative expression of a single ets gene across multiple cell types. To compare different samples, ets mRNA levels were normalized to the levels of 18S rRNA. The reported units, mRNA copy number per cell, assumed a hypothetical cell that contains 2 x 106 18S rRNA molecules (see Materials and Methods).

Control experiments established the sensitivity and accuracy of our approach. Real-time PCR is often used to monitor relative changes in the expression level of a single gene (25). In contrast, we needed to measure absolute levels of different genes. To test the accuracy of real-time PCR for absolute measurements, two distinct primer sets for five different ets gene cDNAs interrogated cDNAs from 23 different cell samples. At the level of sensitivity of one copy per cell, the error between primer sets was <2-fold (Figure 1). Lower levels of ets gene expression could be biologically relevant, however, values below this level displayed a dramatic decrease in accuracy and were not reported. Similar controls in yeast studies have revealed the same level of error (2-fold or less) (26). We found several specific experimental criteria that were necessary to reduce error to this level (see Materials and Methods). We are not aware of any previous work using mammalian genes in which these controls were performed, therefore, this report can provide guidelines for the analysis of additional metazoan gene families.

ets family profiles in human cell samples
By measuring the mRNA levels for the 27 human ets genes, ets family profiles were created for 15 tissues and eight cell lines (Figure 2, columns). In the tissues, an average of 22 genes () was expressed (Figure 2, left columns). The cellular complexity of a tissue could cause an overestimation of the number of ets family members expressed. To evaluate the severity of this problem, eight established human cell lines were analyzed (Figure 2, right columns). A similar abundance of ets gene expression was observed with 19 genes detected per cell line (). Furthermore, cell lines with a matching tissue sample displayed similar expression patterns (Figure 3). The most highly expressed genes illustrated this trend: ETS1 in thymus and Jurkat cells, SPIB in spleen and Raji cells, ESE1 in colon and HCT116 cells, and PDEF in prostate and PC3 cells. Consistent with the co-expression of many ets genes in one cell type, HUVECs, which are primary endothelial cells lacking tissue-based complexity, expressed 19 ets genes, a total similar to the cell lines. Nevertheless, some cell type diversity is detectable in the tissue samples. For example, endothelial and hematopoietic cells likely reside in all tissues, consistent with the detection of PU.1, ERG, and FLI1 mRNA in all tissues. (These genes were abundantly expressed in these cell types as discussed below). In another example, the mRNA copy numbers for particular genes were usually slightly higher in cell lines than in matching tissues (Figure 3). This increased expression could be either a hallmark of transformed cells or simply due to cell type complexity in tissues diluting apparent mRNA levels. In spite of minor concerns for tissue complexity, the overall similarity between the tissue and cell line data suggested that tissues provided a valid profile of ets gene expression in a particular cell type.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Expression profiles for ets gene family demonstrate extensive co-expression. The expression of 27 human ets genes was measured by real-time RT–PCR with gene specific primers (Table 1). Horizontal lines separate ets genes into subgroups that are defined by similarity in the ETS domain. The mRNA copy number per cell was estimated as mRNA molecules per 2 x 106 18S rRNA molecules in the same sample. Values <1, indicated with an asterisk, could not be measured accurately (Figure 1). Each column represents values from a single RNA sample. Values for ESE2, ETS2, SPIB, E1AF and ER81 are the mean of mRNA level of the same cDNA sample with two independent primer sets. Since simple repetition gave much lower error (see Materials and Methods) than that inherent in the assay (Figure 1) such measurements were not deemed valuable and the error for all values should be assumed to be ~2-fold. Values in bold indicate the most highly expressed ets gene in a cell sample.

 


View larger version (24K):
[in this window]
[in a new window]
 
Figure 3. Ets family profile in tissues and matching cell lines are similar. The mRNA copy number per cell for all 27 human ets genes is compared between a tissue sample and a cell line representing a major cell type in that tissue (data from Figure 2). The off-scale mRNA values of ESE1 in colon and ESE3 in prostate are 449 and 669, respectively.

 
Taken together, the analyses of tissue and cell lines revealed abundant expression of the ets gene family with, on average, 21 ets genes expressed in each cell type (). On average, 11 genes () were expressed at levels >10 copies per cell and 1 () expressed at a level >100 copies per cell. Most individual mRNAs in mammalian cells are estimated to be present at levels <10 copies per cell with an upper limit of 500 copies per cell, except for rare cases (27,28). Thus, ets human paralogs are expressed at levels similar to estimates for most cellular mRNAs. Contrary to the simple expectation, there was no unique, predominant ets gene expressed in each cell type. Instead, only eight genes were scored as the highest expressing gene in a cell sample: ETS1, ETS2, ESE1, ESE3, PU.1, E1AF, GABP{alpha} and ERG (Figure 2, bold values). Furthermore, ETS1, ETS2 and ESE1 dominated this category. In summary, the co-expression of numerous ets genes in every cell sample indicates that many ETS proteins must be considered potential ETS-binding site regulators in any human system.

ets gene profiles in human cell samples
The distribution of expression of a single gene across diverse cell types (ets gene profile) provides clues to function. With our comprehensive approach, all human family members were analyzed in the same set of cell samples (Figure 2, rows). The ets family profiles predicted that a high number of ets genes would be expressed in all cells. Indeed, 14 of the 27 ets genes were expressed in at least 22 of the 23 cell samples and classified as ubiquitous (Figure 2, summarized in Table 2). The ubiquitously expressed ets genes tended to be in the ETS, ELF, TCF and ERF subgroups. The ubiquitous ets genes varied in expression levels, with some at high levels, such as ETS2 and GABP{alpha} (mean expression of 61 and 47, respectively), and some at low levels, such as ELF1 and ERF (mean expression of 12 and 6, respectively) (Figure 2).


View this table:
[in this window]
[in a new window]
 
Table 2. Classification of ubiquitous and cell type specific ets genes

 
Cell type specificity was observed to some degree for 16 of the 27 human ets genes (Figure 2, summarized in Table 2). Some genes, such as SPIB and SPIC, were detected only in a few cell samples. Other genes, such as NET and ER71, were expressed in all cell samples, but were present at higher levels in certain cell types (endothelial cells and testis, respectively). Some cell type specific genes (ESE1, ESE3, PU.1, ETS1 and ERG) were the most highly expressed ets genes in a cell sample. Others, such as ER71 or SPIB, never exceeded the levels of other ets genes in the same sample. These differences may reflect diverse strategies for target promoter recognition or differences in the quantity of in vivo binding sites.

The cell type specificities of many genes were consistent with previous in vivo studies (for literature review, see Table 2). Examples of concordance include the ESE subgroup in certain epithelia containing tissues (7), PDEF in prostate (29), PU.1 in myeloid cells (30), SPIB in B cells (31), SPIC in spleen (32), ER71 in testis (33) and FEV in small intestine and prostate (34). In addition, our findings also correlated with functional tests. A conditional lymphoid deletion of ETS1 has a decreased number of B and T cells (35,36), and ETS1 was highly expressed in B and T cells. The NET deletion mouse shows increased target gene expression in the vasculature (37), and this putative repressor was expressed at the highest levels in endothelial cells. Members of the PEA3 subgroup, ER81 and ERM, were expressed at higher levels in testis, lung and brain, consistent with roles in male fertility (38) and in branching morphogenesis in lung and brain (39,40). One interesting observation was the higher expression of ESE1, ESE3 and PDEF in tissues than in cell lines (Figure 3). This difference may be related to a role for these genes in terminal differentiation rather than cell growth. Indeed, ESE1 is proposed to be critical for intestinal epithelia differentiation based on genetic disruption in the mouse (41). This concordance with previous findings, including functional data, supports the validity of our methods and conclusions.

Our survey of ets family expression also revealed new specificities. For example, members of the ERG subgroup have been reported to be present in a number of cell types, including endothelial cells (4246). However, ERG was expressed at an extremely high level only in endothelial cells, whereas FLI1 was expressed at high levels in both endothelial and hematopoietic cells. This endothelial specific expression correlated with genetic studies implicating ERG and FLI1 in endothelial cell differentiation (47,48). In a second example, the PEA3 subgroup showed dramatically higher expression in cell lines than in tissues. For example, E1AF showed minimal expression in tissues, but was among the most highly expressed ets genes in certain cell lines. This expression pattern could be explained by the reported expression of the PEA3 subgroup in multiple tumor types (4951) in conjunction with the fact that the majority of the tested cell lines are derived from tumors.

In vivo ETS DNA binding specificity
The discovery that over one-half of ets genes are ubiquitous brings into question whether each ETS protein has unique targets and whether these targets would change in different cells. Using chromatin immunoprecipitation, we tested the in vivo promoter occupancy of three ubiquitous ETS proteins ETS1, ETS2 and ELK1 on the CDC2L2 and EGR1 promoters with reported specificity for ETS1 (24) or ELK1 (52), respectively. The antibody for ELK1, but not for ETS1 or ETS2, detected the EGR1 promoter in both Jurkat and HCT116 cells (Figure 4). Antibodies for ETS1 and ETS2, but not ELK1, detected the CDC2L2 promoter in both cell lines (Figure 4). These reciprocal findings indicated that specificity is not necessarily reflective of mRNA levels as all three genes are expressed in both cell lines (Figure 2). The presence of both ETS1 and ETS2 at the CDC2L2 promoter had not been previously reported. Interestingly, this dual occupancy does not correlate with the relative mRNA levels for these ets genes in the two cell lines. ETS1 expression is higher than that of ETS2 in Jurkat cells, whereas ETS2 expression is higher than ETS1 in HCT116 (Figure 2). These binding data demonstrate that there is promoter selectivity in spite of extensive co-expression of many ets genes in each cell type. Furthermore, an understanding of ETS protein association with any particular promoter requires consideration of all ETS proteins present in that cell type.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 4. ETS protein promoter occupancy varies in specificity. (A) Chromatin immunoprecipitations were performed with an antibody that recognizes both ETS1 and ETS2 (ETS1/2), or antibodies specific to ETS1, ETS2, or ELK1, or pre-immune rabbit IgG in cell lines indicated. Immunoprecipitated DNA was analyzed by PCR specific to the promoter of EGR1, or CDC2L2, or a 3' region of the albumin gene. (B) Chromatin immunoprecipitations were performed as in (A). Real-time PCR measured enrichment of a negative control region of the albumin gene and the promoter of CDC2L2 by each ETS antisera. Measurements are expressed as a fold enrichment over the IgG control, therefore, lack of a specific enrichment is represented by a value of one. Values are an average (±standard error) from two independent experiments, except for ETS2 in HCT116, which was performed only once.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We discovered that over two-thirds of the 27 human ets genes are expressed in most cell samples. This extensive co-expression, in combination with the conservation of the DNA binding domain, emphasizes the challenge of matching a particular ETS protein to a specific promoter. Our findings extend a more focused study on mouse mammary cells that detected mRNA for 24 ets genes in normal tissue and for 14–20 genes in cell lines (4). Furthermore, our conclusions may extend to other transcription factor families where understanding promoter selectivity is important. Examples include the hox and forkhead gene families, each with at least 39 members in humans (53,54). In concordance with the ets gene data, the co-expression of between 8 and 39 human hox genes is detected in 20 human tissues (53). Our real-time RT–PCR experimental design, which accurately measured the range of 1 to >500 copies of mRNA per cell, will facilitate the characterization of other gene families. Our study establishes the ets family as a model system for the study of specificity in moderately-sized gene families.

Extrapolation of mRNA data to promoter occupancy
The presence of 16–24 different ets mRNAs in a cell sample provides only a maximum number of ets genes that may regulate transcription in that cell. The ability of an ets mRNA to affect transcription requires translation to an active protein with the proper subcellular localization. New immunological reagents are required to survey ETS protein levels to compare with mRNA expression data. In one available example, there appears to be a convergence between protein and mRNA data. At least eight ETS proteins have been detected in T cells (ETS1, ETS2, ELF1, MEF, ELK1, SAP1, TEL and GABP{alpha}) (21,22,5560). The corresponding mRNA for each of these proteins was present in both the Jurkat and thymus cell samples. The 10 additional genes that we detected as mRNA have not been tested. Thus, at least one cell type contains a relatively high number of ETS proteins.

Ultimately, matching an ETS protein to a promoter in vivo requires an assay such as chromatin immunoprecipitation. To date, no specific promoter has been tested for in vivo association with each ETS protein present in a cell. However, more limited analyses, such as the immunoprecipitation of the CD68 promoter by ELF1, FLI1 and PU.1 antibodies (61) and our CDC2L2 experiment, indicate that a positive signal from one ETS antibody does not preclude the relevance of other ETS proteins.

Extrapolation of expression profile data to other cells or tissues
Our analysis provided a framework for connecting a specific ETS protein to a target gene within the 23 cell samples tested. Can we extrapolate from these data to predict the likely ets family profiles of other cell samples? The 14 ets genes found to be ubiquitous, must be considered as candidates for binding to an ETS binding site in any cell. This group encompasses more than half of the ets genes. In addition, the most highly expressed ets genes encode good candidate proteins. A prediction can also be made regarding these genes. In a cell sample with an epithelial identity, we predict that ESE1 and ESE3 will be the most highly expressed ets genes. For myeloid cells, PU.1 likely represents the most abundant ets mRNA, whereas for other hematopoietic lineages a good candidate would be ETS1. Endothelial cells would be predicted to express ERG at high levels. For other cell types, the ubiquitously expressed ETS2 and GABP{alpha} are likely to be the most highly expressed ets genes.

In summary, expression profiling of all 27 human ets genes in the same 23 cell samples generated an unprecedented picture of the cell type specificity of an entire gene family. The most significant finding is the surprisingly high degree of overlapping expression of ets genes in each cell type. Despite this extensive co-expression, target gene specificity can be maintained, as illustrated by the promoter occupancy analysis of two potential targets. These findings demonstrate that multiple ETS proteins are candidates for any potential promoter target and provide a guide for the type of candidates to be considered in different cell types.


    ACKNOWLEDGEMENTS
 
We thank Utah colleagues Tom McIntyre, Paul Shami, and Diana Stafforini for cell lines. Critical reading of manuscript by Don Ayer, Brad Cairns, and Mario Capecchi is gratefully acknowledged. We acknowledge statistical consultation with the Huntsman Cancer Institute Biostatistics Shared Resource, specifically Dr Aniko Szabo. This work was supported by a postdoctoral fellowship (#PF-03-122-01-GMC) from the American Cancer Society to P.C.H., a grant to D.A.J. (RSG02-141-01-CNE) from the American Cancer Society, grants from the National Institutes of Health (T32 CA93247 for fellowship support to P.C.H., GM38663 awarded to B.J.G., and CA24014 awarded to the Huntsman Cancer Institute), and funds from the Huntsman Cancer Foundation.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sharrocks,A.D. ( (2001) ) The ETS-domain transcription factor family. Nature Rev. Mol. Cell Biol., , 2, , 827–837.[CrossRef][Web of Science][Medline]

  2. Graves,B.J. and Petersen,J.M. ( (1998) ) In Woude,G.V. and Klein,G. (eds), Advances in Cancer Research. Academic Press, San Diego, Vol. 75, pp. 1–55.

  3. Szymczyna,B.R. and Arrowsmith,C.H. ( (2000) ) DNA binding specificity studies of four ETS proteins support an indirect read-out mechanism of protein-DNA recognition. J. Biol. Chem., , 275, , 28363–28370.[Abstract/Free Full Text]

  4. Galang,C.K., Muller,W.J., Foos,G., Oshima,R.G. and Hauser,C.A. ( (2004) ) Changes in the expression of many Ets family transcription factors and of potential target genes in normal mammary tissue and tumors. J. Biol. Chem., , 279, , 11281–11292.[Abstract/Free Full Text]

  5. Hsu,T. and Schulz,R.A. ( (2000) ) Sequence and functional properties of Ets genes in the model organism Drosophila. Oncogene, , 19, , 6409–6416.[CrossRef][Web of Science][Medline]

  6. Hart,A.H., Reventar,R. and Bernstein,A. ( (2000) ) Genetic analysis of ETS genes in C. elegans. Oncogene, , 19, , 6400–6408.[CrossRef][Web of Science][Medline]

  7. Kas,K., Finger,E., Grall,F., Gu,X., Akbarali,Y., Boltax,J., Weiss,A., Oettgen,P., Kapeller,R. and Libermann,T.A. ( (2000) ) ESE-3, a novel member of an epithelium-specific ets transcription factor subfamily, demonstrates different target gene specificity from ESE-1. J. Biol. Chem., , 275, , 2986–2998.[Abstract/Free Full Text]

  8. Yordy,J.S. and Muise-Helmericks,R.C. ( (2000) ) Signal transduction and the Ets family of transcription factors. Oncogene, , 19, , 6503–6513.[CrossRef][Web of Science][Medline]

  9. Beitel,G.J., Tuck,S., Greenwald,I. and Horvitz,H.R. ( (1995) ) The Caenorhabditis elegans gene lin-1 encodes an ETS-domain protein and defines a branch of the vulval induction pathway. Genes Dev., , 9, , 3149–3162.[Abstract/Free Full Text]

  10. Verger,A. and Duterque-Coquillaud,M. ( (2002) ) When Ets transcription factors meet their partners. Bioessays, , 24, , 362–370.[CrossRef][Web of Science][Medline]

  11. Li,R., Pei,H. and Watson,D.K. ( (2000) ) Regulation of Ets function by protein-protein interactions. Oncogene, , 19, , 6514–6523.[CrossRef][Web of Science][Medline]

  12. Thompson,C.C., Brown,T.A. and McKnight,S.L. ( (1991) ) Convergence of Ets- and Notch-related structural motifs in a heteromeric DNA binding complex. Science, , 253, , 762–768.[Abstract/Free Full Text]

  13. Pongubala,J.M.R., Nagulapalli,S., Klemsz,M.J., McKercher,S.R., Maki,R.A. and Atchison,M.L. ( (1992) ) PU.1 recruits a second nuclear factor to a site important for immunoglobulin {kappa} 3' enhancer activity. Mol. Cell. Biol., , 12, , 368–378.[Abstract/Free Full Text]

  14. Eisenbeis,C.F., Singh,H. and Storb,U. ( (1995) ) Pip, a novel IRF family member, is a lymphoid-specific PU.1-dependent transcriptional activator. Genes Dev., , 9, , 1377–1387.[Abstract/Free Full Text]

  15. Fitzsimmons,D., Hodsdon,W., Wheat,W., Sauveur-Michel,M., Wasylyk,B. and Hagman,J. ( (1996) ) Pax-5 (BSAP) recruits Ets proto-oncogene family proteins to form functional ternary complexes on a B-cell-specific promoter. Genes Dev., , 10, , 2198–2211.[Abstract/Free Full Text]

  16. Maier,H., Ostraat,R., Parenti,S., Fitzsimmons,D., Abraham,L.J., Garvie,C.W. and Hagman,J. ( (2003) ) Requirements for selective recruitment of Ets proteins and activation of mb-1/Ig-alpha gene transcription by Pax-5 (BSAP). Nucleic Acids Res., , 31, , 5483–5489.[Abstract/Free Full Text]

  17. Rozen,S. and Skaletsky,H.J. ( (2000) ) In Krawetz,S. and Misener,S. (eds), Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365–386.

  18. Duncan,R. and Hershey,J.W. ( (1983) ) Identification and quantitation of levels of protein synthesis initiation factors in crude HeLa cell lysates by two-dimensional polyacrylamide gel electrophoresis. J. Biol. Chem., , 258, , 7228–7235.[Abstract/Free Full Text]

  19. Weinmann,A.S., Bartley,S.M., Zhang,T., Zhang,M.Q. and Farnham,P.J. ( (2001) ) Use of chromatin immunoprecipitation to clone novel E2F target promoters. Mol. Cell. Biol., , 21, , 6820–6832.[Abstract/Free Full Text]

  20. Nissen,R.M. and Yamamoto,K.R. ( (2000) ) The glucocorticoid receptor inhibits NFkappaB by interfering with serine-2 phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev., , 14, , 2314–2329.[Abstract/Free Full Text]

  21. Gunther,C.V. and Graves,B.J. ( (1994) ) Identification of ETS domain proteins in murine T lymphocytes that interact with the Moloney murine leukemia virus enhancer. Mol. Cell. Biol., , 14, , 7569–7580.[Abstract/Free Full Text]

  22. Gunther,C.V. ( (1994) ) Regulation of Moloney Murine Retrovirus Transcription by the ETS gene family. PhD Thesis, University of Utah, UT, USA.

  23. Takahashi,Y., Rayman,J.B. and Dynlacht,B.D. ( (2000) ) Analysis of promoter binding by the E2F and pRB families in vivo: distinct E2F proteins mediate activation and repression. Genes Dev., , 14, , 804–816.[Abstract/Free Full Text]

  24. Feng,Y., Goulet,A.C. and Nelson,M.A. ( (2004) ) Identification and characterization of the human Cdc2l2 gene promoter. Gene, , 330, , 75–84.[CrossRef][Web of Science][Medline]

  25. Bustin,S.A. ( (2002) ) Quantification of mRNA using real-time reverse transcription PCR (RT–PCR): trends and problems. J. Mol. Endocrinol., , 29, , 23–39.[Abstract]

  26. Kang,J.J., Watson,R.M., Fisher,M.E., Higuchi,R., Gelfand,D.H. and Holland,M.J. ( (2000) ) Transcript quantitation in total yeast cellular RNA using kinetic PCR. Nucleic Acids Res, , 28, , e2.[Abstract/Free Full Text]

  27. Zhang,L., Zhou,W., Velculescu,V.E., Kern,S.E., Hruban,R.H., Hamilton,S.R., Vogelstein,B. and Kinzler,K.W. ( (1997) ) Gene expression profiles in normal and cancer cells. Science, , 276, , 1268–1272.[Abstract/Free Full Text]

  28. Bishop,J.O., Morton,J.G., Rosbash,M. and Richardson,M. ( (1974) ) Three abundance classes in HeLa cell messenger RNA. Nature, , 250, , 199–204.[CrossRef][Medline]

  29. Oettgen,P., Finger,E., Sun,Z., Akbarali,Y., Thamrongsak,U., Boltax,J., Grall,F., Dube,A., Weiss,A., Brown,L. et al. ( (2000) ) PDEF, a novel prostate epithelium-specific ets transcription factor, interacts with the androgen receptor and activates prostate-specific antigen gene expression. J. Biol. Chem., , 275, , 1216–1225.[Abstract/Free Full Text]

  30. Klemsz,M.J., McKercher,S.R., Celada,A., Van Beveren,C. and Maki,R.A. ( (1990) ) The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell, , 61, , 113–124.[CrossRef][Web of Science][Medline]

  31. Su,G.H., Ip,H.S., Cobb,B.S., Lu,M.M., Chen,H.M. and Simon,M.C. ( (1996) ) The Ets protein Spi-B is expressed exclusively in B cells and T cells during development. J. Exp. Med., , 184, , 203–214.[Abstract/Free Full Text]

  32. Carlsson,R., Hjalmarsson,A., Liberg,D., Persson,C. and Leanderson,T. ( (2002) ) Genomic structure of mouse SPI-C and genomic structure and expression pattern of human SPI-C. Gene, , 299, , 271–278.[CrossRef][Web of Science][Medline]

  33. Brown,T.A. and McKnight,S.L. ( (1992) ) Specificities of protein-protein and protein-DNA interaction of GABP alpha and two newly defined ets-related proteins. Genes Dev., , 6, , 2502–2512.[Abstract/Free Full Text]

  34. Peter,M., Couturiere,J., Pacquement,H., Michon,J., Thomas,G., Magdelenat,H. and Delattre,O. ( (1997) ) A new member of the ETS family fused to EWS in Ewing tumors. Oncogene, , 14, , 1159–1164.[CrossRef][Web of Science][Medline]

  35. Bories,J.-C., Willerford,D.M., Grevin,D., Davidson,L., Camus,A., Martin,P., Stehelin,D. and Alt,F.W. ( (1995) ) Increased T-cell apoptosis and terminal B-cell differentiation induced by inactivation of the Ets-1 proto-oncogene. Nature, , 377, , 635–638.[CrossRef][Medline]

  36. Muthusamy,N., Barton,K. and Leiden,J.M. ( (1995) ) Defective activation and survival of T-cells lacking the Ets-1 transcription factor. Nature, , 377, , 639–642.[CrossRef][Medline]

  37. Ayadi,A., Zheng,H., Sobieszczuk,P., Buchwalter,G., Moerman,P., Alitalo,K. and Wasylyk,B. ( (2001) ) Net-targeted mutant mice develop a vascular phenotype and up-regulate egr-1. EMBO J., , 20, , 5139–5152.[CrossRef][Web of Science][Medline]

  38. Laing,M.A., Coonrod,S., Hinton,B.T., Downie,J.W., Tozer,R., Rudnicki,M.A. and Hassell,J.A. ( (2000) ) Male sexual dysfunction in mice bearing targeted mutant alleles of the PEA3 ets gene. Mol. Cell. Biol., , 20, , 9337–9345.[Abstract/Free Full Text]

  39. Arber,S., Ladle,D.R., Lin,J.H., Frank,E. and Jessell,T.M. ( (2000) ) ETS gene Er81 controls the formation of functional connections between group Ia sensory afferents and motor neurons. Cell, , 101, , 485–498.[CrossRef][Web of Science][Medline]

  40. Liu,Y., Jiang,H., Crawford,H.C. and Hogan,B.L. ( (2003) ) Role for ETS domain transcription factors Pea3/Erm in mouse lung development. Dev. Biol., , 261, , 10–24.[CrossRef][Web of Science][Medline]

  41. Ng,A.Y., Waring,P., Ristevski,S., Wang,C., Wilson,T., Pritchard,M., Hertzog,P. and Kola,I. ( (2002) ) Inactivation of the transcription factor Elf3 in mice results in dysmorphogenesis and altered differentiation of intestinal epithelium. Gastroenterology, , 122, , 1455–1466.[CrossRef][Web of Science][Medline]

  42. Mélet,F., Motro,B., Rossi,D.J., Zhang,L. and Bernstein,A. ( (1996) ) Generation of a novel Fli-1 protein by gene targeting leads to a defect in thymus development and a delay in Friend virus-induced erythroleukemia. Mol. Cell. Biol., , 16, , 2708–2718.[Abstract]

  43. Klemsz,M.J., Maki,R.A., Papayannopoulou,T., Moore,J. and Hromas,R. ( (1993) ) Characterization of the ets Oncogene Family Member, fli-1. J. Biol. Chem., , 268, , 5769–5773.[Abstract/Free Full Text]

  44. Ben-David,Y., Giddens,E.B., Letwin,K. and Bernstein,A. ( (1991) ) Erythroleukemia induction by Friend murine leukemia virus: insertional activation of a new member of the ets gene family, Fli-1, closely linked to c-ets-1. Genes Dev., , 5, , 908–918.[Abstract/Free Full Text]

  45. Dhordain,P., DeWitte,F., Desbiens,X., Stehelin,D. and Duterque-Coquillaud,M. ( (1995) ) Mesodermal expression of the chicken erg gene associated with precartilaginous condensation and cartilage differentiation. Mech. Dev., , 50, , 17–28.[CrossRef][Web of Science][Medline]

  46. Khachigian,L.M., Fries,J.W., Benz,M.W., Bonthron,D.T. and Collins,T. ( (1994) ) Novel cis-acting elements in the human platelet-derived growth factor B-chain core promoter that mediate gene expression in cultured vascular endothelial cells. J. Biol. Chem., , 269, , 22647–22656.[Abstract/Free Full Text]

  47. McLaughlin,F., Ludbrook,V.J., Cox,J., von Carlowitz,I., Brown,S. and Randi,A.M. ( (2001) ) Combined genomic and antisense analysis reveals that the transcription factor Erg is implicated in endothelial cell differentiation. Blood, , 98, , 3332–3339.[Abstract/Free Full Text]

  48. Spyropoulos,D.D., Pharr,P.N., Lavenburg,K.R., Jackers,P., Papas,T.S., Ogawa,M. and Watson,D.K. ( (2000) ) Hemorrhage, impaired hematopoiesis, and lethality in mouse embryos carrying a targeted disruption of the Fli1 transcription factor. Mol. Cell. Biol., , 20, , 5643–5652.[Abstract/Free Full Text]

  49. Shepherd,T.G., Kockeritz,L., Szrajber,M.R., Muller,W.J. and Hassell,J.A. ( (2001) ) The pea3 subfamily ets genes are required for HER2/Neu-mediated mammary oncogenesis. Curr. Biol., , 11, , 1739–1748.[CrossRef][Web of Science][Medline]

  50. Hiroumi,H., Dosaka-Akita,H., Yoshida,K., Shindoh,M., Ohbuchi,T., Fujinaga,K. and Nishimura,M. ( (2001) ) Expression of E1AF/PEA3, an Ets-related transcription factor in human non-small-cell lung cancers: its relevance in cell motility and invasion. Int. J. Cancer, , 93, , 786–791.[CrossRef][Web of Science][Medline]

  51. Horiuchi,S., Yamamoto,H., Min,Y., Adachi,Y., Itoh,F. and Imai,K. ( (2003) ) Association of ets-related transcriptional factor E1AF expression with tumour progression and overexpression of MMP-1 and matrilysin in human colorectal cancer. J. Pathol., , 200, , 568–576.[CrossRef][Web of Science][Medline]

  52. Yang,S.H. and Sharrocks,A.D. ( (2004) ) SUMO promotes HDAC-mediated transcriptional repression. Mol. Cell, , 13, , 611–617.[CrossRef][Web of Science][Medline]

  53. Takahashi,Y., Hamada,J., Murakawa,K., Takada,M., Tada,M., Nogami,I., Hayashi,N., Nakamori,S., Monden,M., Miyamoto,M. et al. ( (2004) ) Expression profiles of 39 HOX genes in normal human adult organs and anaplastic thyroid cancer cell lines by quantitative real-time RT–PCR system. Exp. Cell Res., , 293, , 144–153.[CrossRef][Web of Science][Medline]

  54. Carlsson,P. and Mahlapuu,M. ( (2002) ) Forkhead transcription factors: key players in development and metabolism. Dev. Biol., , 250, , 1–23.[CrossRef][Web of Science][Medline]

  55. Bhat,N.K., Komschlies,K.L., Fujiwara,S., Fisher,R.J., Mathieson,B.J., Gregorio,T.A., Young,H.A., Kasik,J.W., Ozato,K. and Papas,T.S. ( (1989) ) Expression of ets genes in mouse thymocyte subsets and T cells. J. Immunol., , 142, , 672–678.[Abstract]

  56. Ghysdael,J., Gegonne,A., Pognonec,P., Dernis,D., Leprince,D. and Stehelin,D. ( (1986) ) Identification and preferential expression in thymic and bursal lymphocytes of a c-ets oncogene-encoded Mr 54,000 cytoplasmic protein. Proc. Natl Acad. Sci. USA, , 83, , 1714–1718.[Abstract/Free Full Text]

  57. Bassuk,A.G., Barton,K.P., Anandappa,R.T., Lu,M.M. and Leiden,J.M. ( (1998) ) Expression pattern of the Ets-related transcription factor Elf-1. Mol. Med., , 4, , 392–401.[Web of Science][Medline]

  58. Lacorazza,H.D., Miyazaki,Y., Di Cristofano,A., Deblasio,A., Hedvat,C., Zhang,J., Cordon-Cardo,C., Mao,S., Pandolfi,P.P. and Nimer,S.D. ( (2002) ) The ETS protein MEF plays a critical role in perforin gene expression and the development of natural killer and NK-T cells. Immunity, , 17, , 437–449.[CrossRef][Web of Science][Medline]

  59. Poirel,H., Oury,C., Carron,C., Duprez,E., Laabi,Y., Tsapis,A., Romana,S.P., Mauchauffe,M., Le Coniat,M., Berger,R. et al. ( (1997) ) The TEL gene products: nuclear phosphoproteins with DNA binding properties. Oncogene, , 14, , 349–357.[CrossRef][Web of Science][Medline]

  60. Magnaghi-Jaulin,L., Masutani,H., Lipinski,M. and Harel-Bellan,A. ( (1996) ) Analysis of SRF, SAP-1 and ELK-1 transcripts and proteins in human cell lines. FEBS Lett., , 391, , 247–251.[CrossRef][Web of Science][Medline]

  61. O'Reilly,D., Quinn,C.M., El-Shanawany,T., Gordon,S. and Greaves,D.R. ( (2003) ) Multiple Ets factors and interferon regulatory factor-4 modulate CD68 expression in a cell type-specific manner. J. Biol. Chem., , 278, , 21909–21919.[Abstract/Free Full Text]

  62. Wain,H.M., Lush,M., Ducluzeau,F. and Povey,S. ( (2002) ) Genew: the human gene nomenclature database. Nucleic Acids Res., , 30, , 169–171.[Abstract/Free Full Text]

  63. Oettgen,P., Akbarali,Y., Boltax,J., Best,J., Kunsch,C. and Libermann,T.A. ( (1996) ) Characterization of NERF, a novel transcription factor related to the ETS factor ELF-1. Mol. Cell. Biol., , 16, , 5091–5106.[Abstract]

  64. Miyazaki,Y., Sun,X., Uchida,H., Zhang,J. and Nimer,S. ( (1996) ) MEF, a novel transcription factor with an Elf-1 like DNA binding domain but distinct transcriptional activation properties. Oncogene, , 13, , 1721–1729.[Web of Science][Medline]

  65. Treisman,R. ( (1994) ) Ternary complex factors: growth regulated transcriptional activators. Curr. Opin. Genet. Dev., , 4, , 96–101.[CrossRef][Medline]

  66. Giovane,A., Pintzas,A., Maira,S., Sobieszczuk,P. and Wasylyk,B. ( (1994) ) Net, a new ets transcription factor that is activated by Ras. Genes Dev., , 8, , 1502–1513.[Abstract/Free Full Text]

  67. Cesari,F., Brecht,S., Vintersten,K., Vuong,L.G., Hofmann,M., Klingel,K., Schnorr,J.J., Arsenian,S., Schild,H., Herdegen,T. et al. ( (2004) ) Mice deficient for the ets transcription factor elk-1 show normal immune responses and mildly impaired neuronal gene activation. Mol. Cell. Biol., , 24, , 294–305.[Abstract/Free Full Text]

  68. Ayadi,A., Suelves,M., Dolle,P. and Wasylyk,B. ( (2001) ) Net, an Ets ternary complex transcription factor, is expressed in sites of vasculogenesis, angiogenesis, and chondrogenesis during mouse development. Mech. Dev., , 102, , 205–208.[CrossRef][Web of Science][Medline]

  69. de Castro,C.M., Rabe,S.M., Langdon,S.D., Fleenor,D.E., Slentz-Kesler,K., Ahmed,M.N., Qumsiyeh,M.B. and Kaufman,R.E. ( (1997) ) Genomic structure and chromosomal localization of the novel ETS factor, PE-2 (ERF). Genomics, , 42, , 227–235.[CrossRef][Web of Science][Medline]

  70. Klemsz,M., Hromas,R., Raskind,W., Bruno,E. and Hoffman,R. ( (1994) ) PE-1, a novel ETS oncogene family member, localizes to chromosome 1q21 [PDB] - q23. Genomics, , 20, , 291–294.[CrossRef][Web of Science][Medline]

  71. Watson,D.K., Smyth,F.E., Thompson,D.M., Cheng,J.Q., Testa,J.R., Papas,T.S. and Seth,A. ( (1992) ) The ERGB/Fli-1 gene: isolation and characterization of a new member of the family of human ETS transcription factors. Cell Growth Differ., , 3, , 705–713.[Abstract]

  72. Oettgen,P., Alani,R.M., Barcinski,M.A., Brown,L., Akbarali,W., Boltax,J., Kunsch,C., Munger,K. and Libermann,T.A. ( (1997) ) Isolation and characterization of a novel epithelium-specific transcription factor, ESE-1, a member of the ets family. Mol. Cell. Biol., , 17, , 4419–4433.[Abstract]

  73. Oettgen,P., Kas,K., Dube,A., Gu,X., Grall,F., Thamrongsak,U., Akbarali,Y., Finger,E., Boltax,J., Endress,G. et al. ( (1999) ) Characterization of ESE-2, a novel ESE-1-related Ets transcription factor that is restricted to glandular epithelium and differentiated keratinocytes. J. Biol. Chem., , 274, , 29439–29452.[Abstract/Free Full Text]

  74. Barton,K., Muthusamy,N., Fischer,C., Ting,C.-N., Walunas,T., Lanier,L. and Leiden,J. ( (1998) ) The Ets-1 transcription factor is required for the development of natural killer cells in mice. Immunity, , 9, , 555–563.[CrossRef][Web of Science][Medline]

  75. Kola,I., Brookes,S., Green,A.R., Garber,R., Tymms,M., Papas,T.S. and Seth,A. ( (1993) ) The Ets-1 transcription factor is widely expressed during murine embryo development and is associated with mesodermal cells involved in morphogenetic processes such an organ formation. Proc. Natl Acad. Sci. USA, , 90, , 7588–7592.[Abstract/Free Full Text]

  76. Maroulakou,I.G., Papas,T.S. and Green,J.E. ( (1994) ) Differential expression of ets-1 and ets-2 proto-oncogenes during murine embryogenesis. Oncogene, , 9, , 1551–1565.[Web of Science][Medline]

  77. Yamamoto,H., Flannery,M.L., Kupriyanov,S., Pearce,J., McKercher,S.R., Henkel,G.W., Maki,R.A., Werb,Z. and Oshima,R.G. ( (1998) ) Defective trophoblast function in mice with a targeted mutation of Ets2. Genes Dev., , 12, , 1315–1326.[Abstract/Free Full Text]

  78. Ristevski,S., O'Leary,D.A., Thornell,A.P., Owen,M.J., Kola,I. and Hertzog,P.J. ( (2004) ) The ETS transcription factor GABPalpha is essential for early embryogenesis. Mol. Cell. Biol., , 24, , 5844–5849.[Abstract/Free Full Text]

  79. Galson,D.L., Hensold,J.O., Bishop,T.R., Schalling,M., D'Andrea,A.D., Jones,C., Auron,P.E. and Housman,D.E. ( (1993) ) Mouse beta-globin DNA-binding protein B1 is identical to a proto- oncogene, the transcription factor Spi-1/PU.1, and is restricted in expression to hematopoietic cells and the testis. Mol. Cell. Biol., , 13, , 2929–2941.[Abstract/Free Full Text]

  80. McKercher,S.R., Torbett,B.E., Anderson,K.L., Henkel,G.W., Vestal,D.J., Baribault,H., Klemsz,M., Feeney,A.J., Wu,E.G., Paige,C.J. et al. ( (1996) ) Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. EMBO J., , 15, , 5647–5658.[Web of Science][Medline]

  81. Scott,E.W., Simon,M.C., Anastasi,J. and Singh,H. ( (1994) ) Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages. Science,, 265, , 1573–1577.[Abstract/Free Full Text]

  82. Su,G.H., Chen,H.M., Muthusamy,N., Garrett-Sinha,L.A., Baunoch,D., Tenen,D.G. and Simon,M.C. ( (1997) ) Defective B cell receptor-mediated responses in mice lacking the Ets protein, Spi-B. EMBO J., , 16, , 7118–7129.[CrossRef][Web of Science][Medline]

  83. Chotteau-Lelievre,A., Montesano,R., Soriano,J., Soulie,P., Desbiens,X. and de Launoit,Y. ( (2003) ) PEA3 transcription factors are expressed in tissues undergoing branching morphogenesis and promote formation of duct-like structures by mammary epithelial cells in vitro. Dev. Biol., , 259, , 241–257.[CrossRef][Web of Science][Medline]

  84. Xin,J.H., Cowie,A., Lachance,P. and Hassell,J.A. ( (1992) ) Molecular cloning and characterization of PEA3, a new member of the Ets oncogene family that is differentially expressed in mouse embryonic cells. Genes Dev., , 6, , 481–496.[Abstract/Free Full Text]

  85. Monté,D., Baert,J.-L., Defossez,P.-A., Launoit,Y. and Stéhelin,D. ( (1994) ) Molecular cloning and characterization of human ERM, a new member of the Ets family closely related to mouse PEA3 and ER81 transcription factors. Oncogene, , 9, , 1397–1406.[Web of Science][Medline]

  86. Golub,T.R., Barker,G.F., Lovett,M. and Gilliland,D.G. ( (1994) ) Fusion of PDGF receptor beta to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation. Cell, , 77, , 307–316.[CrossRef][Web of Science][Medline]

  87. Wang,L.C., Kuo,F., Fujiwara,Y., Gilliland,D.G., Golub,T.R. and Orkin,S.H. ( (1997) ) Yolk sac angiogenic defect and intra-embryonic apoptosis in mice lacking the Ets-related factor TEL. EMBO J., , 16, , 4374–4383.[CrossRef][Web of Science][Medline]

  88. Gu,X., Shin,B.H., Akbarali,Y., Weiss,A., Boltax,J., Oettgen,P. and Libermann,T.A. ( (2001) ) Tel-2 is a novel transcriptional repressor related to the Ets factor Tel/ETV-6. J. Biol. Chem., , 276, , 9421–9436.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
S.-C. Shih, A. Zukauskas, D. Li, G. Liu, L.-H. Ang, J. A. Nagy, L. F. Brown, and H. F. Dvorak
The L6 Protein TM4SF1 Is Critical for Endothelial Cell Function and Tumor Angiogenesis
Cancer Res., April 15, 2009; 69(8): 3272 - 3277.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Asano and M. Trojanowska
Phosphorylation of Fli1 at Threonine 312 by Protein Kinase C {delta} Promotes Its Interaction with p300/CREB-Binding Protein-Associated Factor and Subsequent Acetylation in Response to Transforming Growth Factor {beta}
Mol. Cell. Biol., April 1, 2009; 29(7): 1882 - 1894.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
P. Jedlicka, X. Sui, L. Sussel, and A. Gutierrez-Hartmann
Ets Transcription Factors Control Epithelial Maturation and Transit and Crypt-Villus Morphogenesis in the Mammalian Intestine
Am. J. Pathol., April 1, 2009; 174(4): 1280 - 1290.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Szuhai, M. IJszenga, D. de Jong, A. Karseladze, H. J. Tanke, and P. C.W. Hogendoorn
The NFATc2 Gene Is Involved in a Novel Cloned Translocation in a Ewing Sarcoma Variant That Couples Its Function in Immunology to Oncology
Clin. Cancer Res., April 1, 2009; 15(7): 2259 - 2268.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Gangwal, S. Sankar, P. C. Hollenhorst, M. Kinsey, S. C. Haroldsen, A. A. Shah, K. M. Boucher, W. S. Watkins, L. B. Jorde, B. J. Graves, et al.
Microsatellites as EWS/FLI response elements in Ewing's sarcoma
PNAS, July 22, 2008; 105(29): 10149 - 10154.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. M. Birdsey, N. H. Dryden, V. Amsellem, F. Gebhardt, K. Sahnan, D. O. Haskard, E. Dejana, J. C. Mason, and A. M. Randi
Transcription factor Erg regulates angiogenesis and endothelial apoptosis through VE-cadherin
Blood, April 1, 2008; 111(7): 3498 - 3506.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Asano, J. Czuwara, and M. Trojanowska
Transforming Growth Factor- Regulates DNA Binding Activity of Transcription Factor Fli1 by p300/CREB-binding Protein-associated Factor-dependent Acetylation
J. Biol. Chem., November 30, 2007; 282(48): 34672 - 34683.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
W. Lei, R. J. Jaramillo, and K. S. Harrod
Transactivation of lung lysozyme expression by Ets family member ESE-1
Am J Physiol Lung Cell Mol Physiol, November 1, 2007; 293(5): L1359 - L1368.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
P. C. Hollenhorst, A. A. Shah, C. Hopkins, and B. J. Graves
Genome-wide analyses reveal properties of redundant and specific promoter occupancy within the ETS gene family
Genes & Dev., August 1, 2007; 21(15): 1882 - 1894.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Papadaki, M. Alexiou, G. Cecena, M. Verykokakis, A. Bilitou, J. C. Cross, R. G. Oshima, and G. Mavrothalassitis
Transcriptional Repressor Erf Determines Extraembryonic Ectoderm Differentiation
Mol. Cell. Biol., July 15, 2007; 27(14): 5201 - 5213.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
B. J. Graves and J. W. Tamkun
Transcription saga tells developmental stories.
Development, November 1, 2006; 133(22): 4393 - 4397.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. S. Nakerakanti, B. Kapanadze, M. Yamasaki, M. Markiewicz, and M. Trojanowska
Fli1 and Ets1 Have Distinct Roles in Connective Tissue Growth Factor/CCN2 Gene Regulation and Induction of the Profibrotic Gene Program
J. Biol. Chem., September 1, 2006; 281(35): 25259 - 25269.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. R. Presnell, L. Zhang, C. A. Ramilo, H.-W. Chan, and C. T. Lutz
Functional redundancy of transcription factor-binding sites in the killer cell Ig-like receptor (KIR) gene promoter
Int. Immunol., August 1, 2006; 18(8): 1221 - 1232.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. L. Sans, D. J. Satterwhite, C. A. Stoltzman, K. T. Breen, and D. E. Ayer
MondoA-Mlx Heterodimers Are Candidate Sensors of Cellular Energy Status: Mitochondrial Localization and Direct Regulation of Glycolysis.
Mol. Cell. Biol., July 1, 2006; 26(13): 4863 - 4871.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. D. Smith, P. Sumazin, Z. Xuan, and M. Q. Zhang
DNA motifs in human and mouse proximal promoters predict tissue-specific expression
PNAS, April 18, 2006; 103(16): 6275 - 6280.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Kim, C. T. Denny, and R. Wisdom
Cooperative DNA Binding with AP-1 Proteins Is Required for Transformation by EWS-Ets Fusion Proteins.
Mol. Cell. Biol., April 1, 2006; 26(7): 2467 - 2478.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. T. Vander Kooi, H. Onuma, J. K. Oeser, C. A. Svitek, S. R. Allen, C. W. Vander Kooi, W. J. Chazin, and R. M. O'Brien
The Glucose-6-Phosphatase Catalytic Subunit Gene Promoter Contains Both Positive and Negative Glucocorticoid Response Elements
Mol. Endocrinol., December 1, 2005; 19(12): 3001 - 3022.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. Sanjabi, K. J. Williams, S. Saccani, L. Zhou, A. Hoffmann, G. Ghosh, S. Gerondakis, G. Natoli, and S. T. Smale
A c-Rel subdomain responsible for enhanced DNA-binding affinity and selective gene activation
Genes & Dev., September 15, 2005; 19(18): 2138 - 2151.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (392K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (37)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Hollenhorst, P. C.
Right arrow Articles by Graves, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hollenhorst, P. C.
Right arrow Articles by Graves, B. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?