Skip Navigation

Nucleic Acids Research 2004 32(21):6378-6387; doi:10.1093/nar/gkh980
This Article
Right arrow Abstract Freely available
Right arrow Print PDF (391K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Cadman, C. J.
Right arrow Articles by McGlynn, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cadman, C. J.
Right arrow Articles by McGlynn, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published online 2 December 2004

Nucleic Acids Research, Vol. 32 No. 21 © Oxford University Press 2004; all rights reserved

PriA helicase and SSB interact physically and functionally

Chris J. Cadman and Peter McGlynn*

School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Foresterhill, Aberdeen AB25 2ZD, UK

* To whom correspondence should be addressed. Tel: +44 1224 555183; Fax: +44 1224 555844; Email: p.mcglynn{at}abdn.ac.uk

Received October 12, 2004; Revised November 2, 2004; Accepted November 16, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PriA helicase is the major DNA replication restart initiator in Escherichia coli and acts to reload the replicative helicase DnaB back onto the chromosome at repaired replication forks and D-loops formed by recombination. We have discovered that PriA-catalysed unwinding of branched DNA substrates is stimulated specifically by contact with the single-strand DNA binding protein of E.coli, SSB. This stimulation requires binding of SSB to the initial DNA substrate and is effected via a physical interaction between PriA and the C-terminus of SSB. Stimulation of PriA by the SSB C-terminus may act to ensure that efficient PriA-catalysed reloading of DnaB occurs only onto the lagging strand template of repaired forks and D-loops. Correlation between the DNA repair and recombination defects of strains harbouring an SSB C-terminal mutation with inhibition of this SSB–PriA interaction in vitro suggests that SSB plays a critical role in facilitating PriA-directed replication restart. Taken together with previous data, these findings indicate that protein–protein interactions involving SSB may coordinate replication fork reloading from start to finish.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Genome duplication presents a formidable enzymatic challenge, requiring the high fidelity replication of millions of bases of DNA. Moreover, DNA replication occurs in a complex environment. The template is an inherently unstable polymer subject to a constant barrage of chemical insults (1), whilst conflicts between replication and other essential processes such as transcription are unavoidable (24). As a result, replication forks may stall frequently and require some form of repair to allow completion of chromosomal duplication (5,6). Failure to solve these replicative problems comes at a high price, with the consequences being genome instability, cell death and, in higher organisms, cancer.

Prokaryotic studies have highlighted the central role played by recombination enzymes in fork repair (7). Damaged replication forks appear to have two fates in Escherichia coli. First, they may be processed so that the original blocking lesion is removed or bypassed, and replication resumed once the replicative machinery has been reloaded back onto the DNA fork structure (3,8,9). Second, stalled replication forks may break to leave one intact duplex and a free duplex DNA end (911). Recombination of the free duplex end with the intact sister duplex creates a D-loop onto which the replication machinery can be reloaded (12).

In both proposed replication repair pathways, the final stage of repair requires the restart of DNA replication. The key to initiation of DNA replication is loading of the replicative helicase DnaB onto ssDNA. DnaB catalyses unwinding of the parental DNA strands (13) and facilitates assembly of the remaining components of the replisome (14). Loading of DnaB during initiation of chromosomal duplication in E.coli is catalysed by DnaA in a tightly regulated manner at the start of the cell cycle and at a specific locus within the chromosome, oriC (15). In contrast, replication fork repair and hence reloading of DnaB may be needed away from oriC at any point within the chromosome and at any stage during chromosomal duplication. The potentially catastrophic effects of uncontrolled initiation of chromosomal duplication on genome stability suggests that replication restart must be regulated as tightly as DnaA-directed replication initiation at oriC. This implies reloading of DnaB must occur only on ssDNA at repaired forks or D-loops rather than onto other regions of ssDNA, such as those created by blocks to lagging strand synthesis (16,17). Thus an alternative replication initiator protein, PriA helicase, is utilized during replication restart to reload DnaB back onto the chromosome (18).

The requirement to reload DnaB only onto repaired forks and D-loops is thought to be reflected in the preferential binding of PriA to branched DNA structures in vitro (19,20). At such structures, PriA displays two activities. PriA facilitates loading of DnaB onto the lagging strand template via a complex series of protein–protein interactions involving PriB, PriC and DnaT (2124). However, DnaB can bind only to ssDNA (13). Thus the second enzymatic function of PriA, a 3' to 5' DNA helicase activity (25), acts to unwind any lagging strand DNA present at the fork to generate a ssDNA binding site for DnaB (26). The importance of PriA-directed replication restart is underlined by the decrease in viability, defective homologous recombination and extreme sensitivity to exposure to DNA damaging agents exhibited by priA null strains (2729). There exists also an alternative pathway of replication restart that is not dependent on PriA but on Rep helicase (24). Although rep mutants do not show the extreme phenotypes displayed by priA defective cells (30), rep and priA mutations are synthetically lethal (9,24). This suggests that Rep helicase may provide an accessory replication repair function. However, molecular details of the interplay between PriA- and Rep-dependent replication repair pathways remain unknown.

Here we show that SSB stimulates PriA-catalysed unwinding of branched DNA substrates. This stimulation requires binding of SSB to the initial DNA substrate and contact between PriA and the C-terminus of SSB. In contrast, neither a physical nor a functional interaction was detected between SSB and Rep helicase. A mutation within the C-terminus of SSB impairs interaction with PriA in vitro, and correlates with the DNA repair and recombination defects seen in strains carrying this ssb mutation. Contact between SSB and PriA may therefore play a critical role in coordinating reloading of the replisome at repaired forks and D-loops.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
DNA substrates
DNA substrates were constructed using oligonucleotides, one of which in each structure was labelled with [{gamma}32-P]ATP at the 5' end, and purified by gel electrophoresis (31). Sequences of the oligonucleotides (5' to 3') are as follows: (1) CTAGGGTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGCCCATTAGCAAGGCCGGAAACGTCAC, (2) ACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGACCCTAG, (3) GTGACGTTTCCGGCCTTGCTAATGGGCCGAATTCTACCAGTGCCAGTGAT, (4) TAGCAATGTAATCGTCTATGACGTTAAACCATCGATAGCAGCACCGTAATCAGTAGCGACAGAATCAAGT, (5) CATGGAGCTGTCTAGAGGATCCGACCCTAG. Fork 1 was made by annealing oligonucleotides 1, 2, 3 and 4. Fork 2 was made by annealing oligonucleotides 1, 2 and 4. Fork 3 was constructed by annealing oligonucleotides 1 and 2. Duplex 1 was built by annealing oligonucleotides 2 and 4, and duplex 2 made by annealing oligonucleotides 1 and 5. All DNA concentrations refer to the concentration of junction rather than nucleotide equivalents.

Proteins
PriA was purified as described in (32). Plasmids for the overexpression of wild-type and mutant SSB proteins and wild-type Rep helicase were constructed by PCR amplification of the relevant gene from strain MG1655 and cloning into pET22b. All clones derived from PCR products were checked by DNA sequencing to ensure no unwanted mutations had arisen.

Wild-type SSB was overexpressed by IPTG induction of E.coli BL21(DE3) harbouring the above pET22b construct at 37°C. Purification was by ammonium sulfate precipitation followed by passage through Q-sepharose anion exchange, S200HR Sephacryl gel filtration (both Amersham) and heparin agarose (Sigma) columns. Purified protein was stored at –80°C in 20 mM Tris–HCl (pH 8.0), 1 mM EDTA, 5 mM DTT, 100 mM NaCl and 50% (w/v) glycerol. SSB{Delta}C10 and SSB113 were expressed and purified as for wild-type SSB, except that induction of ssb113 expression was performed at 30°C. The presence of a wild-type ssb allele in BL21(DE3) meant that wild-type SSB would co-purify with each mutant protein. However, the difference in mobility between wild-type SSB and SSB{Delta}C10 in SDS gels allowed us to estimate that >95% of the purified sample contained mutant SSB, reflecting the extreme overproduction of plasmid-encoded SSB. Rep helicase was overexpressed as for wild-type SSB and purified through heparin agarose, ssDNA cellulose (both Sigma) and Mono-Q anion exchange (Amersham) columns. Storage was at –80°C in 20 mM Tris–HCl (pH 7.5), 1 mM EDTA, 5 mM DTT, 200 mM NaCl and 50% (w/v) glycerol. S.solfataricus SSB was a gift from Malcolm White. Protein concentrations were determined with a modified Bradford assay (BioRad) using BSA as a standard (33). All E.coli SSB concentrations quoted are those of the tetramer.

DNA unwinding and binding assays
Assays for junction dissociation were performed at 37°C in 40 mM HEPES–HCl (pH 8.0), 10 mM MgCl2, 10 mM DTT, 2 mM ATP and 0.1 mg ml–1 BSA; 0.2 nM junction DNA was used together with the indicated concentrations of proteins. Unwinding reactions were preincubated at 37°C for 5 min, together with SSB if present, prior to addition of PriA to a final volume of 10 µl and incubation continued at 37°C for a further 10 min. Reactions were stopped by addition of 2.5 µl of stop buffer [100 mM Tris–HCl (pH 7.5), 5% SDS, 200 mM EDTA and 10 mg ml–1 proteinase K) and incubation at 37°C for 20 min. The rate of junction dissociation was measured as above except that the final reaction volume was 80 µl, and 10 µl samples were removed and mixed with 2.5 µl stop buffer at the appropriate time interval after addition of PriA. The amount of junction dissociation was analysed by electrophoresis through 10% polyacrylamide/TBE gels, and quantified using a phosphorimager. DNA binding assays were performed as described previously (34) except that 0.2 nM junction DNA was used and 10 mM MgCl2 was included in binding and running buffers. All assays were performed between two and four times, and the means of data used for graphical presentation. SD values from the mean were typically between 5% and 15%.

Surface plasmon resonance
Biotinylated peptides derived from the last 15 amino acids of wild-type SSB (biotin-PSNEPPMDFDDDIPF-COOH) and SSB113 (biotin-PSNEPPMDFDDDISF-COOH) were passed over a Biacore sensor chip SA in SPR buffer [10 mM HEPES–HCl (pH 7.4), 150 mM NaCl and 0.005% Tween-20] using a Biacore 2000 instrument. Approximately 100 response units of peptide were bound to each flow cell. PriA, dialysed into SPR buffer, was passed over each peptide at a flow rate of 5 µl min–1 for 4 min at 12 different concentrations ranging from 50 to 5000 nM at 25°C. After each experiment, flow cells were regenerated using 0.5% SDS in SPR buffer for 1 min at 5 µl min–1. Ligands retained >95% of PriA binding capacity after this treatment. The response obtained from a flow cell without peptide bound to its surface was subtracted from all measurements. Stoichiometries of binding and Kd values were estimated as described in (35) from two independent experiments.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
SSB stimulates PriA helicase at branched DNA substrates
E.coli SSB is required for PriA-catalysed unwinding of duplex DNA >40 bp (36). This requirement for SSB could be due to the need for SSB to bind to displaced ssDNA, and prevent reannealing of intermediates of the unwinding reaction. However, previous data had suggested PriA could interact specifically with ssDNA coated with SSB (37). Thus, a second explanation for SSB-dependent PriA helicase activity is that efficient translocation of PriA along DNA may be dependent on protein–protein interactions between PriA and SSB.

To determine whether an SSB–PriA interaction might play a role in replication restart, we analysed the effects of E.coli SSB on PriA helicase function at forked DNA structures in vitro. PriA-catalysed unwinding of the oligonucleotide corresponding to the lagging strand within a fork possessing both leading and lagging strand duplexes was stimulated to a limited extent by increasing amounts of SSB (Figure 1A and B, fork 1). However, when the leading strand was omitted, so that the leading strand template was single-stranded, increasing amounts of SSB stimulated PriA-catalysed unwinding of the lagging strand duplex so that the majority of the substrate was unwound (Figure 1A and B, fork 2). This was reflected in the 4-fold increase in the initial rate of PriA-directed unwinding of fork 2 by addition of SSB (Figure 1C).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1. Effect of wild-type SSB on PriA helicase function. (A) Unwinding reactions were performed with 0.2 nM PriA as indicated in the presence of 0, 0.02, 0.05, 0.2, 2 and 10 nM SSB tetramers (lanes 2–7). Incubation with 10 nM SSB tetramers in the absence of PriA was performed (lane 8) to ensure any dissociation was not due to duplex melting by SSB. DNA substrates are depicted above each gel whilst products of unwinding are shown on the left. Positions of 32P labels are shown as circles, arrows mark the 3' ends of DNA strands and numbers indicate the length in nucleotides of each arm. The 50mer and 70mer oligonucleotides correspond to the leading and lagging strands, respectively, at a replication fork. (B) Quantification of the degree of unwinding in the presence of increasing concentrations of SSB. Closed circles, fork 1; open triangles, fork 2; closed triangles, duplex 1. (C) Rates of unwinding of fork 2 by 0.2 nM PriA in the absence of SSB (closed triangles) and the presence of 2 nM SSB tetramers (open triangles). (D) Binding of forks 1 and 2 and duplex 1 by PriA as monitored by bandshift assays. Symbols are as described in B. (E) Binding of forks 1 and 2 and duplex 1 by SSB. Symbols are as described in (B).

 
PriA may target DNA substrates such as fork 2 in one of two ways. PriA displays high affinity binding to the branch point of DNA forks and can translocate along the lagging strand template arm to unwind any lagging strand DNA present (19,26). PriA can also bind with lower affinity to 3' single-stranded extensions from duplex DNA to translocate in a 3' to 5' direction along ssDNA regardless of the presence of a branch within the substrate (19,20). Thus PriA may target the ssDNA arm of fork 2 and translocate along the leading strand template arm unwinding the parental duplex as it goes (38). Since SSB stimulated PriA to unwind the lagging strand of fork 2, and of fork 1, rather than the parental duplex (Figure 1A), SSB stimulated PriA when PriA was acting as a branched DNA helicase.

PriA bound to both forks 1 and 2 with equal affinity (Figure 1D). SSB bound to fork 2 but not fork 1 (Figure 1E) as expected from the presence and absence of ssDNA, respectively. However, although SSB-stimulated levels of PriA-catalysed unwinding were maximal with fork 2, SSB also stimulated PriA-catalysed unwinding of fork 1 (Figure 1B). Thus stimulation of PriA on fork 1 did not require binding of SSB to the initial substrate. Stimulation might therefore be achieved by SSB binding to the displaced 70mer lagging strand and prevention of reannealing rather than a direct SSB–PriA interaction. Although addition of SSB failed to stimulate unwinding by PriA of a 70mer unbranched duplex bearing a 3' ssDNA tail (Figure 1A and B, duplex 1), arguing that stimulation was not due solely to prevention of reannealing by SSB, SSB binding to ssDNA extensions of duplex DNA substrates is known to inhibit PriA helicase activity (38). Any stimulation of PriA-catalysed unwinding of duplex 1 by SSB might be masked therefore by inhibition of PriA binding to the ssDNA arm of duplex 1 by SSB. Other approaches were required therefore to determine whether SSB stimulated PriA helicase at branched DNA substrates via specific protein–protein interactions.

SSB stimulation of PriA helicase is specific
If stimulation of PriA by E.coli SSB occurred solely by prevention of reannealing of the displaced DNA strand, then SSB proteins from other organisms should also stimulate E.coli PriA helicase. However, SSB from the archaeon Sulfolobus solfataricus (39,40) had no significant stimulatory effect on PriA-catalysed unwinding of fork 2 (Figure 2A and B). Bacteriophage T4 gp32 SSB also failed to stimulate PriA-catalysed unwinding of fork 2 (data not shown). We conclude that the ability of an SSB to bind ssDNA is not sufficient to effect stimulation of PriA.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 2. Specificity of SSB-directed stimulation of PriA. (A) Unwinding of fork 2 by 0.2 nM PriA in the presence of 0, 0.05, 0.2, 0.5, 2, 10 and 50 nM E.coli SSB tetramers (lanes 2–8). Lane 9 contains 50 nM SSB tetramers but no PriA. (B) Unwinding of fork 2 by 0.2 nM PriA in the presence of 0, 0.2, 0.8, 2, 8, 40 and 200 nM S.solfataricus SSB monomers (lanes 2–8). Lane 9 contains 200 nM S.solfataricus SSB monomers but no PriA. Concentrations of S.solfataricus SSB monomers were chosen so that equivalent numbers of E.coli and S.solfataricus SSB polypeptides were employed in (A) and (B). (C) Unwinding of fork 2 by 20 nM Rep in the presence of 0, 0.05, 0.2, 0.5, 2, 10 and 50 nM E.coli SSB tetramers (lanes 2–8). Lane 9 contains 50 nM SSB tetramers but no Rep. (D) Structure of fork 2 used in (A), (B) and (C).

 
The specificity of PriA stimulation by E.coli SSB was investigated further. Rep helicase is postulated to provide an alternative replication restart pathway to those dependent on PriA (24). The 3' to 5' helicase activity of Rep unwound fork 2 by translocation along the 50mer single-stranded leading strand template to effect unwinding of the parental duplex (Figure 2C, lane 2). Increasing concentrations of E.coli SSB failed to stimulate unwinding by Rep of the 70mer lagging strand duplex (Figure 2C, lanes 3–8). Moreover, SSB inhibited unwinding by Rep of the 30mer parental duplex. These data suggest that the stimulatory function of SSB in replication restart is specific for PriA helicase.

The C-terminus of SSB effects stimulation of PriA helicase
The specific stimulation of PriA by E.coli SSB but not SSBs from other organisms supported the existence of a direct PriA–SSB interaction. However, interaction of S.solfataricus SSB and T4 gp32 with ssDNA differs from the binding of E.coli SSB to ssDNA (41,42). Therefore, an alternative explanation for the specific stimulation of PriA by E.coli SSB is that the manner in which E.coli SSB binds DNA, as compared to other SSBs, leads to the generation of a preferred substrate for PriA helicase. To distinguish between these possibilities, a mutant SSB was generated lacking the final ten C-terminal residues (SSB{Delta}C10). The acidic C-terminus of E.coli SSB has been shown to interact directly with three proteins involved in DNA replication and repair, but is not required for ssDNA binding (4346).

SSB{Delta}C10 bound fork 2 with an affinity similar to wild-type SSB (Figure 3E). When the effects of SSB{Delta}C10 upon PriA-catalysed unwinding of fork 2 were compared with those of wild-type SSB, no stimulation of unwinding by SSB{Delta}C10 was observed (Figure 3A, B and D). Indeed, the low level of unwinding of the lagging strand of fork 2 by PriA was inhibited rather than stimulated by SSB{Delta}C10 (Figure 3B, compare lanes 2 and 4). The SSB C-terminus appears therefore to be required for the stimulation of PriA-catalysed unwinding of fork 2.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Stimulation of PriA helicase requires physical contact with a wild-type SSB C-terminus. (A) Unwinding of fork 2 by 0.5 nM PriA in the presence of 0, 0.1, 0.2, 0.5, 2 and 10 nM wild-type E.coli SSB tetramers (lanes 2–7). Lane 8 contains 10 nM SSB tetramers but no PriA. (B) Effect of SSB{Delta}C10 on unwinding of fork 2 by PriA. Protein concentrations are as in (A). (C) Effect of SSB113 on unwinding of fork 2 by PriA. Protein concentrations are as in (A). (D) Extent of PriA-catalysed unwinding of fork 2 as a function of SSB concentration. Closed circles, wild-type SSB; open triangles, SSB{Delta}C10; open squares, SSB113. (E) Binding of fork 2 by wild-type and mutant SSBs as monitored by bandshift assays. Symbols are as described in (D). (F) Binding of PriA to a 15mer peptide corresponding to the 15 C-terminal residues of wild-type SSB, as measured by surface plasmon resonance. Times of injection of 200 and 1000 nM PriA (dashed and filled lines, respectively), and of buffer lacking PriA, are indicated by arrows. (G) Binding of PriA to a 15mer peptide corresponding to the 15 C-terminal residues of SSB113. Line designations are as for (F).

 
However, SSB{Delta}C10 may possess elevated affinity for ssDNA as compared with wild-type SSB (43). To exclude the possibility that altered binding of fork 2 by SSB{Delta}C10 might be the cause of the lack of PriA stimulation, we used an SSB bearing a single amino acid alteration within the C-terminus. The ssb113 allele encodes a proline to serine mutation at the penultimate amino acid of SSB, and SSB113 protein binds ssDNA with similar affinity, cooperativity and binding modes as wild-type SSB (42). However, ssb113 confers temperature-sensitive growth and defects in DNA repair and recombination in E.coli (47). Furthermore, this mutation abrogates direct interactions between SSB and the {chi} subunit of DNA polymerase III holoenzyme (46), and between SSB and exonuclease I (45).

SSB113 carrying this P176S mutation bound fork 2 with an affinity similar to wild-type SSB (Figure 3E). However, SSB113, like SSB{Delta}C10, inhibited rather than stimulated PriA-catalysed unwinding of fork 2 (Figure 3C and D). The unwinding assays in Figure 3 were performed at 37°C. Assays performed at 30°C also failed to reveal stimulation by SSB113 or SSB{Delta}C10 (data not shown) which excludes heat inactivation of the mutant SSBs as the reason for lack of stimulation at 37°C.

These data indicate that stimulation of PriA on fork 2 requires a wild-type SSB C-terminus and that stimulation is not dependent solely upon the induction of a specific conformation within the DNA upon binding by SSB. These data also provide further evidence that trapping of unwinding intermediates by binding of SSB cannot explain SSB-dependent stimulation of PriA on fork 2. Instead, the data indicate that a direct interaction between the C-terminus of SSB and PriA stimulates PriA helicase. Therefore, we tested the ability of the SSB C-terminus to bind directly to PriA.

PriA binds specifically to the 15 C-terminal amino acids of SSB
We used surface plasmon resonance to test for a direct interaction between PriA and a peptide corresponding to the last fifteen amino acids of the wild-type SSB C-terminus. The wild-type SSB peptide, conjugated to an N-terminal biotin group, was bound to a streptavidin-coated chip, and PriA was passed over the chip surface. PriA bound to the peptide (Figure 3F). Unfortunately the rise and fall in response units was too rapid to obtain accurate measurements of kon and koff. Therefore, the responses 225 s after injection of PriA were plotted as a function of the concentration of PriA, and the data fitted to a single site Langmuir model (35). This yielded estimates of 0.98 (±0.01) PriA molecules bound per wild-type SSB peptide at saturation and a Kd of 2.4 ± 1.3 µM.

We also assayed for interaction between PriA and a 15mer peptide corresponding to the C-terminus of SSB113 carrying the P176S mutation (Figure 3G). Accurate estimates of kon and koff again could not be made. However, binding of PriA to the SSB113 peptide was reduced compared with binding to the wild-type peptide. This was reflected in the estimated stoichiometry of 0.20 (±0.02) PriA molecules bound per SSB113 peptide at saturation and a Kd of 6.9 ± 2.0 µM.

The correlation between stimulation of PriA helicase by wild-type SSB but not SSB113, and the relative levels of binding of PriA to wild-type SSB and SSB113 C-terminal peptides (Figure 3) indicate that stimulation of PriA helicase is dependent on a physical interaction between PriA and the SSB C-terminus. The specific nature of this interaction was underlined by the failure to detect any interaction between Rep helicase and either the wild-type or SSB113 peptides using surface plasmon resonance (data not shown). Furthermore, no binding to either wild-type or SSB113 peptides was detected with PriB, PriC or DnaT (data not shown).

Stimulation of PriA by the SSB C-terminus requires binding of SSB to ssDNA within the substrate
The observed functional and physical interactions between the SSB C-terminus and PriA (Figure 3) suggest that stimulation of PriA helicase at branched DNA can occur via binding of SSB to ssDNA present within the substrate followed by interaction between the SSB C-terminus and PriA. To test this, we used a simplified branched DNA substrate possessing two ssDNA arms of 50 and 70 bases and a corresponding unbranched DNA substrate lacking the 70mer ssDNA arm (Figure 4A and B). Binding of PriA to the branch point of fork 3 and translocation in a 3' to 5' direction along the 70mer ssDNA arm would not effect unwinding of the 30 bp duplex (Figure 4Ci). However, binding of PriA to the 50mer ssDNA arm would allow the 3' to 5' helicase activity of PriA to unwind the 30 bp duplex within both fork 3 and duplex 2 (Figure 4Cii and iii). The unwinding of fork 3 and duplex 2 might therefore be viewed as the same reaction with the 70mer ssDNA arm of fork 3 playing no part in the mechanism of unwinding.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Stimulation of PriA helicase by SSB correlates with binding of SSB to ssDNA within the initial DNA substrate. Unwinding of fork 3 (A) and duplex 2 (B) by 0.2 nM PriA in the presence of 0, 0.05, 0.2, 2 and 10 nM wild-type SSB tetramers (lanes 2–6, respectively). Lane 7 contains 10 nM SSB tetramers but no PriA. (C) Potential translocation activities of PriA, depicted as a shaded triangle, on fork 3 (i and ii) and on duplex 2 (iii). (D) Extent of PriA-catalysed unwinding of fork 3 (open squares) and duplex 2 (closed squares) as a function of SSB concentration. (E) Binding of PriA to fork 3 (open squares) and duplex 2 (closed squares) as measured by bandshift assays. (F) Binding of SSB to fork 3 (open squares) and duplex 2 (closed squares) as measured by bandshift assays. (G) Bandshift assay of wild-type SSB binding to fork 3. Concentrations of SSB tetramers were 0, 0.1, 0.2, 0.4, 0.8, 1.6, 3.2 and 50 nM. (H) Bandshift assay of SSB binding to duplex 2. Concentrations of SSB are as described in (G).

 
SSB had opposing effects on PriA-catalysed unwinding of the two substrates. Unwinding of fork 3 was stimulated 3- to 5-fold by SSB (Figure 4A) although at higher SSB concentrations stimulation was reduced (Figure 4D). In contrast, unwinding of duplex 2 by PriA was inihibited by SSB (Figure 4B and D). Stimulation of PriA-catalysed unwinding of fork 3 by SSB was dependent therefore on the presence of the 70mer ssDNA arm.

The affinity of SSB for duplex 2 was ~2-fold less than for fork 3 (Figure 4F). However, the most striking feature of SSB binding was the formation of two SSB–DNA complexes with fork 3 but only one with duplex 2 (Figure 4G and H). An SSB tetramer has a binding site size of 50–60 nt under the ionic conditions used in both the helicase and bandshift assays in this study (48). The pattern of SSB–DNA complexes formed with fork 3 and duplex 2 can be explained therefore by a single SSB tetramer binding to each ssDNA arm. When compared to fork 3, absence of the 70mer ssDNA arm in duplex 2 had no effect either on the binding of PriA (Figure 4E) or on the efficiency of unwinding by PriA of the 30 bp duplex in the absence of SSB (Figure 4D). We conclude that dependence of SSB-directed stimulation of PriA upon the 70mer ssDNA arm in fork 3 reflects a requirement for SSB binding to this arm.

To test whether the C-terminus of SSB was required for stimulation of PriA on fork 3, we analysed the effects of SSB{Delta}C10 and SSB113 on unwinding by PriA. Neither SSB{Delta}C10 nor SSB113 stimulated PriA helicase to any significant extent (Figure 5) even though both mutants bound fork 3 with similar affinities to wild-type SSB (data not shown). Instead both mutant SSBs inhibited PriA-catalysed unwinding of fork 3 (Figure 5B and C). Thus stimulation of PriA-catalysed unwinding of fork 3 by translocation along the 50mer ssDNA arm required both the binding of SSB to the opposing ssDNA arm and a wild-type SSB C-terminus. Consistent with this conclusion, S.solfataricus SSB also failed to stimulate PriA-catalysed unwinding of fork 3 (data not shown).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 5. Stimulation of PriA by SSB binding to ssDNA within the initial substrate requires a wild-type SSB C-terminus. Unwinding of fork 3 by 0.5 nM PriA in the presence of 0, 0.1, 0.2, 0.5, 2 and 10 nM tetramers of wild-type SSB (A), SSB{Delta}C10 (B) and SSB113 (C) (lanes 2–7). Lane 8 contains 10 nM SSB tetramers but lacks PriA. (D) Structure of fork 3 used in (A), (B) and (C).

 
SSB also stimulates PriA by prevention of reannealing of unwound ssDNA
The data in Figures 1GoGoGo5 demonstrate that SSB binding to ssDNA within branched DNA substrates leads to contact between the SSB C-termimus and PriA, and consequent stimulation of PriA helicase. However, one observation contradicts this conclusion. Stimulation of PriA-catalysed unwinding of fork 1 by SSB (Figure 1A and B) suggests that stimulation can also be effected in the absence of SSB binding to the initial DNA substrate. This implies that unwinding of fork 1 by PriA may be stimulated by SSB binding to and preventing the reannealing of ssDNA intermediates of unwinding rather than direct contact between the SSB C-terminus and PriA. We tested this possibility by comparing the effects of wild-type SSB and SSB113 on PriA-catalysed unwinding of fork 1. Both SSBs stimulated unwinding of the 70mer lagging strand of fork 1 to the same extent (Figure 6). Stimulation of PriA by SSB can occur therefore in the absence of a wild-type SSB C-terminus, suggesting that the ssDNA binding function of SSB can also promote unwinding by PriA.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. SSB can also stimulate PriA by trapping intermediates of unwinding. (A) Unwinding of fork 1 by 0.2 nM PriA in the presence of 0, 0.05, 0.2, 2, 10 and 50 nM wild-type SSB tetramers (lanes 2–7). Lane 8 contains 50 nM SSB tetramers but no PriA. (B) As for (A) except SSB113 was used in place of wild-type SSB. (C) Levels of stimulation of PriA-catalysed unwinding of fork 1 by wild-type SSB (closed circles) and SSB113 (open squares).

 
We conclude that SSB can stimulate PriA via two mechanisms. SSB binding to the substrate DNA effects stimulation by contact between the SSB C-terminus and PriA. However, SSB binding to ssDNA intermediates of unwinding can also stimulate PriA helicase via a mechanism that does not require direct contact between PriA and the SSB C-terminus.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have discovered a physical and functional interaction between the major replication restart initiator in E.coli, PriA helicase and SSB. This interaction stimulated PriA helicase activity specifically at branched DNA substrates and required both binding of SSB to ssDNA within the substrate and a wild-type SSB C-terminus. SSB and PriA might act in concert therefore to promote reloading of DnaB during replication fork repair. Moreover, this interaction was specific to PriA. SSB failed to stimulate Rep, the alternative replication restart helicase in E.coli, and no interaction was detected between the C-terminus of SSB and Rep. SSB also stimulated PriA helicase by a second mechanism that required neither a wild-type SSB C-terminus nor SSB binding to the initial DNA substrate, suggesting that PriA helicase was stimulated additionally by prevention of reannealing of unwound ssDNA intermediates.

Enhancement of PriA helicase by SSB occurs therefore by a novel dual mechanism. Stimulation of helicase activity by SSB binding to and effectively trapping ssDNA intermediates of unwinding acts to increase the apparent processivity of more distributive helicases (49). In contrast, how contact between the SSB C-terminus and PriA might elevate the rate of DNA unwinding is not known. One possibility is that this interaction may enhance the effective local concentration of PriA near ssDNA. However, the estimated Kd of 2.4 µM for the PriA–SSB C-terminus interaction (Figure 3) as compared with the nanomolar estimates of the Kd for PriA–DNA interactions (19) suggests that contact between the SSB C-terminus and PriA likely occurs only when both proteins are already bound to the substrate DNA. Thus a more likely stimulatory mechanism is that contact with the SSB C-terminus subsequent to binding of PriA to the DNA induces a conformational change in PriA to enhance the processivity of unwinding. Indeed, reduction of the length of the lagging strand duplex to be unwound by PriA from 70 to 30 bp leads to a reduction in the degree of stimulation by wild-type SSB (data not shown).

There are two major domains in PriA, the C-terminal helicase domain containing the conserved helicase motifs and an N-terminal DNA binding domain (50). It is tempting therefore to suggest that SSB might enhance the processivity of PriA by interaction with the helicase domain of PriA. However, work on PcrA helicase has demonstrated that both the helicase domain and the DNA binding domain responsible for distortion of duplex DNA ahead of the helicase domain are critical for helicase function (51). Thus induced conformational changes in either the helicase or DNA binding domains of PriA by SSB could conceivably alter the processivity of PriA.

Stimulation of PriA via contact with the SSB C-terminus or prevention of reannealing by SSB was specific to branched DNA structures. However, the observed stimulation of PriA by SSB lead to enhancement of unwinding of the lagging strand of fork 2 (Figure 1) and the parental strands of fork 3 (Figure 4). The unwinding of different features of branched DNA structures suggests that the in vivo function of SSB-directed stimulation of PriA might not be to enhance unwinding of the lagging strand by PriA for loading of DnaB. This apparent discrepancy can be explained by the eventual inhibition of PriA on fork 3 at higher concentrations of SSB whereas stimulation of PriA by SSB on fork 2 remained unaffected (data not shown). SSB is known to inhibit PriA helicase on duplex substrates possessing a 3' ssDNA tail (38) (Figure 4B). Thus at higher SSB concentrations, binding of SSB to the 50mer ssDNA arm of fork 3 might occlude low affinity binding of PriA to this arm and abrogate the stimulatory effect of SSB binding to the 70mer ssDNA arm. Stimulation of PriA helicase by the SSB C-terminus in vivo might therefore be restricted to high affinity branched DNA binding sites for PriA, enhancing PriA translocation along the lagging strand template of repaired forks and D-loops. Put another way, stimulation of PriA by the SSB C-terminus occurs only when binding of PriA and SSB to DNA substrates is not mutually exclusive, limiting this stimulation to repaired forks and D-loops.

SSB inhibited Rep-catalysed unwinding of fork 2 (Figure 2C). This observation suggests that SSB may inhibit Rep function in a proposed alternative replication restart mechanism (24). However, the in vivo DNA substrate for Rep remains unclear. Moreover, Rep may also function in concert with PriC in vivo (24). Thus the functional significance of SSB-dependent inhibition of Rep helicase is currently unknown.

What role might a PriA–SSB interaction play in vivo? SSB stimulation of PriA helicase might ensure that sufficient lagging strand duplex DNA is unwound to facilitate loading of DnaB onto the lagging strand template. Moreover, even in the absence of lagging strand DNA at a fork or D-loop, stimulation of PriA helicase may be important. DnaB cannot be loaded onto SSB-bound ssDNA (13), but PriA may be able to displace SSB from ssDNA (52). Stimulation of PriA by SSB bound to a single-stranded lagging strand arm might lead therefore to enhanced removal of SSB and facilitate loading of DnaB. Thus, paradoxically, SSB might stimulate its own removal from the lagging strand template. Either way, promotion of loading of DnaB by a PriA–SSB interaction may play a critical role in replication fork restart. Moreover, SSB-dependent stimulation of PriA at branched DNA substrates may effectively enhance the DNA structure specificity of PriA. This enhancement might act to ensure that PriA-directed loading of DnaB occurs at branched DNA substrates only and not at other, adventitious, sites throughout the genome.

These data imply that impairment in vivo of an interaction between PriA and the SSB C-terminus should hinder PriA function. ssb113 strains display temperature-sensitive growth, sensitivity to DNA damaging agents and defects in recombination (47). Temperature-sensitive growth of ssb113 strains has been attributed to reduced interaction between the {chi} subunit of the clamp loader complex and the C-terminus of SSB113 at elevated temperatures (53). This reduced interaction may lead to an inability of the clamp loader to displace primase from the newly synthesized primer (53). However, the defects in DNA repair and recombination of ssb113 are evident even at permissive temperatures. priA null strains also confer extreme sensitivity to DNA damaging agents and defects in recombination (28,54). Thus the repair and recombination defects of ssb113 might be explained, at least in part, by abrogation of a PriA–SSB interaction. However, given the pleiotropic effects of ssb113, specific inhibition of the PriA–SSB interaction in vivo will be required to establish the importance of SSB for PriA function.

The mutually exclusive interactions of primase and of the {chi} subunit of the clamp loader complex with SSB are thought to facilitate hand-off of the RNA primer from primase to DNA polymerase III, ensuring ordered assembly of the lagging strand polymerase (53). The PriA–SSB interaction detailed in this study suggests that SSB plays an extensive role in coordinating replication restart at every stage of the reaction, from initial loading of DnaB by PriA to recruitment of the DNA polymerase III holoenzyme complex. Coordination of replication restart by interactions between SSB and partner proteins might extend even further. A direct SSB–RecO interaction may modulate activity of the RecF, O and R proteins in directing loading of RecA onto SSB-coated ssDNA (5557). Furthermore, RecO and RecR stimulate recombination-directed DNA replication catalysed by PriA in vitro (12). Interactions between SSB and components of the recombination and replication machineries might act therefore to direct the repair of damaged replication forks from start to finish.

Our studies suggest that coordination of replication fork repair may be accomplished, at least in part, by SSB in prokaryotes. Is this a universal strategy? Loading of the bacteriophage T4 replicative helicase gp41 onto D-loops formed by recombination requires a physical and functional interaction between the single-stranded DNA binding protein gp32 and the helicase loader gp59 (58). A physical interaction between UL9 helicase and ICP8 single-stranded DNA binding protein of Herpes simplex virus 1 may play a role in the unwinding of HSV 1 origins of replication (59). Although eukaryotic enzymes responsible for initiation of replication at structures such as D-loops have yet to be identified, the eukaryotic single-stranded DNA binding protein RPA interacts with RecQ-type helicases required for maintenance of genome integrity (60) and with subunits of the MCM complex thought to constitute the eukaryotic replicative helicase (61). Moreover, SSB interacts physically and functionally with MCM DNA helicase in S.solfataricus, a homologue of the eukaryotic MCM complex (62). Orchestration of helicase function by contact with single-stranded DNA binding proteins is emerging as a crucial factor in the maintenance of genome stability throughout all domains of life.


    ACKNOWLEDGEMENTS
 
The authors would like to thank Ken Marians for supplying the priA expression plasmid and for a great deal of other help over the last four years. Thanks are also due to Malcolm White and Liza Cubeddu for supplying purified S.solfataricus SSB. P.M. is a Lister Institute-Jenner Research Fellow and this work was also funded by the MRC.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lindahl,T. ( (1996) ) The Croonian Lecture, 1996: endogenous damage to DNA. Philos. Trans. R. Soc. Lond. B Biol. Sci., , 351, , 1529–1538.[Web of Science][Medline]

  2. Vilette,D., Ehrlich,S.D. and Michel,B. ( (1995) ) Transcription-induced deletions in Escherichia coli plasmids. Mol. Microbiol., , 17, , 493–504.[Web of Science][Medline]

  3. McGlynn,P. and Lloyd,R.G. ( (2000) ) Modulation of RNA polymerase by (p)ppGpp reveals a RecG-dependent mechanism for replication fork progression. Cell, , 101, , 35–45.[CrossRef][Web of Science][Medline]

  4. Huertas,P. and Aguilera,A. ( (2003) ) Cotranscriptionally formed DNA:RNA hybrids mediate transcription elongation impairment and transcription-associated recombination. Mol. Cell, , 12, , 711–721.[CrossRef][Web of Science][Medline]

  5. Cox,M.M., Goodman,M.F., Kreuzer,K.N., Sherratt,D.J., Sandler,S.J. and Marians,K.J. ( (2000) ) The importance of repairing stalled replication forks. Nature, , 404, , 37–41.[CrossRef][Medline]

  6. McGlynn,P. and Lloyd,R.G. ( (2002) ) Recombinational repair and restart of damaged replication forks. Nat. Rev. Mol. Cell Biol., , 3, , 859–870.[CrossRef][Web of Science][Medline]

  7. Kuzminov,A. ( (1999) ) Recombinational repair of DNA damage in Escherichia coli and bacteriophage lambda. Microbiol. Mol. Biol. Rev., , 63, , 751–813.[Abstract/Free Full Text]

  8. Courcelle,J., Donaldson,J.R., Chow,K.H. and Courcelle,C.T. ( (2003) ) DNA damage-induced replication fork regression and processing in Escherichia coli. Science, , 299, , 1064–1067.[Abstract/Free Full Text]

  9. Seigneur,M., Bidnenko,V., Ehrlich,S.D. and Michel,B. ( (1998) ) RuvAB acts at arrested replication forks. Cell, , 95, , 419–430.[CrossRef][Web of Science][Medline]

  10. Horiuchi,T. and Fujimura,Y. ( (1995) ) Recombinational rescue of the stalled DNA replication fork: a model based on analysis of an Escherichia coli strain with a chromosome region difficult to replicate. J. Bacteriol., , 177, , 783–791.[Abstract]

  11. Gregg,A.V., McGlynn,P., Jaktaji,R.P. and Lloyd,R.G. ( (2002) ) Direct rescue of stalled DNA replication forks via the combined action of PriA and RecG helicase activities. Mol. Cell, , 9, , 241–251.[CrossRef][Web of Science][Medline]

  12. Xu,L. and Marians,K.J. ( (2003) ) PriA mediates DNA replication pathway choice at recombination intermediates. Mol. Cell, , 11, , 817–826.[CrossRef][Web of Science][Medline]

  13. LeBowitz,J.H. and McMacken,R. ( (1986) ) The Escherichia coli dnaB replication protein is a DNA helicase. J. Biol. Chem., , 261, , 4738–4748.[Abstract/Free Full Text]

  14. Fang,L., Davey,M.J. and O'Donnell,M. ( (1999) ) Replisome assembly at oriC, the replication origin of E. coli, reveals an explanation for initiation sites outside an origin. Mol. Cell, , 4, , 541–553.[CrossRef][Web of Science][Medline]

  15. Messer,W., Blaesing,F., Jakimowicz,D., Krause,M., Majka,J., Nardmann,J., Schaper,S., Seitz,H., Speck,C., Weigel,C. et al. ( (2001) ) Bacterial replication initiator DnaA. Rules for DnaA binding and roles of DnaA in origin unwinding and helicase loading. Biochimie, , 83, , 5–12.[Medline]

  16. Rupp,W.D. and Howard-Flanders,P. ( (1968) ) Discontinuities in the DNA synthesized in an excision-defective strain of Escherichia coli following ultraviolet irradiation. J. Mol. Biol., , 31, , 291–304.[CrossRef][Web of Science][Medline]

  17. McInerney,P. and O'Donnell,M. ( (2004) ) Functional uncoupling of twin polymerases: mechanism of polymerase dissociation from a lagging-strand block. J. Biol. Chem., , 279, , 21543–21551.[Abstract/Free Full Text]

  18. Sandler,S.J. and Marians,K.J. ( (2000) ) Role of PriA in replication fork reactivation in Escherichia coli. J. Bacteriol., , 182, , 9–13.[Free Full Text]

  19. Nurse,P., Liu,J. and Marians,K.J. ( (1999) ) Two modes of PriA binding to DNA. J. Biol. Chem., , 274, , 25026–25032.[Abstract/Free Full Text]

  20. McGlynn,P., Al-Deib,A.A., Liu,J., Marians,K.J. and Lloyd,R.G. ( (1997) ) The DNA replication protein PriA and the recombination protein RecG bind D-loops. J. Mol. Biol., , 270, , 212–221.[CrossRef][Web of Science][Medline]

  21. Ng,J.Y. and Marians,K.J. ( (1996) ) The ordered assembly of the {phi}X174-type primosome. I. Isolation and identification of intermediate protein–DNA complexes. J. Biol. Chem., , 271, , 15642–15648.[Abstract/Free Full Text]

  22. Liu,J., Nurse,P. and Marians,K.J. ( (1996) ) The ordered assembly of the phiX174-type primosome. III. PriB facilitates complex formation between PriA and DnaT. J. Biol. Chem., , 271, , 15656–15661.[Abstract/Free Full Text]

  23. McCool,J.D., Ford,C.C. and Sandler,S.J. ( (2004) ) A dnaT mutant with phenotypes similar to those of a priA2::kan mutant in Escherichia coli K-12. Genetics, , 167, , 569–578.[Abstract/Free Full Text]

  24. Sandler,S.J. ( (2000) ) Multiple genetic pathways for restarting DNA replication forks in Escherichia coli K-12. Genetics, , 155, , 487–497.[Abstract/Free Full Text]

  25. Lee,M.S. and Marians,K.J. ( (1987) ) Escherichia coli replication factor Y, a component of the primosome, can act as a DNA helicase. Proc. Natl Acad. Sci. USA, , 84, , 8345–8349.[Abstract/Free Full Text]

  26. Jones,J.M. and Nakai,H. ( (1999) ) Duplex opening by primosome protein PriA for replisome assembly on a recombination intermediate. J. Mol. Biol., , 289, , 503–516.[CrossRef][Web of Science][Medline]

  27. Sandler,S.J., Samra,H.S. and Clark,A.J. ( (1996) ) Differential suppression of priA2::kan phenotypes in Escherichia coli K-12 by mutations in priA, lexA, and dnaC. Genetics, , 143, , 5–13.[Abstract]

  28. Kogoma,T., Cadwell,G.W., Barnard,K.G. and Asai,T. ( (1996) ) The DNA replication priming protein, PriA, is required for homologous recombination and double-strand break repair. J. Bacteriol., , 178, , 1258–1264.[Abstract/Free Full Text]

  29. Nurse,P., Zavitz,K.H. and Marians,K.J. ( (1991) ) Inactivation of the Escherichia coli priA DNA replication protein induces the SOS response. J. Bacteriol., , 173, , 6686–6693.[Abstract/Free Full Text]

  30. Calendar,R., Lindqvist,B., Sironi,G. and Clark,A.J. ( (1970) ) Characterization of REP- mutants and their interaction with P2 phage. Virology, , 40, , 72–83.[CrossRef][Web of Science][Medline]

  31. Parsons,C.A., Kemper,B. and West,S.C. ( (1990) ) Interaction of a four-way junction in DNA with T4 endonuclease VII. J. Biol. Chem., , 265, , 9285–9289.[Abstract/Free Full Text]

  32. Marians,K.J. ( (1995) ) {phi}X174-type primosomal proteins: purification and assay. Methods Enzymol., , 262, , 507–521.[Web of Science][Medline]

  33. Bradford,M. ( (1976) ) A rapid and sensitive method for the quantitation of microgram quantites of protein utilizing the principle of protein-dye binding. Anal. Biochem., , 72, , 248.[CrossRef][Web of Science][Medline]

  34. McGlynn,P. and Lloyd,R.G. ( (1999) ) RecG helicase activity at three- and four-strand DNA structures. Nucleic Acids Res., , 27, , 3049–3056.[Abstract/Free Full Text]

  35. Witte,G., Urbanke,C. and Curth,U. ( (2003) ) DNA polymerase III chi subunit ties single-stranded DNA binding protein to the bacterial replication machinery. Nucleic Acids Res., , 31, , 4434–4440.[Abstract/Free Full Text]

  36. Lasken,R.S. and Kornberg,A. ( (1988) ) The primosomal protein n' of Escherichia coli is a DNA helicase. J. Biol. Chem., , 263, , 5512–5518.[Abstract/Free Full Text]

  37. Allen,G.C.,Jr. and Kornberg,A. ( (1993) ) Assembly of the primosome of DNA replication in Escherichia coli. J. Biol. Chem., , 268, , 19204–19209.[Abstract/Free Full Text]

  38. Jones,J.M. and Nakai,H. ( (2001) ) Escherichia coli PriA Helicase: fork binding orients the helicase to unwind the lagging strand side of arrested replication forks. J. Mol. Biol., , 312, , 935–947.[CrossRef][Web of Science][Medline]

  39. Wadsworth,R.I. and White,M.F. ( (2001) ) Identification and properties of the crenarchaeal single-stranded DNA binding protein from Sulfolobus solfataricus. Nucleic Acids Res., , 29, , 914–920.[Abstract/Free Full Text]

  40. Haseltine,C.A. and Kowalczykoski,S.C. ( (2002) ) A distinctive single-strand DNA-binding protein from the Archaeon Sulfolobus solfataricus. Mol. Microbiol., , 43, , 1505–1515.[CrossRef][Web of Science][Medline]

  41. Kerr,I.D., Wadsworth,R.I., Cubeddu,L., Blankenfeldt,W., Naismith,J.H. and White,M.F. ( (2003) ) Insights into ssDNA recognition by the OB fold from a structural and thermodynamic study of Sulfolobus SSB protein. EMBO J., , 22, , 2561–2570.[CrossRef][Web of Science][Medline]

  42. Lohman,T.M. and Ferrari,M.E. ( (1994) ) Escherichia coli single-stranded DNA-binding protein: multiple DNA-binding modes and cooperativities. Annu. Rev. Biochem., , 63, , 527–570.[Web of Science][Medline]

  43. Curth,U., Genschel,J., Urbanke,C. and Greipel,J. ( (1996) ) In vitro and in vivo function of the C-terminus of Escherichia coli single-stranded DNA binding protein. Nucleic Acids Res., , 24, , 2706–2711.[Abstract/Free Full Text]

  44. Handa,P., Acharya,N. and Varshney,U. ( (2001) ) Chimeras between single-stranded DNA-binding proteins from Escherichia coli and Mycobacterium tuberculosis reveal that their C-terminal domains interact with uracil DNA glycosylases. J. Biol. Chem., , 276, , 16992–16997.[Abstract/Free Full Text]

  45. Genschel,J., Curth,U. and Urbanke,C. ( (2000) ) Interaction of E. coli single-stranded DNA binding protein (SSB) with exonuclease I. The carboxy-terminus of SSB is the recognition site for the nuclease. Biol. Chem., , 381, , 183–192.[CrossRef][Web of Science][Medline]

  46. Kelman,Z., Yuzhakov,A., Andjelkovic,J. and O'Donnell,M. ( (1998) ) Devoted to the lagging strand-the {chi} subunit of DNA polymerase III holoenzyme contacts SSB to promote processive elongation and sliding clamp assembly. EMBO J., , 17, , 2436–2449.[CrossRef][Web of Science][Medline]

  47. Meyer,R.R. and Laine,P.S. ( (1990) ) The single-stranded DNA-binding protein of Escherichia coli. Microbiol. Rev., , 54, , 342–380.[Abstract/Free Full Text]

  48. Bujalowski,W. and Lohman,T.M. ( (1986) ) Escherichia coli single-strand binding protein forms multiple, distinct complexes with single-stranded DNA. Biochemistry, , 25, , 7799–7802.[CrossRef][Medline]

  49. Delagoutte,E. and von Hippel,P.H. ( (2003) ) Helicase mechanisms and the coupling of helicases within macromolecular machines. Part II: Integration of helicases into cellular processes. Q. Rev. Biophys., , 36, , 1–69.[CrossRef][Web of Science][Medline]

  50. Tanaka,T., Mizukoshi,T., Taniyama,C., Kohda,D., Arai,K. and Masai,H. ( (2002) ) DNA binding of PriA protein requires cooperation of the N-terminal D-loop/arrested-fork binding and C-terminal helicase domains. J. Biol. Chem., , 277, , 38062–38071.[Abstract/Free Full Text]

  51. Soultanas,P., Dillingham,M.S., Wiley,P., Webb,M.R. and Wigley,D.B. ( (2000) ) Uncoupling DNA translocation and helicase activity in PcrA: direct evidence for an active mechanism. EMBO J., , 19, , 3799–3810.[CrossRef][Web of Science][Medline]

  52. Shlomai,J. and Kornberg,A. ( (1980) ) A prepriming DNA replication enzyme of Escherichia coli. II. Actions of protein n': a sequence-specific, DNA-dependent ATPase. J. Biol. Chem., , 255, , 6794–6798.[Abstract/Free Full Text]

  53. Yuzhakov,A., Kelman,Z. and O'Donnell,M. ( (1999) ) Trading places on DNA—a three-point switch underlies primer handoff from primase to the replicative DNA polymerase. Cell, , 96, , 153–163.[CrossRef][Web of Science][Medline]

  54. Lee,E.H. and Kornberg,A. ( (1991) ) Replication deficiencies in priA mutants of Escherichia coli lacking the primosomal replication n' protein. Proc. Natl Acad. Sci. USA, , 88, , 3029–3032.[Abstract/Free Full Text]

  55. Umezu,K. and Kolodner,R.D. ( (1994) ) Protein interactions in genetic recombination in Escherichia coli. Interactions involving RecO and RecR overcome the inhibition of RecA by single-stranded DNA-binding protein. J. Biol. Chem., , 269, , 30005–30013.[Abstract/Free Full Text]

  56. Morimatsu,K. and Kowalczykowski,S.C. ( (2003) ) RecFOR proteins load RecA protein onto gapped DNA to accelerate DNA strand exchange: a universal step of recombinational repair. Mol. Cell, , 11, , 1337–1347.[CrossRef][Web of Science][Medline]

  57. Kantake,N., Madiraju,M.V., Sugiyama,T. and Kowalczykowski,S.C. ( (2002) ) Escherichia coli RecO protein anneals ssDNA complexed with its cognate ssDNA-binding protein: a common step in genetic recombination. Proc. Natl Acad. Sci. USA, , 99, , 15327–15332.[Abstract/Free Full Text]

  58. Ma,Y., Wang,T., Villemain,J.L., Giedroc,D.P. and Morrical,S.W. ( (2004) ) Dual functions of single-stranded DNA-binding protein in helicase loading at the bacteriophage T4 DNA replication fork. J. Biol. Chem., , 279, , 19035–19045.[Abstract/Free Full Text]

  59. Arana,M.E., Haq,B., Tanguy Le Gac,N. and Boehmer,P.E. ( (2001) ) Modulation of the herpes simplex virus type-1 UL9 DNA helicase by its cognate single-strand DNA-binding protein, ICP8. J. Biol. Chem., , 276, , 6840–6845.[Abstract/Free Full Text]

  60. Hickson,I.D. ( (2003) ) RecQ helicases: caretakers of the genome. Nat. Rev. Cancer, , 3, , 169–178.[CrossRef][Web of Science][Medline]

  61. Kneissl,M., Putter,V., Szalay,A.A. and Grummt,F. ( (2003) ) Interaction and assembly of murine pre-replicative complex proteins in yeast and mouse cells. J. Mol. Biol., , 327, , 111–128.[CrossRef][Web of Science][Medline]

  62. Carpentieri,F., De Felice,M., De Falco,M., Rossi,M. and Pisani,F.M. ( (2002) ) Physical and functional interaction between the mini-chromosome maintenance-like DNA helicase and the single-stranded DNA binding protein from the crenarchaeon Sulfolobus solfataricus. J. Biol. Chem., , 277, , 12118–12127.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
J. A. Buss, Y. Kimura, and P. R. Bianco
RecG interacts directly with SSB: implications for stalled replication fork regression
Nucleic Acids Res., December 1, 2008; 36(22): 7029 - 7042.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Lu and J. L. Keck
Structural basis of Escherichia coli single-stranded DNA-binding protein stimulation of exonuclease I
PNAS, July 8, 2008; 105(27): 9169 - 9174.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. M. Baitin, M. C. Gruenig, and M. M. Cox
SSB Antagonizes RecX-RecA Interaction
J. Biol. Chem., May 23, 2008; 283(21): 14198 - 14204.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Arad, A. Hendel, C. Urbanke, U. Curth, and Z. Livneh
Single-stranded DNA-binding Protein Recruits DNA Polymerase V to Primer Termini on RecA-coated DNA
J. Biol. Chem., March 28, 2008; 283(13): 8274 - 8282.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. D. Shereda, D. A. Bernstein, and J. L. Keck
A Central Role for SSB in Escherichia coli RecQ DNA Helicase Function
J. Biol. Chem., June 29, 2007; 282(26): 19247 - 19258.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. D. Hobbs, A. Sakai, and M. M. Cox
SSB Protein Limits RecOR Binding onto Single-stranded DNA
J. Biol. Chem., April 13, 2007; 282(15): 11058 - 11067.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
R. Fedorov, G. Witte, C. Urbanke, D. J. Manstein, and U. Curth
3D structure of Thermus aquaticus single-stranded DNA-binding protein gives insight into the functioning of SSB proteins
Nucleic Acids Res., December 5, 2006; (2006) gkl1002v1.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. D. S. Cameron and R. J. Redfield
Non-canonical CRP sites control competence regulons in Escherichia coli and many other {gamma}-proteobacteria
Nucleic Acids Res., November 6, 2006; 34(20): 6001 - 6014.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. J. Cadman, M. Lopper, P. B. Moon, J. L. Keck, and P. McGlynn
PriB Stimulates PriA Helicase via an Interaction with Single-stranded DNA
J. Biol. Chem., December 2, 2005; 280(48): 39693 - 39700.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. L. Maxwell, P. Reed, R.-g. Zhang, S. Beasley, A. R. Walmsley, F. A. Curtis, A. Joachimiak, A. M. Edwards, and G. J. Sharples
Functional similarities between phage {lambda} Orf and Escherichia coli RecFOR in initiation of genetic exchange
PNAS, August 9, 2005; 102(32): 11260 - 11265.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
L. M. Iyer, E. V. Koonin, D. D. Leipe, and L. Aravind
Origin and evolution of the archaeo-eukaryotic primase superfamily and related palm-domain proteins: structural insights and new members
Nucleic Acids Res., July 15, 2005; 33(12): 3875 - 3896.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. J. Sandler
Requirements for Replication Restart Proteins During Constitutive Stable DNA Replication in Escherichia coli K-12
Genetics, April 1, 2005; 169(4): 1799 - 1806.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (391K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Cadman, C. J.
Right arrow Articles by McGlynn, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cadman, C. J.
Right arrow Articles by McGlynn, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?