Published online 13 February 2004
Nucleic Acids Research, 2004, Vol. 32, No. 3 1143-1153
© 2004 Oxford University Press
Psoralen interstrand cross-link repair is specifically altered by an adjacent triple-stranded structure
Laboratoire de Biophysique, INSERM U565, CNRS UMR5153, Muséum National dHistoire Naturelle, 43 rue Cuvier, 75231 Paris Cedex 05, France and 1 UMR CNRS/Institut Curie 218, Institut Curie, Section de Recherche, 26 rue dUlm, 75248 Paris, France
*To whom correspondence should be addressed. Tel: +33 1 40 79 36 84; Fax: +33 1 40 79 37 05; Email: praseuth{at}mnhn.fr
Received October 8, 2003; Revised and Accepted January 16, 2004
| ABSTRACT |
|---|
|
|
|---|
Targeting DNA-damaging agents to specific DNA sites by using sequence-specific DNA ligands has been successful in directing genomic modifications. The understanding of repair processing of such targeted damage and the influence of the adjacent complex is largely unknown. In this way, directed interstrand cross-links (ICLs) have already been generated by psoralen targeting. The mechanisms responsible for ICL removal are far from being understood in mammalian cells, with the proposed involvement of both mutagenic and recombinogenic pathways. Here, a unique ICL was introduced at a selected site by photoactivation of a psoralen moiety with the use of psoralen conjugates of triplex-forming oligonucleotides. The processing of psoralen ICL was evaluated in vitro and in cells for two types of cross-linked substrates, either containing a psoralen ICL alone or with an adjacent triple-stranded structure. We show that the presence of a neighbouring triplex structure interferes with different stages of psoralen ICL processing: (i) the ICL-induced DNA repair synthesis in HeLa cell extracts is inhibited by the triplex structure, as measured by the efficiency of true and futile repair synthesis, stopping at the ICL site; (ii) in HeLa cells, the ICL removal via a nucleotide excision repair (NER) pathway is delayed in the presence of a neighbouring triplex; and (iii) the binding to ICL of recombinant xeroderma pigmentosum A protein, which is involved in pre-incision recruitment of NER factors is impaired by the presence of the third DNA strand. These data characterize triplex-induced modulation of ICL repair pathways at specific steps, which might have implications for the controlled induction of targeted genomic modifications and for the associated cellular responses.
| INTRODUCTION |
|---|
|
|
|---|
Sequence-specific DNA ligands such as triplex-forming molecules [oligonucleotides (TFO), and peptide nucleic acids (PNAs)] are promising reagents that can interfere with DNA metabolism. TFOs have been successfully used to modulate gene transcription (initiation and elongation), and also replication and repair processes, in some cases leading to the induction of targeted genomic modifications [for reviews see Faria and Giovannangeli (1), Knauert and Glazer (2) and Seidman and Glazer (3)]. TFOs can serve as vectors for common DNA-damaging molecules, such as cross-linking or cleaving agents. Such bifunctional molecules provide useful tools to induce controlled DNA modifications, and the molecular events surrounding damage repair in the absence or presence of the oligonucleotide moiety must be characterized to elucidate the corresponding cellular responses.
Interstrand cross-links (ICLs) between nucleotides in complementary DNA strands are common lesions introduced into DNA by drugs such as psoralen, nitrogen mustards or cisplatin. The sequence of events involved in the removal of such cross-links is not yet understood in mammalian cells. Studies using cell lines deficient in specific repair proteins suggest that several repair pathways are probably involved in ICL repair. From these genetic approaches, both recombination-dependent and -independent pathways have been implicated (4,5), and an essential role for the ERCC1XPF heterodimer has been described, this complex being involved in nucleotide excision repair (NER) and in other repair processes (6,7). In vitro studies have revealed that both mammalian cell extracts and purified components of NER can promote incisions on the 5' (810) and 3' (8,11) sides of the psoralen ICL. A double incision 5' to the psoralen ICL leads to a 5' gap (9), and this gap can be converted to a nick adjacent to the ICL following DNA synthesis (12). The implication of such futile synthesis in the repair process remains unknown. ICLs have been shown to induce DNA synthesis, not only in the damaged plasmid, but also in another plasmid present in the reaction. This hallmark of ICL repair is not well understood but requires XPFERCC1 and the recombination factors, XRCC2 and XRCC3 (6). The early stages of ICL repair in mammalian cells are also of intense interest with the recent identification of new components, such as the mismatch complex hMutSß (7).
In this study, we characterize the repair of a unique psoralen ICL, in the absence or presence of an adjacent triple-stranded structure, with the use of TFOpsoralen conjugates. We and others have previously used such conjugates and showed that: (i) in cells, they can induce targeted mutagenesis and stimulate recombination, both processes being influenced by the presence of the triplex structure, and both involving NER factors such as xeroderma pigmentosum A protein (XPA) (1316); and (ii) in cell extracts, the incision near the cross-linked psoralen was inhibited by the presence of the third strand (10,17). In this report, we further elucidate the molecular basis for the different processing of these two types of cross-linked substrates, either containing a psoralen ICL alone or with an adjacent triple-stranded structure. We present evidence that: (i) in HeLa nuclear extracts, the presence of an adjacent triplex structure decreased the level of repair synthesis and mainly suppressed the production of one of the two products of futile repair synthesis stopping at the ICL; (ii) in HeLa cells, ICL removal by an NER-dependent pathway was delayed when a triple-stranded structure was present; and (iii) binding of human recombinant XPA to psoralen ICLs was inhibited by a neighbouring triplex. These data demonstrate triplex interference at specific stages of psoralen ICL repair. We will discuss the implications of our observations for the future design of strategies aimed at targeting controlled genomic modifications.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Oligonucleotides
Psoralen TFO conjugates, Pso-S-S-16TC, Pso-16TC and Pso-15TCG, were described previously (10,13); for sequences, see Figure 1B.
|
Preparation of psoralen cross-linked DNA substrates
Two types of DNA substrates containing the oligopyrimidine·oligopurine sequence suitable for triplex formation (the polypurine tract sequence of HIV-1, abbreviated as HIV-PPT: 5' AAAAGAAAAGGGGGGA 3') (18) were used: either two plasmids, pSP-F47 (3360 bp) abbreviated as P (see details in Fig. 2A), and PGK/luc plasmid (8850 bp) abbreviated as Pluc (see details in Fig. 4), or two short duplex oligonucleotides (76D and 29D). The synthetic duplexes are formed with complementary oligonucleotides, and the sequence of the purine-containing strand is as follows: 5'-CAAGGCAGCT GTAGATCTTAG (CCACTTTTTAAAAGAAAAGGGGG GACTGG)AAGGGCTAATTCACTCCCAACA-3'; the 76D duplex includes the 29D duplex as indicated (parentheses). All these DNA substrates were modified at a 5' TA 3' motif adjacent to the triplex site in two different ways using psoralen conjugates: either Pso-S-S-16TC [containing a cleavable disulfide (S-S) bond] for generation of a substrate with a unique psoralen ICL, or Pso-16TC or Pso-15TCG (uncleavable) for generation of a substrate with a unique cross-linked triple-stranded structure (Fig. 1). In all cases, the DNA targets were incubated with the appropriate TFO to form the triplex (in 10 mM MES pH 6 or 10 mM Tris pH 7, 50 mM NaCl, 10 mM MgCl2), and UV irradiated according to Giovannangeli et al. (19) (monochromatic light, 365 nm). After the covalent triplex was formed, the disulfide bridge in Pso-S-S-16TC was reduced with 1 mM dithiothreitol (DTT; 37°C, 1 h incubation) in order to eliminate the third strand portion. The cleaved and unreacted oligonucleotides were removed by gel filtration chromatography (Chromaspin, Clontech) for plasmid substrates. Two constructs were obtained: plasmids or synthetic duplexes containing a single psoralen ICL at the PPT triplex site are designed by Pso-(P or Pluc) and Pso-(29 or 76)D, respectively. 15/16-Pso-P and 15/16-Pso-D stand for covalent triple-stranded structures obtained with uncleavable Pso-15TCG/Pso-16TC, respectively. Under the experimental conditions used, >90% of the double-stranded DNA target could be modified with a unique psoralen ICL (for an illustration, see Fig. 2B, lanes 1 and 2). The unmodified DNAs (P or Pluc, 76D or 29D) were treated in the same way as the corresponding modified substrate (irradiation, DTT reduction and chromatography).
|
|
In vitro repair synthesis assay
The nucleotide incorporation assay was performed in a 50 µl reaction mixture, according to Wood et al. (20). Briefly, the plasmid (0.3 µg), either unmodified (P) or modified (Pso-P, 15-Pso-P), was incubated in HeLa cell nuclear extracts (80 µg) (Promega) in the presence of 2 mM ATP, 20 µM dATP, dTTP, dGTP, 8 µM dCTP and 2 µCi of [
-32P]dCTP (3000 Ci/mmol) in the presence of 40 mM creatine phosphate, 2.5 µM creatine phosphokinase. The buffer was 45 mM HEPES pH 7.8, 70 mM KCl, 7 mM MgCl2, 0.9 mM DTT, 0.4 mM EDTA, 3.5% glycerol, 0.36 mg/ml bovine serum albumin. Incubation was performed for 3 h at 30°C. After purification, the plasmid was cleaved with BglII and EcoRV (or BsrI), producing the fragments represented in Figure 2A. The 65py·69pu (or 32py·38pu) fragments contain the ICL site and the oligopyrimidine·oligopurine target sequence for triplex formation. In parallel, in order to characterize the nature of the fragments obtained after restriction cleavage, the plasmid (P, Pso-P or 15-Pso-P) was digested by the appropriate set of enzymes in the absence of incubation in extracts, and the fragments were 5'-labelled with T4 polynucleotide kinase (Biolabs) and [
-32P]ATP by standard procedures. In all cases, the products were analysed and quantitated by 8% acrylamide/bisacrylamide 19:1 sequencing PAGE.
Quantification of repair-induced neo-synthesized fragments
Full-length neo-synthesized products. Full-length synthesized fragments were quantitated taking into account the following factors. (i) The number of cytosines in various products, since we performed a [
-32P]dCTP incorporation assay as described above. It must be noted that the control fragments (80 for BglIIEcoRV digestion, and 43 for BglIIBsrI digestion) are composed of two strands that are not separated by electrophoresis in our conditions. The numbers of cytosines are as follows: 17 in 69pu, 16 in 65py, 42 in (80+80), five in 38pu, eight in 32py and 19 in (43+43). (ii) The detectable incorporation present in undamaged fragments (control fragments). (iii) The initial abundance of the fragments. It is thus possible to determine the amount of synthesized product specifically due to repair processing, i.e. the relative repair activity (Fig. 3A). It was calculated as explained in the following example, for the synthesis of the purine strand (69pu) with analysis with BglIIEcoRV digestion (see Fig. 2): the 80 nt fragments (abbreviated as 80+80), undamaged and adjacent to the target fragment, were used as references. Then the relative repair activity of 69pu was obtained by dividing (a) by (b) with: (a) the relative abundance of the neo-synthesized products 69pu, estimated by the ratio of radioactivity of the fragments 69pu to (80+80) obtained in the [
-32P]dCTP incorporation assay, corrected by the number of cytosines; and (b) the initial abundance of the products 69pu and (80+80), before reaction in the extracts, estimated by the ratio of radioactivity of the fragments (69pu + 65py) to (80+80) obtained in kinase labelling experiments. The relative repair activity obtained for the undamaged plasmid P should be close to 1 if the efficiencies of kinase labelling are identical for every fragment. In our system, higher efficiency was obtained for overhang versus blunt end labelling, and we chose to normalize to 1 the activity obtained for the undamaged plasmid P.
|
It must be noted that we did not take into account recent results describing a possible stimulation of nucleotide incorporation when an undamaged plasmid was added to the solution in appropriate conditions, especially in excess compared with the damaged plasmid (6). In our experimental conditions, the amount of unmodified plasmid represented <10% and might not induce increased incorporation. If such incorporation occurs, our evaluation of relative repair activity would be under-estimated.
Futile neo-synthesized products. The abundance of these fragments was calculated on the basis of signal intensities and cytosine contents. The number of cytosines for the different fragments are: 15 in 52py, seven in 19py and four in 17pu. For information, the number of cytosines for fragments that are not observed is one for 13py, nine for 52pu and one for 21pu.
DNA repair assay in cells
The PGK/luc plasmid, abbreviated as Pluc, contained the firefly luciferase (Photinus pyralis) gene under the control of the phosphoglycerate kinase (PGK) promoter. A 34 bp insert (5' CCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGG 3') containing the polypurine tract PPT/HIV-1 was cloned in the 5'-transcribed sequence of the luciferase gene (BamHIHindIII fragment from the pGL2-basic vector; Promega), downstream of the putative PGK start site, as previously described in more detail (21,22). The Renilla luciferase (Renilla reniformis; RL) control vector (CMV-RL; Promega) was used to monitor transfection efficiency. The RL gene was inserted downstream of the cytomegalovirus (CMV) immediate-early enhancer/promoter region.
The Pluc plasmid was modified at
9095% by a single psoralen ICL (Pso-Pluc) or by a single cross-linked triplex (15-Pso-Pluc), as described previously. The various Pluc plasmids (0.5 µg), modified or not, were co-transfected with the control vector expressing Renilla luciferase CMV-RL plasmid (0.005 µg), in HeLa cells (in 24-well plates) using Superfect transfection reagent (Qiagen), as described (21). The mixture was prepared for duplicates or triplicates. Both luciferase activities (firefly and Renilla) were measured in the same cell extract by using the dual-luciferase assay kit (Promega); the ratio (firefly/Renilla), called the relative luciferase activity, was used to monitor the cellular processing of the various modified plasmids with time.
Analysis of recombinant XPA binding to psoralen cross-linked substrates
GSTXPA (rXPA) was prepared according to Saijo et al. (23,24). Binding activity of rXPA was characterized by electrophoretic mobility shift assay (EMSA) (4% non-denaturing acrylamide gel in 1x TBE buffer), as described previously (2527).
The duplex probes [unmodified 29D and 76D, or modified Pso-(29 or 76)D and 16-Pso-(29 or 76)D] were purified on denaturating gels and 5'-32P-labelled on both strands. The radiolabelled target was incubated with rXPA (50 mM MES pH 6, 0.1 M NaCl, 10 mM MgCl2) according to Jones et al. (28). Incubation was performed for 1 h at 30°C and species were separated by EMSA. Mixtures with defined percentages of psoralen ICL at the triplex site were obtained by treating the sample (76D in the presence of Pso-S-S-16TC) for variable irradiation times. The amount of ICL was determined by denaturing electrophoresis and is expressed as the ratio Pso-76D:76D (Fig. 5A).
|
| Results |
|---|
|
|
|---|
Substrates with a single psoralen interstrand cross-link
Plasmids or short synthetic duplexes containing a specific oligopyrimidine·oligopurine sequence (named HIV-PPT) were modified with two types of psoralen derivatives: the goal was to obtain at the same defined site in DNA a single psoralen ICL, either alone (by treatment with cleavable Pso-S-S-16TC) or associated with an adjacent triplex (by treatment with uncleavable Pso-16TC or Pso-15-TCG) (Fig. 1, and details in Materials and Methods). Following treatment with TFOpsoralen conjugates, the efficiency of ICL formation for each substrate was evaluated by electrophoresis analysis after 5' labelling. As an example, ICL induction in the plasmid pSP-F47 (P) was determined by 5' labelling of DNA fragments obtained by BglII and EcoRV digestion followed by electrophoresis analysis (Fig. 2B). The mobility of cross-linked products was reduced compared with that of undamaged fragments. The 69pu and 65py fragments containing the oligopyrimidine·oligopurine target were converted to cross-linked fragments with an efficiency of
90%, whereas the 80 nt fragment lacking the target was unaffected (Fig. 2B, lanes 13). Equivalent levels of modifications were obtained with synthetic oligonucleotide substrates.
Repair synthesis of the specific target fragment is decreased by the presence of an adjacent triple-stranded structure
The initial stages of ICL repair require incisions to be made in the vicinity of the cross-linked site; these incisions are associated with DNA repair synthesis. To analyse the repair synthesis in vitro, damaged plasmids were incubated in the presence of HeLa cell extracts, and DNA synthesis, induced by a single psoralen ICL that was introduced at a defined site in the Pso-P or 15-Pso-P plasmids, was measured as the specific incorporation of labelled [
-32P]dCTP into damage-containing fragments. The competency of the extracts to perform NER in our experimental conditions was evaluated by using a plasmid carrying a unique cisplatin ICL between two guanines in a GTG sequence. This cisplatin lesion is known to be a good substrate for NER (29) and therefore serves as a positive control. Repair activity was detected since a fragment containing the cisplatin cross-link (33 nt long) became specifically 3- to 4-fold more radioactive in the damaged plasmid compared with the control undamaged plasmid (data not shown).
Incorporation of labelled nucleotides reflects a neo-synthesis activity, and the different products have been analysed on denaturing PAGE. The damage-containing fragments, 69(38)pu or 65(32)py, were generated by double digestion with BglII and EcoRV (BsrI) as shown in Figure 2A. The radioactive signals corresponding to intact purine and pyrimidine fragments were significantly higher for cross-linked substrates than what would be expected from non-specific incorporation into the small residual undamaged fragments. Noticeably a background synthesis independent of repair (30,31) was also detected in the undamaged fragments present in the control sample (Fig. 2B, lane 6, and C, lane 4). This is attributed to nicking activities present in the extracts or arising as a consequence of the irradiation step. The neo-synthesis associated with repair processes (relative repair activity) was evaluated for each strand (see Materials and Methods) and is presented in Figure 3A. Levels of repair synthesis of pyrimidine and purine strands were increased (2.5- to 5-fold) in cross-linked compared with control plasmids, and were slightly decreased (3040%) by the presence of the triplex structure.
Futile repair synthesis depends on the nature of the cross-linked substrate
In addition to the full-length fragments described above, shorter neo-synthesized products were also observed; their sizes corresponded to the length (±1 nt) between the proximal enzymatic cleavage site and the position of the psoralen ICL located at the DraI digestion site. In Figure 2B (lanes 4 and 8) and C (lane 2), short fragments of 52(19)py and 17/16pu were clearly detected (according to the digest). Triplex did not affect the production of the short purine (17/16 nt) fragment (Fig. 2B, lanes 8 and 9), whereas the pyrimidine short fragment [52 (19) nt] was completely abolished (Fig. 2B, lanes 4 and 5, and C, lanes 2 and 3).
These truncated neo-synthesis fragments are consistent with the so-called futile DNA synthesis products described by Mu et al. (12). These authors reported that a psoralen ICL induced a DNA synthesis that converted an excision gap 5' to the ICL into a nick without removing the damage. Several findings support the idea that our observed truncated neo-synthesized products are the result of specific repair synthesis. First, we observed a synthesis signal 13-fold stronger for the pyrimidine strand compared with that for the purine strand (ICL in the Pso-P plasmid) (Figs 2 and 3B). Such a 10-fold ratio was observed previously for the futile synthesis induced by the pyrone-side adducted thymine compared with the furane-side adducted thymine (12), reflecting a differential incision efficiency as reported by Bessho et al. (9). Such stoichiometry is consistent with the preferential orientation of the psoralen moiety in our system, with the furane side adducted on the purine strand and the pyrone side on the pyrimidine strand [data not shown; Takasugi et al. (32)]. Secondly, we observed a lack of futile synthesis specifically for the pyrimidine strand in the presence of the triplex structure (15-Pso-P plasmid). These data are consistent with our previous demonstration that the incision step during repair of a psoralen cross-link was inhibited at the triplex site in the presence of the third strand in HeLa nuclear extracts (10). In addition, the fact that no product was detected for the pyrimidine strand using 15-Pso-P plasmid as a substrate reflected a synthesis caused by damage repair and not originating from a repair-independent incision downstream of the lesion. Indeed, such an incision should have been elongated and detected [as a 52 nt (in BglII/EcoRV analysis) or 19 nt fragment (in BglII/BsrI analysis)] since DNA polymerization could initiate downstream of a covalent triplex (data not shown based on primer extension experiments with Klenow DNA polymerase) (33,34). Thirdly, production of these truncated fragments by nucleotide incorporation until the damage position required the presence of ATP (data not shown).
Finally, for the Pso-P plasmid, a product corresponding to religation of futile synthesis repair fragments to thymine still carrying the psoralen was detected (shown by an asterisk in Fig. 2B, lane 4), as reported previously in another system (12). This product was detected when Pso-P plasmid was used as a substrate, but not for the 15-Pso-P plasmid (Fig. 2B, lane 5). This lack of religated product in the presence of the triplex is consistent with the notion that (i) the ligated product resulted from the two futile synthesis products, and therefore could not be produced in the presence of the third strand; and also that (ii) for the futile-synthesized purine strand, which is produced in the presence of the third strand, the triplex could inhibit the ligation step.
A triple-stranded structure delayed cross-link repair in cells
Since we observed that a triple-stranded structure inhibited ICL repair by interfering with the repair machinery at specific stages (incision, repair synthesis and religation) in vitro, we decided to evaluate the processing of cross-linked substrates in cells. The PPT sequence was cloned between the promoter and the coding region of the luciferase reporter gene (PGK/luc plasmid, named Pluc). This plasmid was modified with either cleavable Pso-S-S-16TC (Pso-Pluc plasmid) or uncleavable Pso-15TCG (15-Pso-Pluc plasmid), and then transfected into HeLa cells. Luciferase reactivation was used to monitor ICL removal by a recombination-independent and error-prone repair pathway, involving NER factors, as described previously (5). Luciferase activity was measured at different times after transfection (Fig. 4). At 24 h post-transfection, luciferase activity was inhibited by 9095% for Pso-Pluc and 15-Pso-Pluc, in agreement with the yield of psoralen ICL obtained for each construct. At later times, luciferase reactivation increased and, at all times, we observed that luciferase activity from Pso-Pluc was twice that for 15-Pso-Pluc. This result is consistent with a 2-fold lower repair rate of 15-Pso-Pluc compared with Pso-Pluc in this assay.
Recombinant XPA binds to a fragment containing a unique psoralen interstrand cross-link and complex formation is influenced by an adjacent triplex structure
In cells, NER factors have been shown to be sequentially assembled and XPA is involved in a pre-incision step for the loading of different components of the NER complex (35). In vitro, XPA has been described in some cases as a damage-sensing factor (25,36,37). In order to characterize further the effect of a triplex structure on NER processing of psoralen ICLs, we examined the binding affinity of recombinant human protein rXPA for duplexes containing a unique psoralen ICL, alone or in the presence of a triple helix. For this purpose, two target duplexes of different lengths (76D and 29D, see sequences in Materials and Methods) were modified with a unique psoralen ICL (in Pso-76D or Pso-29D) or with a unique covalent triplex (in 16/15-Pso-76D or 16/15-Pso-29D; Fig. 1). These substrates were incubated in the presence of recombinant rXPA and the resulting complexes were analysed by gel retardation assay (Fig. 5). The complex was detected as a retarded band (L) on top of the gel. The amount of L complex increased proportionally with the amount of psoralen-modified duplex (Fig. 5A), indicating that the L complex represents a specific association between rXPA and the damaged DNA. We have estimated [using the dissociation constant (Kd)] the protein concentration that bound 50% of the substrate: for Pso-76D, Kd = 0.3 x 106 M, compared with 106 M for unmodified 76D duplex. These values agree with previously published values (Kd = 0.3 x 106 M versus 1.7 x 106 M for a 258 bp fragment in the presence or absence of four sites of UV damage, respectively) (28).
The proportion of complex was quantified for various damaged substrates (Fig. 5B). Complex formation was inhibited to varying extents depending on the nature of the third strand: 54% inhibition with the phosphodiester Pso-16TC (PO) (16-Pso-29D substrate), 70% inhibition with the phosphodiester Pso-15TCG(PO) [15(PO)-Pso-29D substrate] and 85% with the phosphoramidate Pso-15TCG(NP) [15(NP)-Pso-29D substrate]. The level of rXPA binding thus decreased as the thermodynamic stability of the triplex increased (38). However, the covalent triplex was still better recognized by rXPA than undamaged DNA. Similar results were obtained concerning rXPA binding affinities independently of the length of the various substrates (D, Pso-D or 16/15-Pso-D) in the tested range, 76 or 29 bp long, and also independently of the substrate sequence (another sequence suitable for triplex formation was tested 5' AAAAGGAGAGGGAGA 3'; data not shown). In contrast, in previous studies performed with prokaryote repair systems, triplexes were found to inhibit damage processing at the cleavage but not at the recognition step (39).
These data on rXPA binding must be considered with respect to helical distortions induced by a DNA triplex and the sensitivity of XPA to conformational alterations in the helical structure. The nature of the triplex (length of the third strand, Hoogsteen or reverse Hoogsteen motif, position of the ICL site at the 5' or 3' side of the triplex) could strongly influence induced distortion and, consequently, the affinity of XPA for the lesion (26). Further studies are needed to evaluate the precise influence of this set of factors.
Finally, the lower rXPA binding to psoralen ICL observed in the presence of an adjacent triplex structure is consistent with the decrease in luciferase reactivation described above, reflecting a decrease in cellular removal of psoralen ICL with a triplex, since this reactivation has been shown to be XPA dependent (5).
| Discussion |
|---|
|
|
|---|
This report shows that a psoralen ICL was differentially recognized whether alone or in the context of a DNA triple-helical structure by elements of the repair machinery, both in vitro and in cells. To summarize our findings, the presence of the third strand influenced different stages of psoralen ICL processing: (i) repair synthesis in HeLa cell extracts is inhibited by the triplex structure, as schematically described in Figure 3B; (ii) the ICL removal involving NER factors is delayed in HeLa cells in the presence of a triplex; and (iii) the triplex structure impaired recombinant XPA binding of a neighbouring psoralen ICL and the level of this inhibition is correlated with the binding affinity of the third strand to DNA. Triplex-forming molecules have been successfully used to position DNA-damaging agents such as psoralen molecules, with the goal of inducing targeted genomic modifications. In mammalian cells, there are indirect data demonstrating the contribution of NER factors, especially XPA, in mutagenesis and recombination processes induced by a cross-linked triplex (14,16). The molecular basis of processes leading to targeted DNA modifications is far from understood. In this context, we will discuss how our data may be useful in advancing this characterization and in designing future strategies aimed at targeting controlled genomic modifications.
The exact mechanism of psoralen ICL repair is still poorly understood in mammalian systems. Initially, repair processes are based on generation of various incisions in the vicinity of the lesion. At present, the factors responsible for these incisions as well as their exact sites remain to be determined. We and others did not directly detect species corresponding to 3' cleavage (9,10). However, such 3' incisions were directly detected in different experimental systems (7,8,11), and have been attributed to NER proteins with a major role in the ERCC1XPF complex and recently also to MMRs (MutSß). Combining the results presented in this work and those of several other recent studies leads us to a putative model for the repair of the two types of studied cross-linked substrates (summarized in Fig. 6). We propose various scenarios starting from the futile synthesis fragments stopping at the psoralen ICL, as intermediates in the ICL repair process, including modulation by an adjacent triplex structure [indicated by () in Fig. 6].
|
A small fraction [
10% according to Mu et al. (12)] of these truncated fragments can be religated to the adducted thymines (Fig. 6A). We showed here that religation leading to regeneration of a cross-linked substrate was inhibited in the presence of the triplex structure (Fig. 2B). Consequently, the pathway shown in Figure 6A does seem to be ineffective for psoralen ICL in the presence of a triplex. Futile synthesis products could also be processed in order to eliminate the ICL. Mainly, two pathways could be envisaged (Fig. 6B and C).
In the pathway shown in Figure 6B, a nick occurs 3' to the lesion, on the same strand as the incision 5' to the lesion which led to futile synthesis. DNA synthesis can then fill in the resulting gap by translesion bypass. Such translesion synthesis has already been characterized; it involves a specialized distributive polymerase (probably a homologue of Saccharomyces cerevisiae Rad30), more tolerant to structural defaults (40). It must be noted that the finding of the possible involvement of 3'5' exonuclease activity of ERCC1XPF in the presence of RPA (12) would even make the 5' cleavage unnecessary, and lead to the same end result. In any case, the remaining damage could then be removed by an additional cleavage process. This mechanism would predict that the base opposing the cross-linked thymine would be a mutation hot-spot as a result of the bypass synthesis. We have directly measured triplex interference during this pathway. Indeed, we have quantified the cellular removal of a site-specific psoralen ICL, either alone or with an adjacent triplex structure, using reactivation of a reporter gene when the damage was located in the 5'-transcribed but untranslated region. In HeLa cells, we have observed a decrease in ICL removal in the presence of the triplex structure. This result supports our in vitro data discussed above describing the triplex-induced inhibition of the repair machinery, at different levels (incision, repair synthesis). Such inhibition of this pathway might be associated with an increased contribution of the recombination pathway (Fig. 6C) for triplex-associated ICL repair.
In the pathway shown in Figure 6C, a nick is produced 3' to the lesion, on the strand opposite to the incision 5' to the lesion that led to futile synthesis. A double-strand break (DSB) can appear as an intermediate during ICL repair, as already demonstrated, both in cells and in vitro (4,7,41). In our experimental conditions we did not reveal any DSB. Another way to generate such a DSB could be an arrest of the replication fork near the ICL site in dividing cells. In any case, recombination-dependent repair will take place by different mechanisms; they could be error-free [homologous recombination (HR)] or error-prone [end-joining (EJ), single-strand annealing (SSA) or break-induced replication (BIR)] processes.
Our data demonstrate triplex-induced inhibition of the repair machinery in vitro and in cells, and suggest an increased contribution of the pathway shown in Figure 6C compared with that shown in Figure 6B. These findings are consistent with mutagenesis and recombination results obtained with a positioned psoralen ICL, alone or with an adjacent triplex: (i) the mutation frequency (Fig. 6B) was lower in the presence of the triplex structure (17), whereas the recombination frequency (Fig. 6C) was higher (14); and (ii) two types of mutation are induced around the site of the specific ICL for both types of ICL (in the presence or absence of the triplex structure); they are point mutations facing the adducted thymine (generated from the pathway shown in Fig. 6B) and deletions (generated from the pathway shown in Fig. 6C). The deletions were longer in the presence of the triplex (17).
The present work advances the molecular understanding of processes leading to targeted modifications of DNA in mammalian cells with the use of specific DNA ligands to direct DNA-damaging molecules. Such a study might help in the improvement of, and new developments in, genetic manipulation of mammalian cells and in the use of DNA-targeted anti-tumour agents.
| ACKNOWLEDGEMENTS |
|---|
We thank U. Asseline for the synthesis of psoralen-cleavable oligonucleotides, J. Moggs for the gift of platinated plasmid and monoclonal anti-XPA antibodies, and J. Mello for careful reading of the manuscript. F.G. was supported by ARC (Association de la Recherche sur le Cancer) and AFM (Association Française sur la Myopathie) fellowships.
| REFERENCES |
|---|
|
|
|---|
- Faria,M. and Giovannangeli,C. (2001) Triplex-forming molecules: from concepts to applications. J. Gene Med., 3, 299310.[CrossRef][Web of Science][Medline]
- Knauert,M.P. and Glazer,P.M. (2001) Triplex forming oligonucleotides: sequence-specific tools for gene targeting. Hum. Mol. Genet., 10, 22432251.
[Abstract/Free Full Text] - Seidman,M.M. and Glazer,P.M. (2003) The potential for gene repair via triple helix formation. J. Clin. Invest., 112, 487494.[CrossRef][Web of Science][Medline]
- De Silva,I.U., McHugh,P.J., Clingen,P.H. and Hartley,J.A. (2000) Defining the roles of nucleotide excision repair and recombination in the repair of DNA interstrand cross-links in mammalian cells. Mol. Cell. Biol., 20, 79807990.
[Abstract/Free Full Text] - Wang,G., Chen,Z., Zhang,S., Wilson,G.L. and Jing,K. (2001) Detection and determination of oligonucleotide triplex formation-mediated transcription-coupled DNA repair in HeLa nuclear extracts. Nucleic Acids Res., 29, 18011807.
[Abstract/Free Full Text] - Li,L., Peterson,C.A., Lu,X., Wei,P. and Legerski,R.J. (1999) Interstrand cross-links induce DNA synthesis in damaged and undamaged plasmids in mammalian cell extracts. Mol. Cell. Biol., 19, 56195630.
[Abstract/Free Full Text] - Zhang,N., Lu,X., Zhang,X., Peterson,C.A. and Legerski,R.J. (2002) hMutSbeta is required for the recognition and uncoupling of psoralen interstrand cross-links in vitro. Mol. Cell. Biol., 22, 23882397.
[Abstract/Free Full Text] - Kumaresan,K.R., Hang,B. and Lambert,M.W. (1995) Human endonucleolytic incision of DNA 3' and 5' to a site-directed psoralen monoadduct and interstrand cross-link. J. Biol. Chem., 270, 3070930716.
[Abstract/Free Full Text] - Bessho,T., Mu,D. and Sancar,A. (1997) Initiation of DNA interstrand cross-link repair in humans: the nucleotide excision repair system makes dual incisions 5' to the cross-linked base and removes a 22- to 28-nucleotide-long damage-free strand. Mol. Cell. Biol., 17, 68226830.[Abstract]
- Guieysse,A.L., Praseuth,D., Giovannangeli,C., Asseline,U. and Hélène,C. (2000) Psoralen adducts induced by triplex-forming oligonucleotides are refractory to repair in HeLa cells. J. Mol. Biol., 296, 373383.[CrossRef][Web of Science][Medline]
- Kuraoka,I., Kobertz,W.R., Ariza,R.R., Biggerstaff,M., Essigmann,J.M. and Wood,R.D. (2000) Repair of an interstrand DNA cross-link initiated by ERCC1XPF repair/recombination nuclease J. Biol. Chem., 275, 2663226636.
[Abstract/Free Full Text] - Mu,D., Bessho,T., Nechev,L.V., Chen,D.J., Harris,T.M., Hearst,J.E. and Sancar,A. (2000) DNA interstrand cross-links induce futile repair synthesis in mammalian cell extracts. Mol. Cell. Biol., 20, 24462454.
[Abstract/Free Full Text] - Barre,F.X., Asseline,U. and Harel-Bellan,A. (1999) Asymmetric recognition of psoralen interstrand crosslinks by the nucleotide excision repair and the error-prone repair pathways. J. Mol. Biol., 286, 13791387.[CrossRef][Web of Science][Medline]
- Faruqi,A.F., Datta,H.J., Carroll,D., Seidman,M.M. and Glazer,P.M. (2000) Triple-helix formation induces recombination in mammalian cells via a nucleotide excision repair-dependent pathway. Mol. Cell. Biol., 20, 9901000.
[Abstract/Free Full Text] - Raha,M., Wang,G., Seidman,M.M. and Glazer,P.M. (1996) Mutagenesis by third-strand-directed psoralen adducts in repair-deficient human cells: high frequency and altered spectrum in a xeroderma pigmentosum variant. Proc. Natl Acad. Sci. USA, 93, 29412946.
[Abstract/Free Full Text] - Wang,G., Seidman,M.M. and Glazer,P.M. (1996) Mutagenesis in mammalian cells induced by triple helix formation and transcription-coupled repair. Science, 271, 802805.[Abstract]
- Wang,G. and Glazer,P.M. (1995) Altered repair of targeted psoralen photoadducts in the context of an oligonucleotide-mediated triple helix. J. Biol. Chem., 270, 2259522601.
[Abstract/Free Full Text] - Giovannangeli,C., Perrouault,L., Escude,C., Nguyen,T. and Hélène,C. (1996) Specific inhibition of in vitro transcription elongation by triplex-forming oligonucleotideintercalator conjugates targeted to HIV proviral DNA. Biochemistry, 35, 1053910548.[CrossRef][Medline]
- Giovannangeli,C., Thuong,N.T. and Hélène,C. (1992) Oligodeoxynucleotide-directed photo-induced cross-linking of HIV proviral DNA via triple-helix formation. Nucleic Acids Res., 20, 42754281.
[Abstract/Free Full Text] - Wood,R.D., Robins,P. and Lindahl,T. (1988) Complementation of the xeroderma pigmentosum DNA repair defect in cell-free extracts. Cell, 53, 97106.[CrossRef][Web of Science][Medline]
- Faria,M., Wood,C.D., Perrouault,L., Nelson,J.S., Winter,A., White,M.R., Hélène,C. and Giovannangeli,C. (2000) Targeted inhibition of transcription elongation in cells mediated by triplex-forming oligonucleotides. Proc. Natl Acad. Sci. USA, 97, 38623867.
[Abstract/Free Full Text] - Faria,M., Wood,C.D., White,M.R., Hélène,C. and Giovannangeli,C. (2001) Transcription inhibition induced by modified triple helix-forming oligonucleotides: a quantitative assay for evaluation in cells. J. Mol. Biol., 306, 1524.[CrossRef][Web of Science][Medline]
- Saijo,M., Kuraoka,I., Masutani,C., Hanaoka,F. and Tanaka,K. (1996) Sequential binding of DNA repair proteins RPA and ERCC1 to XPA in vitro. Nucleic Acids Res., 24, 47194724.
[Abstract/Free Full Text] - Nocentini,S., Coin,F., Saijo,M., Tanaka,K. and Egly,J.M. (1997) DNA damage recognition by XPA protein promotes efficient recruitment of transcription factor II H. J. Biol. Chem., 272, 2299122994.
[Abstract/Free Full Text] - Missura,M., Buterin,T., Hindges,R., Hubscher,U., Kasparkova,J., Brabec,V. and Naegeli,H. (2001) Double-check probing of DNA bending and unwinding by XPARPA: an architectural function in DNA repair. EMBO J., 20, 35543564.[CrossRef][Web of Science][Medline]
- Vasquez,K.M., Christensen,J., Li,L., Finch,R.A. and Glazer,P.M. (2002) Human XPA and RPA DNA repair proteins participate in specific recognition of triplex-induced helical distortions. Proc. Natl Acad. Sci. USA, 99, 58485853.
[Abstract/Free Full Text] - Wakasugi,M. and Sancar,A. (1998) Assembly, subunit composition and footprint of human DNA repair excision nuclease. Proc. Natl Acad. Sci. USA, 95, 66696674.
[Abstract/Free Full Text] - Jones,C.J. and Wood,R.D. (1993) Preferential binding of the xeroderma pigmentosum group A complementing protein to damaged DNA. Biochemistry, 32, 1209612104.[CrossRef][Medline]
- Moggs,J.G., Szymkowski,D.E., Yamada,M., Karran,P. and Wood,R.D. (1997) Differential human nucleotide excision repair of paired and mispaired cisplatinDNA adducts. Nucleic Acids Res., 25, 480491.
[Abstract/Free Full Text] - Branum,M.E., Reardon,J.T. and Sancar,A. (2001) DNA repair excision nuclease attacks undamaged DNA. A potential source of spontaneous mutations. J. Biol. Chem., 276, 2542125426.
[Abstract/Free Full Text] - Coudore,F., Calsou,P. and Salles,B. (1997) DNA repair activity in protein extracts from rat tissues. FEBS Lett., 414, 581584.[CrossRef][Web of Science][Medline]
- Takasugi,M., Guendouz,A., Chassignol,M., Decout,J.L., Lhomme,J., Thuong,N.T. and Hélène,C. (1991) Sequence-specific photo-induced cross-linking of the two strands of double-helical DNA by a psoralen covalently linked to a triple helix-forming oligonucleotide. Proc. Natl Acad. Sci. USA, 88, 56025606.
[Abstract/Free Full Text] - Guieysse,A.L., Praseuth,D., Grigoriev,M., Harel-Bellan,A. and Hélène,C. (1996) Detection of covalent triplex within human cells. Nucleic Acids Res., 24, 42104216.
[Abstract/Free Full Text] - Giovannangeli,C., Thuong,N.T. and Hélène,C. (1993) Oligonucleotide clamps arrest DNA synthesis on a single-stranded DNA target. Proc. Natl Acad. Sci. USA, 90, 1001310017.
[Abstract/Free Full Text] - Volker,M., Mone,M.J., Karmakar,P., van Hoffen,A., Schul,W., Vermeulen,W., Hoeijmakers,J.H., van Driel,R., van Zeeland,A.A. and Mullenders,L.H. (2001) Sequential assembly of the nucleotide excision repair factors in vivo. Mol. Cell, 8, 213224.[CrossRef][Web of Science][Medline]
- Wakasugi,M. and Sancar,A. (1999) Order of assembly of human DNA repair excision nuclease. J. Biol. Chem., 274, 1875918768.
[Abstract/Free Full Text] - Araujo,S.J. and Wood,R.D. (1999) Protein complexes in nucleotide excision repair. Mutat. Res., 435, 2333.[Web of Science][Medline]
- Escudé,C., Giovannangeli,C., Sun,J.S., Lloyd,D.H., Gryaznov,S.M., Garestier,T. and Hélène,C. (1996) Stable triple helices formed by oligonucleotide N3'
P5' phosphoramidates inhibit transcription elongation. Proc. Natl Acad. Sci. USA, 93, 43654369.[Abstract/Free Full Text] - Duval-Valentin,G., Takasugi,M., Hélène,C. and Sage,E. (1998) Triple helix-directed psoralen crosslinks are recognized by Uvr(A)BC excinuclease. J. Mol. Biol., 278, 815825.[CrossRef][Web of Science][Medline]
- Woodgate,R. (1999) A plethora of lesion-replicating DNA polymerases. Genes Dev., 13, 21912195.
[Free Full Text] - McHugh,P.J., Sones,W.R. and Hartley,J.A. (2000) Repair of intermediate structures produced at DNA interstrand cross-links in Saccharomyces cerevisiae. Mol. Cell. Biol., 20, 34253433.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
S. Richards, S.-T. Liu, A. Majumdar, J.-L. Liu, R. S. Nairn, M. Bernier, V. Maher, and M. M. Seidman Triplex targeted genomic crosslinks enter separable deletion and base substitution pathways Nucleic Acids Res., September 25, 2005; 33(17): 5382 - 5393. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Thoma, M. Wakasugi, J. Christensen, M. C. Reddy, and K. M. Vasquez Human XPC-hHR23B interacts with XPA-RPA in the recognition of triplex-directed psoralen DNA interstrand crosslinks Nucleic Acids Res., May 24, 2005; 33(9): 2993 - 3001. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









