Published online 10 February 2004
Nucleic Acids Research, 2004, Vol. 32, No. 3 997-1005
© 2004 Oxford University Press
Phosphatidyl inositol 3-kinase-like serine/threonine protein kinases (PIKKs) are required for DNA damage-induced phosphorylation of the 32 kDa subunit of replication protein A at threonine 21
1 Department of Biological Sciences, University of Calgary, 2500 University Drive NW, Calgary, Alberta T2N 1N4, Canada and 2 Cancer Biology Research Group, Department of Biochemistry and Molecular Biology, University of Calgary, 3330 Hospital Drive NW, Calgary, Alberta T2N 4N1, Canada
*To whom correspondence should be addressed. Tel: +1 403 220 7628; Fax: +1 403 210 3899; Email: leesmill{at}ucalgary.ca
Received November 6, 2003; Revised and Accepted January 14, 2004
| ABSTRACT |
|---|
|
|
|---|
Replication protein A (RPA) is a single-stranded DNA (ssDNA) binding protein involved in various processes, including nucleotide excision repair and DNA replication. The 32 kDa subunit of RPA (RPA32) is phosphorylated in response to various DNA-damaging agents, and two protein kinases, ataxia-telangiectasia mutated (ATM) and the DNA-dependent protein kinase (DNA-PK) have been implicated in DNA damage-induced phosphorylation of RPA32. However, the relative roles of ATM and DNA-PK in the site-specific DNA damage-induced phosphorylation of RPA32 have not been reported. Here we generated a phosphospecific antibody that recognizes Thr21-phosphorylated RPA32. We show that both DNA-PK and ATM phosphorylate RPA32 on Thr21 in vitro. Ionizing radiation (IR)-induced phosphorylation of RPA32 on Thr21 was defective in ATM-deficient cells, while camptothecin (CPT)-induced phosphorylation of RPA32 on Thr21 was defective in cells lacking functional DNA-PK. Neither ATM nor DNA-PK was required for etoposide (ETOP)-induced RPA32 Thr21 phosphorylation. However, two inhibitors of the ATM- and Rad3-related (ATR) protein kinase activity prevented ETOP-induced Thr21 phosphorylation. Inhibition of DNA replication prevented both the IR- and CPT-induced phosphorylation of Thr21, whereas ETOP-induced Thr21 phosphorylation did not require active DNA replication. Thus, the regulation of RPA32 Thr21 phosphorylation by multiple DNA damage response protein kinases suggests that Thr21 phosphorylation of RPA32 is a crucial step within the DNA damage response.
| INTRODUCTION |
|---|
|
|
|---|
Replication protein A (RPA) is a heterotrimer composed of 70, 32 and 14 kDa subunits (tRPA) (1). The 32 kDa subunit of RPA (RPA32) is phosphorylated in a cell cycle-dependent manner, beginning at the G1/S transition and extending until late mitosis (2,3). RPA32 becomes hyperphosphorylated in response to a wide variety of DNA-damaging agents, such as ionizing radiation (IR), ultraviolet radiation (UV) and camptothecin (CPT) (412). Phosphopeptide mapping experiments in HeLa cells found that Thr21, Ser23, Ser29, and Ser33 become phosphorylated in response to UV, as well as Ser4, Ser8 and either Ser11, Ser12 or Ser13 (13). In vitro, cyclin A/cyclin BCdc2 complexes phosphorylate many of the same sites in RPA32 that are phosphorylated in response to UV (13), and Ser29 is the main in vitro Cdc2 phosphorylation site within RPA32 (14).
Two additional protein kinases have been implicated in the DNA damage-induced phosphorylation of RPA32, one of which is the DNA-dependent protein kinase (DNA-PK). DNA-PK is composed of a catalytic subunit (DNA-PKcs) and the Ku70/Ku80 heterodimer (reviewed in 15,16). In vitro, Thr21 and Ser33 are the major DNA-PK phosphorylation sites in RPA32 (14), and DNA-PK phosphorylates RPA32 in vitro on sites similar to those phosphorylated in RPA32 in response to UV (13). To date, in vivo phosphorylation of RPA32 has only been determined by metabolic labeling with [32P]ortho phosphate or by induction of a phosphorylation-dependent mobility shift on SDSPAGE, and the protein kinases required for site-specific DNA damage-induced phosphorylation of RPA32 have not been determined. In DNA-PKcs-deficient human (M059J) cells, the CPT-induced phosphorylation of RPA32 is deficient (7) and extracts from DNA-PKcs-deficient cells do not support phosphorylation of RPA32 (17). IR-induced phosphorylation of RPA32 appears to require expression of DNA-PKcs (12,18); however, one report demonstrated that DNA-PKcs-deficient human (M059J) cells support robust IR-induced RPA32 phosphorylation (17). The IR- and CPT-induced phosphorylation of RPA32 is inhibited by aphidicolin, a DNA replication inhibitor, indicating that the DNA-PK-dependent phosphorylation of RPA32 is S-phase specific (7). DNA-PKcs-deficient cells are hypersensitive to IR- and CPT-induced cell killing (7,19), and fail to suppress DNA replication in response to CPT (7). In combination, these data strongly suggest a role for the phosphorylation of RPA by DNA-PK in a DNA damage-induced replication checkpoint.
The second protein kinase shown to regulate the DNA damage-induced phosphorylation of RPA32 is ataxia- telangiectasia mutated (ATM) (4,6,8,10,20). ATM phosphorylates RPA32 in vitro (20,21) on sites similar to those phosphorylated in vivo in response to IR and UV (10,20). Candidate ATM phosphorylation sites within RPA32 include Thr21 and Ser33, although other undetermined sites are also phosphorylated by ATM (10). Ataxia-telangiectasia (A-T) patients harbor one or more mutations within both ATM alleles, resulting in loss of functional ATM protein expression (22), and A-T cells show delayed IR-induced phosphorylation of RPA32 (4). Similarly, human cell lines expressing ATM dominant-negative fragments show a delayed IR-induced phosphorylation of RPA32 (6). The UV-induced hyperphosphorylation of RPA32 is also ATM dependent (10). It has been hypothesized that ATM and DNA-PK cooperate to phosphorylate RPA32 after IR-induced DNA damage to promote RPA-mediated DNA repair (12) but the relative contributions of each protein kinase remains to be determined.
Phosphorylation of RPA32 occurs within the N-terminal 33 residues, termed the N-terminal phosphorylation domain. This region of RPA32 is not required for the single-stranded DNA (ssDNA) binding activity of RPA (23); however, a phosphorylation-induced conformation change in RPA, resulting from altered intersubunit interactions, may regulate the interaction of RPA with both interacting proteins and DNA (24). In response to DNA damage, RPA co-localizes into nuclear foci with various proteins, including ATM- and Rad3-related (ATR), ATR interacting protein (ATRIP), serine 139-phosphorylated histone H2AX (
-H2AX), breast and ovarian cancer susceptibility protein 1 (BRCA1), Rad51 and Werners syndrome helicase (WRN) (2529). RPA may act as a DNA damage sensor by binding to ssDNA and recruiting ATRATRIP complexes to sites of DNA damage, which facilitates substrate phosphorylation by ATRATRIP, thus initiating checkpoint signaling (25). In addition, a kinase-inactive form of ATR can block the translocation of RPA into nuclear foci following DNA damage (30). DNA-PK, ATM and ATR all belong to the phosphatidyl inositol 3-kinase like serine/threonine protein kinase (PIKK) family (reviewed in 31,32) and all have a substrate preference for serine or threonine residues followed by a glutamine (S/T-Q motifs).
In light of the numerous connections between RPA and the PIKK family of protein kinases, as well as the lack of information regarding the protein kinase requirements for the site-specific phosphorylation of RPA32 in vivo, we generated an antibody that recognizes RPA32 when it is phosphorylated on Thr21, a TQ motif in the N-terminal phosphorylation domain. We report that both ATM and DNA-PK phosphorylate Thr21 in vitro and that RPA32 becomes phosphorylated on Thr21 in an ATM-dependent manner in response to IR, UV, doxorubicin or t-butyl hydroperoxide. In contrast, CPT and etoposide (ETOP) induced RPA32 Thr21 phosphorylation in an ATM-independent manner. DNA-PKcs-deficient cells failed to phosphorylate RPA32 Thr21 in response to CPT suggesting that DNA-PKcs is the major Thr21 protein kinase in CPT-treated cells. IR- and CPT-induced phosphorylation of RPA32 Thr21 both required active DNA replication while ETOP-induced Thr21 phosphorylation did not. The data indicate that Thr21 of RPA32 is a target of multiple DNA damage-induced signal transduction pathways.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of a phosphospecific antibody to RPA32 phosphorylated on Thr21
Phosphopeptides and non-phosphopeptides corresponding to amino acids 1626 of human RPA32 [GAGGY(pT)QSPGGK and GAGGYTQSPGGK, respectively, where (pT) indicates the phosphorylated amino acid residue corresponding to Thr21] were synthesized and coupled to bovine serum albumin and keyhole limpet hemocyanin (mcKLH) (Pierce) as described previously (33). A New Zealand white rabbit was injected with four biweekly injections, each of 1.5 mg of the phosphorylated peptide conjugate. The phosphospecific antibody was affinity purified from the resulting serum by passage over a column containing phosphorylated peptide coupled to activated CH-Sepharose 4B (Amersham Biosciences). Trace amounts of antibodies that recognized unphosphorylated RPA32 were depleted by passage over a column of activated CH-Sepharose 4B coupled to the equivalent unphosphorylated peptide. Antibody specificity was confirmed by cross-reactivity with phosphorylated but not unphosphorylated peptides in dot blot immunoassays.
PCR mutagenesis and hRPA14·32 purification
The pET16b-hRPA14·32 construct was a kind gift from Dr Alexey Bochkarev (University of Oklahoma). A XbaI upstream primer (5'-GCT CTA GAA ATA ATT TTG TTT AAC TTT AAG AAG-3'), an EcoRI downstream primer (5'-GGA ATT CTC ATG TTT GAC AGC TTA T-3'), and the complementary mutagenic primers either for Thr21
Ala21 (5'-GCG GCT ACG CGC AGT CC-3' and 5'-GGA CTG CGC GTA GCC GC-3') or Ser33
Ala33 (5'-CCG CAC CTG CTC AAG CC-3' and 5'-GGC TTG AGC AGG TGC GG-3') mutations were used in a two-step method to amplify the region encoding RPA14 and RPA32, with either a A
G or T
G nucleotide alteration to produce Thr21
Ala21 or Ser33
Ala33 mutations, respectively, in RPA32. The amplified region was ligated back into the original vector that had been digested with EcoRI and XbaI to remove the RPA14 and RPA32 coding sequences. All mutations were confirmed by DNA sequencing at the University of Calgary DNA Sequencing Facility. Constructs were transformed into Escherichia coli BL21 (DE3) cells, which were grown to an optical density of 0.6 at 600 nm and then induced with 0.5 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) for 3 h at 37°C with agitation. Cells were re-suspended in lysis buffer [50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 10 mM imidazole, 0.2 mM phenylmethyl sulphonyl fluoride (PMSF), 0.2 µg/ml pepstatin A, 0.2 µg/ml aprotinin, 0.2 µg/ml leupeptin, 0.1 mM benzamidine, 1% (v/v) Triton X-100] and lysed by sonication. Lysates were centrifuged at 10 000 g for 15 min and proteins were purified from the resulting supernatant using NTA-agarose (Qiagen) according to the manufacturers recommendations.
Human heterotrimeric RPA (tRPA) expression and purification
The p11d-tRPA construct was a kind gift from Dr Mark Wold (University of Iowa College of Medicine). Heterotrimeric RPA was expressed in E.coli and purified as described previously (34).
Cell lines
Human lymphoblastoid cells lines, BT (ATM-proficient) and L3 (ATM-deficient) were as described (3537). Human cell lines M059K (DNA-PKcs-proficient) and M059J (DNA-PKcs-deficient) were as described (38). M059J/Fus1 and M059J/Fus9, which are derived from M059J, were as described (39). BT, L3, M059K, M059J, M059J/Fus1 and M059J/Fus9 cell lines were grown as reported previously (35,38,39).
DNA-PK kinase assays
DNA-PK subunits (DNA-PKcs and Ku70/80) were purified from HeLa cells as described previously (40) with modifications as described elsewhere (A.A. Goodarzi and S.P. Lees-Miller, manuscript submitted for publication). The protein kinase activity of purified DNA-PK was determined as described previously (40). M13 DNA [M13mp18(+) Strand DNA; Amersham Biosciences] or a 40 nt single-stranded oligonucleotide (CCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGG) was added to a concentration of 10 ng/ml where indicated.
ATM immunoprecipitation kinase assays
Human lymphoblastoid cells (BT) were collected, washed in PBS, re-suspended in TGN buffer [50 mM TrisHCl pH 8.0, 50 mM ß-glycerophosphate, 150 mM NaCl, 10% (v/v) glycerol, 1% (v/v) Tween-20, 25 mM NaF, 1 mM Na3VO4, 0.2 mM PMSF, 0.2 µg/ml pepstatin A, 0.2 µg/ml aprotinin, 0.2 µg/ml leupeptin] containing 1 µM microcystin-LR (Calbiochem) and sonicated. Lysates were centrifuged at 10 000 g for 10 min, and 1 mg of supernatant was incubated with 4 µl of a mouse monoclonal to ATM (Ab-2; Oncogene, San Diego, CA) for 12 h at 4°C with end-over-end rotation. Thirty microliters of a 1:1 slurry of protein GSepharose (Amersham Biosciences) in TGN buffer was added and the incubation was continued for a further 45 min. Samples were washed twice with TGN buffer, once with a high salt buffer (100 mM TrisHCl pH 8.0, 600 mM NaCl), twice with pre-kinase buffer (10 mM HEPESHCl pH 7.4, 50 mM NaCl, 10 mM MgCl2) and then once with kinase buffer (pre-kinase buffer containing 10 mM MnCl2). Protein GSepharose beads were added to kinase buffer containing 1 µM microcystin-LR, 10 µM ATP, 10 µCi [
-32P]ATP and the indicated substrate, and then incubated for 30 min at 30°C. PHAS-I was purchased from Stratagene. Where indicated, cells were treated with 10 Gy IR using a 137Cs tissue irradiator (Gammacell 1000; MDS Nordion, Ottawa, ON) at a rate of 3.7 Gy/min, and allowed to recover for 60 min at 37°C in 5% CO2 prior to making extracts.
Treatment of cell cultures, Affi-gel blue pulldowns and western immunoblot analysis
Cells were incubated in fresh media for 2 h with the indicated DNA-damaging agent: ETOP (VP-16; Sigma), doxorubicin hydrochloride (Adriamycin; Sigma), t-butyl hydroperoxide (Sigma), CPT (Sigma). For IR treatment, cells were placed in fresh medium, irradiated with 10 Gy and then allowed to recover at 37°C for 2 h. For UV treatment, cells were exposed to UV-C (254 nm) in a minimal volume of PBS at a dose rate of 1 J/m2/s, and then placed back into fresh medium for 3 h. Where indicated, cells were treated with 10 mM caffeine (BDH) or 100 µM wortmannin (Sigma) for 30 min prior to exposure to DNA-damaging agent.
After treatment, cells were collected, washed in PBS and lysed in NETN buffer [20 mM TrisHCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% (v/v) Nonidet P-40, 0.2 mM PMSF, 0.2 µg/ml pepstatin A, 0.2 µg/ml aprotinin, 0.2 µg/ml leupeptin, 25 mM NaF, 25 mM ß-glycerophosphate, 1 mM Na3VO4) containing 1 µM microcystin-LR. Lysates were centrifuged at 10 000 g for 10 min, and then 2.5 mg of the supernatant was adjusted to a final NaCl concentration of 450 mM before being added to 80 µl of a 1:1 slurry of Affi-gel blue resin (BioRad) in NETN buffer. These mixtures were incubated at 4°C with end over end rotation for 2 h, and then washed with NETN containing 450 mM NaCl. Proteins were eluted off the Affi-gel blue resin with SDS sample buffer, fractionated on 12.5% SDSpolyacrylamide gels and transferred to nitrocellulose in buffer for 30 min at 100 V. Membranes were blocked in Tris-buffered saline containing Tween-20 [TBS-T, 20 mM TrisHCl pH 8.0, 500 mM NaCl, 0.1% (v/v) Tween-20] containing 20% (w/v) skim milk powder (Canada Safeway), and then probed for 12 h with either a mouse monoclonal antibody to RPA32 (Ab-3; Oncogene) or the phosphospecific rabbit polyclonal to RPA32 Thr21 described above. Where indicated, phosphorylated peptide (pThr21 blocking peptide) or non-phosphorylated peptide (Thr21 mock peptide) was added (to 10 µg/ml) to the Thr21 phosphospecific antibody.
[32P]inorganic phosphate cell labeling
Cells were placed into phosphate-free Dulbeccos modified Eagles medium (DMEM) (with L-glutamine, high glucose, without sodium phosphate, without sodium pyruvate) containing 10% fetal calf serum for 1 h prior to labeling. For in vivo labeling, 125 µl of 10 mCi/ml [32P]orthophosphate (PBS13; Amersham Biosciences) was added to 2 ml of cultured cells. After 30 min, samples were treated (as indicated) with 10 µM CPT (2 h), or exposed to 10 Gy IR and then allowed to recover for 2 h at 37°C. Cells were washed in ice-cold PBS, lysed in NETN buffer and centrifuged. Protein concentrations were measured using the Detergent Compatible protein assay. A volume of supernatant equivalent to 1 mg of total protein was added to 2.5 µl of mouse monoclonal antibody to RPA32 and incubated for 2.5 h. A 1:1 slurry of protein GSepharose in NETN buffer was added (30 µl) and the mixture was incubated for an additional 45 min. Protein GSepharose beads were washed with NETN buffer and eluted with SDS sample buffer. Where indicated, cells were pretreated with 10 mM caffeine or 100 µM wortmannin for 30 min in phosphate-free DMEM prior to the addition of [32P]orthophosphate.
| RESULTS |
|---|
|
|
|---|
DNA-PK phosphorylates RPA32 on Thr21 in vitro
Previously, DNA-PK has been shown to phosphorylate RPA32, primarily on two sites, Thr21 and Ser33, both of which are Ser/Thr-Gln (S/T-Q) motifs (13,14,21). In order to confirm that Thr21 and Ser33 were in vitro DNA-PK phosphorylation sites in RPA32, we generated RPA32 containing Thr21 to Ala21 (T21A) or Ser33 to Ala33 (S33A) mutations. RPA32 used in this experiment was present as a dimer with the 14 kDa subunit of RPA (RPA14·32; see Materials and Methods for details) but without the 70 kDa subunit of RPA (RPA70), which harbors the majority of the ssDNA binding activity of RPA (41). Purified RPA14·32 proteins were phosphorylated using highly purified DNA-PK in in vitro kinase assays containing [
-32P]ATP. Compared with wild type (WT), DNA-PK phosphorylation of RPA32 in the T21A-RPA14·32 mutant was
55% less, and that of the S33A-RPA14·32 mutant was
18% less (Fig. 1), thus Thr21 appears to be the primary DNA-PK phosphorylation site in RPA32 in vitro.
|
RPA32 phosphorylated by DNA-PK and ATM in vitro is recognized by a Thr21 phosphospecific antibody
In order to determine whether Thr21 of RPA32 was phosphorylated in vivo, we generated a phosphospecific antibody to this site. The specificity of the antibody was determined by incubation of WT-RPA14·32, T21A-RPA14·32, S33A-RPA14·32 and tRPA with purified DNA-PK, with or without ATP. Samples were run on SDSPAGE, transferred to nitrocellulose membranes and probed with the RPA32 Thr21 phosphospecific antibody, either with antibody alone (Fig. 2A, i), antibody with pThr21 blocking peptide (p-peptide) (Fig. 2A, ii), or antibody with Thr21 mock peptide (peptide) (Fig. 2A, iii). The membrane was then probed with a mouse monoclonal antibody to RPA32 as a loading control (Fig. 2A, iv). RPA32 from WT-RPA14·32, S33A-RPA14·32 and tRPA were recognized by the Thr21 phosphospecific antibody, but only when the RPA32 and DNA-PK were incubated in the presence of ATP. In contrast, RPA32 from T21A-RPA14·32 was not recognized by the Thr21 phosphospecific antibody, even when incubated under conditions that support DNA-PK kinase activity. The recognition of DNA-PK-phosphorylated RPA32 by the Thr21 phosphospecific antibody was blocked by the pThr21 blocking peptide (Fig. 2A, ii) but not by the Thr21 mock peptide (Fig. 2A, iii). Therefore, the RPA32 Thr21 phosphospecific antibody is specific for Thr21-phosphorylated RPA32, and DNA-PK phosphorylates Thr21 in vitro. Since RPA is a ssDNA binding protein, and ssDNA could affect the conformation of RPA (42) and thus its ability to be phosphorylated by DNA-PK in vitro (43,44), these experiments were repeated using tRPA with the addition of either M13 closed circular ssDNA or a 40 nt single-stranded oligonucleotide (ssDNA). Neither M13 DNA nor the 40 nt ssDNA were required for efficient phosphorylation of tRPA on Thr21 by DNA-PK (Fig. 2B).
|
ATM has also been reported to phosphorylate RPA32, although no phosphorylation sites have been unambiguously identified. We therefore determined whether ATM could also phosphorylate RPA32 on Thr21. ATM was first immunoprecipitated from unirradiated cells or from cells that had been exposed to 10 Gy IR and allowed to recover for 60 min. Immunoprecipitates were incubated in the presence of [
-32P]ATP and PHAS-I, either with or without 1 µM wortmannin. As expected, the ATM immunoprecipitates contained an IR-stimulated, wortmannin-inhibitable protein kinase activity (Fig. 3A). No activity was observed when ATM immunoprecipitations were carried out in the ATM-deficient cell line, L3 (data not shown). ATM immunoprecipitates from irradiated cells were therefore used to phosphorylate WT-RPA14·32, T21A-RPA14·32, S33A-RPA14·32 and tRPA. As found for DNA-PK, ATM also phosphorylated Thr21 of RPA32 (Fig. 3B). The Thr21 phosphospecific antibody cross-reactive band that runs immediately below Thr21-phosphorylated RPA32 was immunoprecipitated from both irradiated and unirradiated extracts with the ATM antibody in the presence and absence of ATP (data not shown) and is therefore a contaminating band likely unrelated to RPA32.
|
IR-inducible phosphorylation of RPA32 on Thr21 is ATM dependent
ATM regulates the phosphorylation of a wide variety of substrates in response to DNA damage (reviewed in 4547). Cells deficient for ATM have been reported to be defective for IR-induced phosphorylation of RPA32 (4,8,12). Therefore, we investigated whether Thr21 of RPA32 was phosphorylated in response to IR in an ATM-dependent manner. BT (ATM-proficient) and L3 (ATM-deficient) cells were irradiated with 10 Gy IR and allowed to recover for 2 h. Cell extracts were enriched for RPA using the Affi-gel blue resin as described in Methods and Materials and immunoblots were probed with either the Thr21 phosphospecific antibody or a RPA32 antibody as a loading control. RPA32 Thr21 was phosphorylated in BT cells after IR, whereas in L3 cells, no Thr21 phosphorylation was detected (Fig. 4, iii). Furthermore, the IR-induced phosphorylation of Thr21 was inhibited by pre-treatment of cells with caffeine or wortmannin, which are small molecule inhibitors of ATM kinase activity.
|
In a separate experiment, BT and L3 cells were labeled with [32P]orthophosphate, irradiated with an additional 10 Gy or left without further treatment, and allowed to recover for 2 h. RPA was then immunoprecipitated from cell extracts and visualized by autoradiography. Immunoprecipitates were also probed with an RPA32 antibody as a loading control. The [32P]orthophosphate itself acts as a source of DNA damage, as evident by the incorporation of 32P into RPA32 in control BT cells (Fig. 4, i). However, the phosphorylation of RPA32 was markedly increased in response to IR, while no phosphorylation of RPA32 was observed in L3 cells, with or without exposure to 10 Gy IR. Pre-treatment of BT cells with caffeine or wortmannin abolished all phosphorylation of RPA32. These data suggest that ATM is required for RPA32 phosphorylation after IR, and that RPA32 Thr21 is an in vivo target of ATM protein kinase activity.
ATM-dependent and -independent phosphorylation of RPA32 Thr21 in response to DNA damage
We next investigated whether ATM was required for the DNA damage-induced phosphorylation of RPA32 on Thr21 in response to other DNA-damaging agents. BT (ATM- proficient) and L3 (ATM-deficient) cells were treated with various DNA-damaging agents and extracts were analyzed by immunoblotting for RPA32 Thr21 phosphorylation. Ultraviolet radiation (UVC; 254 nm), IR, doxorubicin and t-butyl hydroperoxide all induced RPA32 Thr21 phosphorylation in an ATM-dependent manner, whereas CPT and ETOP induced ATM-independent phosphorylation of Thr21 (Fig. 5A). We considered it possible that ATM might be required for Thr21 phosphorylation at low doses of CPT or ETOP, whereas redundant pathways could be activated at higher doses. Therefore, we repeated the experiment using a range of CPT and ETOP concentrations. At all doses examined, the CPT- and ETOP-induced phosphorylation of RPA32 Thr21 was ATM independent (Fig. 5B).
|
DNA replication requirements for RPA32 Thr21 phosphorylation
The IR- and CPT-induced phosphorylation of RPA32 has been shown to require active DNA replication (7,28). To determine whether RPA32 Thr21 phosphorylation was dependent on DNA replication, cells were treated with IR, CPT or ETOP, with or without pre-incubation with aphidicolin, then immunoblotted for RPA32 Thr21 phosphorylation. BT cells were used for the IR experiments, while L3 cells were used for CPT and ETOP experiments since previous results had shown that IR-induced phosphorylation of RPA32 Thr21 was ATM dependent, while the CPT- and ETOP-induced phosphorylation was ATM independent. Whereas the IR- and CPT-induced phosphorylations of Thr21 were inhibited by aphidicolin (Fig. 6A and B, respectively), the ETOP-induced phosphorylation of Thr21 was unaffected (Fig. 6B). Thus, ETOP does not require active DNA replication to induce RPA32 Thr21 phosphorylation, unlike IR and CPT, suggesting that Thr21 is phosphorylated through a different mechanism, possibly by a different protein kinase, in response to ETOP than in response to IR and CPT.
|
CPT-induced phosphorylation of RPA32 on Thr21 is DNA-PK dependent
RPA32 was reported to be phosphorylated in response to CPT in a DNA-PK-dependent manner (7), therefore M059K (DNA-PKcs-proficient) and M059J (DNA-PKcs-deficient) cells were treated with CPT and immunoblotted for RPA32 Thr21 phosphorylation. M059K cells supported phosphorylation of Thr21 in response to CPT, whereas M059J cells showed no Thr21 phosphorylation (Fig. 7A). In a separate experiment, M059J/Fus1 and M059J/Fus9 cells were labeled with [32P]orthophosphate, treated with CPT, and analyzed for RPA32 phosphorylation, as described previously. In M059J/Fus1 cells, RPA32 was phosphorylated in a CPT-inducible manner, whereas in M059J/Fus9 cells, RPA32 phosphorylation was barely detectable (Fig. 7B). Pre-incubation of cells with wortmannin, a potent inhibitor of DNA-PK kinase activity (48) inhibited the CPT-induced phosphorylation of RPA32. These data suggest that DNA-PK is required for CPT-induced RPA32 phosphorylation, and that RPA32 Thr21 is an in vivo target of DNA-PK protein kinase activity.
|
DNA-PK-independent etoposide-induced RPA32 Thr21 phosphorylation
In order to determine whether DNA-PK was required for ETOP-induced Thr21 phosphorylation, DNA-PK-deficient (M059J) cells were either untreated or treated with 68 µM ETOP and analyzed for RPA32 Thr21 phosphorylation. Similar to the DNA-PKcs-proficient cell lines, BT and L3 (Fig. 5A), RPA32 Thr21 was phosphorylated in response to ETOP in M059J cells (Fig. 8A). In addition, pre-treatment with caffeine or wortmannin prevented ETOP-induced Thr21 phosphorylation in ATM-deficient cells (Fig. 8B).
|
| DISCUSSION |
|---|
|
|
|---|
ATM and DNA-PK phosphorylate RPA32 Thr21 in vitro and in vivo
We have produced an RPA32 Thr21 phosphospecific antibody and definitively identified Thr21 as an in vitro phosphorylation site of both DNA-PK and ATM. RPA32 Thr21 phosphorylation was ATM dependent in response to IR, UV, doxorubicin and t-butyl hydroperoxide, whereas CPT- and ETOP-induced Thr21 phosphorylation was ATM independent. These data support previous reports that IR- and CPT-induced RPA32 phosphorylation is ATM-dependent and ATM-independent, respectively (4,7,8). In addition, we found that UV-induced RPA32 Thr21 phosphorylation requires ATM, supporting a previous report that A-T cells are deficient for UV-induced RPA32 Thr21 phosphorylation (10). Cells deficient for DNA-PKcs failed to phosphorylate RPA32 Thr21 in response to CPT, confirming earlier data implicating DNA-PK in the CPT-induced phosphorylation of RPA32 (7). The ATM-dependent, caffeine-inhibitable phosphorylation of RPA32 Thr21 in response to IR suggests DNA-PKcs is not required for IR-induced RPA32 Thr21 phosphorylation, consistent with a previous report that DNA-PKcs-deficient (M059J) cells supported IR-induced phosphorylation of RPA32 (17). However, we cannot exclude the possibility that DNA-PK is involved in RPA32 Thr21 phosphorylation at higher doses of IR or time points >2 h after exposure to IR.
It is interesting that doxorubicin and ETOP, both of which are topoisomerase (topo) II poisons, induced Thr21 phosphorylation, yet only the doxorubicin-induced Thr21 phosphorylation was ATM dependent. Topo II poisons stabilize the topo IIDNA cleavage complexes, which can lead to the induction of DNA double-strand breaks (DSBs), chromosomal translocations and other mutagenic events (49). The varied ATM dependency with which doxorubicin and ETOP induced RPA32 Thr21 phosphorylation may reflect the ability of doxorubicin to generate oxygen free radicals or to intercalate DNA, neither of which have been reported for ETOP (50). Similar to ATM-deficient cells, DNA-PKcs-deficient cells showed robust ETOP-induced phosphorylation of RPA32 Thr21. The DNA-PKcs-independent induction of RPA32 Thr21 in response to ETOP is consistent with the inability of protein-linked DSBs produced by ETOP and topo II to activate DNA-PK (51). ETOP-induced Thr21 phosphorylation was caffeine- and wortmannin-inhibitable, indicating that a PIKK family protein kinase member besides ATM and DNA-PK, such as ATR, likely regulates this phosphorylation event.
RPA32 Thr21 phosphorylation is induced by multiple DNA damage sensors
Both the IR- and CPT-induced phosphorylation of RPA32 Thr21 was inhibited by pre-treatment with aphidicolin. CPT inhibits the DNA re-ligation step of DNA topo I to create a protein-linked single-strand break (SSB), which if encountered by the DNA replication machinery, is converted to a DSB (52). The aphidicolin-inhibitable nature of CPT-induced RPA32 Thr21 phosphorylation suggests that Thr21 phosphorylation only has the potential to function in DSB repair pathways and not SSB repair pathways. Similarly, despite the ability of IR to generate both SSBs and DSBs, it is likely that only IR-induced DSBs trigger RPA32 Thr21 phosphorylation. We speculate that IR-induced DSBs generated or encountered by the DNA replication machinery elicit RPA32 Thr21 phosphorylation. Inherent to each replication fork is a large amount of ssDNA, which is bound and stabilized by RPA (1). Perhaps it is simply the large amount of RPA-bound ssDNA present in open chromatin structures at the replication fork that becomes hyperphosphorylated when juxtaposed with the DSB-recruited repair machinery. Topo II poisons demonstrate maximal cell killing of S phase cells (53), due in part to the requirement for disruption of the topo IIDNA cleavage complex by the DNA replication machinery in order for the DSB to be sensed by the nuclear milieu (49). It was therefore surprising that the ETOP-induced phosphorylation of Thr21 was not inhibited by aphidicolin. However, transcription inhibitors can partially protect cells from the cytotoxicity of topo II poisons (53), suggesting that an RNA polymerase can expose the ETOP-induced DSB. A collision between an RNA polymerase and a topo IIDNA cleavage complex would expose the DSB in close proximity to long stretches of ssDNA present within the transcription bubble, possibly explaining why ETOP-induced RPA32 Thr21 phosphorylation was not inhibited by aphidicolin.
The significance of RPA32 Thr21 phosphorylation
Here we have identified Thr21 of RPA32 as both an in vitro and in vivo phosphorylation site. However, it is very likely that RPA is phosphorylated at additional sites both in vitro by DNA-PK, ATM and other protein kinases, and in vivo, in response to various DNA-damaging agents. Experiments are underway to identify additional phosphorylation sites in RPA32 and the physiological significance of these phosphorylation events. Various reports regarding the effect of phosphorylation on the function of RPA have yielded conflicting results, which include causing RPA heterotrimer dissociation (54), stimulating the helix destabilization activity of RPA (55) and decreasing RPA DNA binding (17). Recent reports suggest that phosphorylation of the N-terminal phosphorylation domain of RPA32 decreases the helix destabilization activity of RPA and alters the interactions between RPA and interacting proteins, brought about through a phosphorylation-induced alteration in the intersubunit interactions within the RPA heterotrimer (24,56). However, no studies to date have addressed whether specific phosphorylation sites within RPA32 have any significance or whether it is simply a gross introduction of negative charge into the N-terminal phosphorylation domain that is important. As with the phosphorylation of the N-terminus of p53 (57), sites of DNA damage-induced phosphorylation of RPA32 may each have specific or partially redundant biochemical significance.
| SUPPLEMENTARY MATERIAL |
|---|
|
|
|---|
Supplementary Material is available at NAR Online.
| ACKNOWLEDGEMENTS |
|---|
We thank Drs Alexey Bochkarev (University of Oklahoma) and Mark Wold (University of Iowa) for RPA plasmids, Martin Lavin (University of Queensland) for the BT cell line, Yossi Shiloh (Tel Aviv University) for the L3 cell line, Cordula Kirchgessner (Stanford University) for M059J/Fus1 and M059J/Fus9 cell lines, and Hilary McLachlan (University of Dundee) for synthesis of phosphopeptides. Thanks also to members of the Lees-Miller laboratory for the careful reading of this manuscript and helpful discussions, Aaron Goodarzi for assistance with the ATM immunoprecipitation kinase assay, Ruiqiong Ye for continued assistance with cell culture, and Katarzyna Kycia for help with the preparation of the manuscript. This work was supported by grant no. 011053 from the National Cancer Institute of Canada with funds from the Canadian Cancer Foundation. W.D.B. is supported by graduate studentships from the Alberta Heritage Foundation for Medical Research (AHFMR) and the Natural Sciences and Engineering Research Council of Canada (NSERC). S.P.L.M. is a Scientist of the AHFMR, an Investigator of the Canadian Institutes for Health Research, and holds the Alberta Cancer Foundation/Engineered Air Chair in Cancer Research.
| REFERENCES |
|---|
|
|
|---|
- Wold,M.S. (1997) Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Annu. Rev. Biochem., 66, 6192.[CrossRef][Web of Science][Medline]
- Dutta,A. and Stillman,B. (1992) cdc2 family kinases phosphorylate a human cell DNA replication factor, RPA and activate DNA replication. EMBO J., 11, 21892199.[Web of Science][Medline]
- Din,S., Brill,S.J., Fairman,M.P. and Stillman,B. (1990) Cell-cycle-regulated phosphorylation of DNA replication factor A from human and yeast cells. Genes Dev., 4, 968977.
[Abstract/Free Full Text] - Liu,V.F. and Weaver,D.T. (1993) The ionizing radiation-induced replication protein A phosphorylation response differs between ataxia telangiectasia and normal human cells. Mol. Cell. Biol., 13, 72227231.
[Abstract/Free Full Text] - Brush,G.S., Morrow,D.M., Hieter,P. and Kelly,T.J. (1996) The ATM homologue MEC1 is required for phosphorylation of replication protein A in yeast. Proc. Natl Acad. Sci. USA, 93, 1507515080.
[Abstract/Free Full Text] - Morgan,S.E. and Kastan,M.B. (1997) Dissociation of radiation-induced phosphorylation of replication protein A from the S-phase checkpoint. Cancer Res., 57, 33863389.
[Abstract/Free Full Text] - Shao,R.G., Cao,C.X., Zhang,H., Kohn,K.W., Wold,M.S. and Pommier,Y. (1999) Replication-mediated DNA damage by camptothecin induces phosphorylation of RPA by DNA-dependent protein kinase and dissociates RPA:DNA-PK complexes. EMBO J., 18, 13971406.[CrossRef][Web of Science][Medline]
- Cheng,X., Cheong,N., Wang,Y. and Iliakis,G. (1996) Ionizing radiation-induced phosphorylation of RPA p34 is deficient in ataxia telangiectasia and reduced in aged normal fibroblasts. Radiother. Oncol., 39, 4352.[CrossRef][Web of Science][Medline]
- Wang,Y., Zhou,X.Y., Wang,H., Huq,M.S. and Iliakis,G. (1999) Roles of replication protein A and DNA-dependent protein kinase in the regulation of DNA replication following DNA damage. J. Biol. Chem., 274, 2206022064.
[Abstract/Free Full Text] - Oakley,G.G., Loberg,L.I., Yao,J., Risinger,M.A., Yunker,R.L., Zernik-Kobak,M., Khanna,K.K., Lavin,M.F., Carty,M.P. and Dixon,K. (2001) UV-induced hyperphosphorylation of replication protein a depends on DNA replication and expression of ATM protein. Mol. Biol. Cell, 12, 11991213.
[Abstract/Free Full Text] - Liu,J.S., Kuo,S.R., McHugh,M.M., Beerman,T.A. and Melendy,T. (2000) Adozelesin triggers DNA damage response pathways and arrests SV40 DNA replication through replication protein A inactivation. J. Biol. Chem., 275, 13911397.
[Abstract/Free Full Text] - Wang,H., Guan,J., Perrault,A.R., Wang,Y. and Iliakis,G. (2001) Replication protein A2 phosphorylation after DNA damage by the coordinated action of ataxia telangiectasia-mutated and DNA-dependent protein kinase. Cancer Res., 61, 85548563.
[Abstract/Free Full Text] - Zernik-Kobak,M., Vasunia,K., Connelly,M., Anderson,C.W. and Dixon,K. (1997) Sites of UV-induced phosphorylation of the p34 subunit of replication protein A from HeLa cells. J. Biol. Chem., 272, 2389623904.
[Abstract/Free Full Text] - Niu,H., Erdjument-Bromage,H., Pan,Z.Q., Lee,S.H., Tempst,P. and Hurwitz,J. (1997) Mapping of amino acid residues in the p34 subunit of human single-stranded DNA-binding protein phosphorylated by DNA-dependent protein kinase and Cdc2 kinase in vitro. J. Biol. Chem., 272, 1263412641.
[Abstract/Free Full Text] - Lieber,M.R., Ma,Y., Pannicke,U. and Schwarz,K. (2003) Mechanism and regulation of human non-homologous DNA end-joining. Nature Rev. Mol. Cell Biol., 4, 712720.[CrossRef][Web of Science][Medline]
- Lees-Miller,S.P. and Meek,K. (2003) Repair of DNA double-strand breaks by nonhomologous end-joining. Biochimie, 85, 11611173.[Medline]
- Fried,L.M., Koumenis,C., Peterson,S.R., Green,S.L., van Zijl,P., Allalunis-Turner,J., Chen,D.J., Fishel,R., Giaccia,A.J., Brown,J.M. et al. (1996) The DNA damage response in DNA-dependent protein kinase-deficient SCID mouse cells: replication protein A hyperphosphorylation and p53 induction. Proc. Natl Acad. Sci. USA, 93, 1382513830.
[Abstract/Free Full Text] - Boubnov,N.V. and Weaver,D.T. (1995) scid cells are deficient in Ku and replication protein A phosphorylation by the DNA-dependent protein kinase. Mol. Cell. Biol., 15, 57005706.
[Abstract/Free Full Text] - Allalunis-Turner,M.J., Zia,P.K., Barron,G.M., Mirzayans,R. and Day,R.S.,III (1995) Radiation-induced DNA damage and repair in cells of a radiosensitive human malignant glioma cell line. Radiat. Res., 144, 288293.[Web of Science][Medline]
- Gately,D.P., Hittle,J.C., Chan,G.K. and Yen,T.J. (1998) Characterization of ATM expression, localization and associated DNA-dependent protein kinase activity. Mol. Biol. Cell, 9, 23612374.
[Abstract/Free Full Text] - Chan,D.W., Son,S.C., Block,W., Ye,R., Khanna,K.K., Wold,M.S., Douglas,P., Goodarzi,A.A., Pelley,J., Taya,Y. et al. (2000) Purification and characterization of ATM from human placenta. A manganese-dependent, wortmannin-sensitive serine/threonine protein kinase. J. Biol. Chem., 275, 78037810.
[Abstract/Free Full Text] - Shiloh,Y. (1997) Ataxia-telangiectasia and the Nijmegen breakage syndrome: related disorders but genes apart. Annu. Rev. Genet., 31, 635662.[CrossRef][Web of Science][Medline]
- Mer,G., Bochkarev,A., Gupta,R., Bochkareva,E., Frappier,L., Ingles,C.J., Edwards,A.M. and Chazin,W.J. (2000) Structural basis for the recognition of DNA repair proteins UNG2, XPA and RAD52 by replication factor RPA. Cell, 103, 449456.[CrossRef][Web of Science][Medline]
- Binz,S.K., Lao,Y., Lowry,D.F. and Wold,M.S. (2003) The phosphorylation domain of the 32-kDa subunit of replication protein A (RPA) modulates RPADNA interactions. Evidence for an intersubunit interaction. J. Biol. Chem., 278, 3558435591.
[Abstract/Free Full Text] - Zou,L. and Elledge,S.J. (2003) Sensing DNA damage through ATRIP recognition of RPAssDNA complexes. Science, 300, 15421548.
[Abstract/Free Full Text] - Golub,E.I., Gupta,R.C., Haaf,T., Wold,M.S. and Radding,C.M. (1998) Interaction of human rad51 recombination protein with single-stranded DNA binding protein, RPA. Nucleic Acids Res., 26, 53885393.
[Abstract/Free Full Text] - Choudhary,S.K. and Li,R. (2002) BRCA1 modulates ionizing radiation-induced nuclear focus formation by the replication protein A p34 subunit. J. Cell. Biochem., 84, 666674.[CrossRef][Web of Science][Medline]
- Liu,J.S., Kuo,S.R., Beerman,T.A. and Melendy,T. (2003) Induction of DNA damage responses by adozelesin is S phase-specific and dependent on active replication forks. Mol. Cancer Ther., 2, 4147.
[Abstract/Free Full Text] - Sakamoto,S., Nishikawa,K., Heo,S.J., Goto,M., Furuichi,Y. and Shimamoto,A. (2001) Werner helicase relocates into nuclear foci in response to DNA damaging agents and co-localizes with RPA and Rad51. Genes Cells, 6, 421430.[Abstract]
- Barr,S.M., Leung,C.G., Chang,E.E. and Cimprich,K.A. (2003) ATR kinase activity regulates the intranuclear translocation of ATR and RPA following ionizing radiation. Curr. Biol., 13, 10471051.[CrossRef][Web of Science][Medline]
- Abraham,R.T. (2001) Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes Dev., 15, 21772196.
[Free Full Text] - Durocher,D. and Jackson,S.P. (2001) DNA-PK, ATM and ATR as sensors of DNA damage: variations on a theme? Curr. Opin. Cell Biol., 13, 225231.[CrossRef][Web of Science][Medline]
- Douglas,P., Sapkota,G.P., Morrice,N., Yu,Y., Goodarzi,A.A., Merkle,D., Meek,K., Alessi,D.R. and Lees-Miller,S.P. (2002) Identification of in vitro and in vivo phosphorylation sites in the catalytic subunit of the DNA-dependent protein kinase. Biochem. J., 368, 243251.[CrossRef][Web of Science][Medline]
- Henricksen,L.A., Umbricht,C.B. and Wold,M.S. (1994) Recombinant replication protein A: expression, complex formation and functional characterization. J. Biol. Chem., 269, 1112111132.
[Abstract/Free Full Text] - Ye,R., Bodero,A., Zhou,B.B., Khanna,K.K., Lavin,M.F. and Lees-Miller,S.P. (2001) The plant isoflavenoid genistein activates p53 and Chk2 in an ATM-dependent manner. J. Biol. Chem., 276, 48284833.
[Abstract/Free Full Text] - Kozlov,S., Gueven,N., Keating,K., Ramsay,J. and Lavin,M.F. (2003) ATP activates ataxia-telangiectasia mutated (ATM) in vitro. Importance of autophosphorylation. J. Biol. Chem., 278, 93099317.
[Abstract/Free Full Text] - Ye,R., Goodarzi,A.A., Kurz,E.U., Saito,S., Higashimoto,Y., Lavin,M.F., Appella,E., Anderson,C.W. and Lees-Miller,S.P. (2004) The isoflavonoids genistein and quercetin activate different stress signaling pathways as shown by analysis of site-specific phosphorylation of ATM, p53 and histone H2AX. in press.
- Lees-Miller,S.P., Godbout,R., Chan,D.W., Weinfeld,M., Day,R.S.,III, Barron,G.M. and Allalunis-Turner,J. (1995) Absence of p350 subunit of DNA-activated protein kinase from a radiosensitive human cell line. Science, 267, 11831185.
[Abstract/Free Full Text] - Hoppe,B.S., Jensen,R.B. and Kirchgessner,C.U. (2000) Complementation of the radiosensitive M059J cell line. Radiat. Res., 153, 125130.[Web of Science][Medline]
- Chan,D.W., Mody,C.H., Ting,N.S. and Lees-Miller,S.P. (1996) Purification and characterization of the double-stranded DNA-activated protein kinase, DNA-PK, from human placenta. Biochem. Cell Biol., 74, 6773.[Web of Science][Medline]
- Bochkareva,E., Frappier,L., Edwards,A.M. and Bochkarev,A. (1998) The RPA32 subunit of human replication protein A contains a single-stranded DNA-binding domain. J. Biol. Chem., 273, 39323936.
[Abstract/Free Full Text] - Gomes,X.V., Henricksen,L.A. and Wold,M.S. (1996) Proteolytic mapping of human replication protein A: evidence for multiple structural domains and a conformational change upon interaction with single-stranded DNA. Biochemistry, 35, 55865595.[CrossRef][Medline]
- Blackwell,L.J., Borowiec,J.A. and Masrangelo,I.A. (1996) Single-stranded-DNA binding alters human replication protein A structure and facilitates interaction with DNA-dependent protein kinase. Mol. Cell. Biol., 16, 47984807.
[Abstract/Free Full Text] - Brush,G.S., Anderson,C.W. and Kelly,T.J. (1994) The DNA-activated protein kinase is required for the phosphorylation of replication protein A during simian virus 40 DNA replication. Proc. Natl Acad. Sci. USA, 91, 1252012524.
[Abstract/Free Full Text] - Abraham,R.T. (2003) Checkpoint signaling: epigenetic events sound the DNA strand-breaks alarm to the ATM protein kinase. Bioessays, 25, 627630.[CrossRef][Web of Science][Medline]
- Shiloh,Y. (2003) ATM and related protein kinases: safeguarding genome integrity. Nature Rev. Cancer, 3, 155168.[CrossRef][Web of Science][Medline]
- Goodarzi,A.A., Block,W.D., Lees-Miller,S.P. (2003) The role of ATM and ATR in DNA damage-induced cell cycle control. Prog. Cell Cycle Res., 5, 393412.[Medline]
- Sarkaria,J.N., Tibbetts,R.S., Busby,E.C., Kennedy,A.P., Hill,D.E. and Abraham,R.T. (1998) Inhibition of phosphoinositide 3-kinase related kinases by the radiosensitizing agent wortmannin. Cancer Res., 58, 43754382.
[Abstract/Free Full Text] - Wilstermann,A.M. and Osheroff,N. (2003) Stabilization of eukaryotic topoisomerase II-DNA cleavage complexes. Curr. Top. Med. Chem., 3, 321338.[CrossRef][Web of Science][Medline]
- Sordet,O., Khan,Q.A., Kohn,K.W. and Pommier,Y. (2003) Apoptosis induced by topoisomerase inhibitors. Curr. Med. Chem. Anti-Cancer Agents, 3, 271290.[CrossRef][Medline]
- Martensson,S., Nygren,J., Osheroff,N. and Hammarsten,O. (2003) Activation of the DNA-dependent protein kinase by drug-induced and radiation-induced DNA strand breaks. Radiat. Res., 160, 291301.[Web of Science][Medline]
- Strumberg,D., Pilon,A.A., Smith,M., Hickey,R., Malkas,L. and Pommier,Y. (2000) Conversion of topoisomerase I cleavage complexes on the leading strand of ribosomal DNA into 5'-phosphorylated DNA double-strand breaks by replication runoff. Mol. Cell Biol., 20, 39773987.
[Abstract/Free Full Text] - DArpa,P., Beardmore,C. and Liu,L.F. (1990) Involvement of nucleic acid synthesis in cell killing mechanisms of topoisomerase poisons. Cancer Res., 50, 69196924.
[Abstract/Free Full Text] - Treuner,K., Findeisen,M., Strausfeld,U. and Knippers,R. (1999) Phosphorylation of replication protein A middle subunit (RPA32) leads to a disassembly of the RPA heterotrimer. J. Biol. Chem., 274, 1555615561.
[Abstract/Free Full Text] - Georgaki,A. and Hubscher,U. (1993) DNA unwinding by replication protein A is a property of the 70 kDa subunit and is facilitated by phosphorylation of the 32 kDa subunit. Nucleic Acids Res., 21, 36593665.
[Abstract/Free Full Text] - Oakley,G.G., Patrick,S.M., Yao,J., Carty,M.P., Turchi,J.J. and Dixon,K. (2003) RPA phosphorylation in mitosis alters DNA binding and proteinprotein interactions. Biochemistry, 42, 32553264.[CrossRef][Medline]
- Appella,E. and Anderson,C.W. (2001) Post-translational modifications and activation of p53 by genotoxic stresses. Eur. J. Biochem., 268, 27642772.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
J. A. Meador, Y. Su, J.-L. Ravanat, and A. S. Balajee DNA-dependent protein kinase (DNA-PK)-deficient human glioblastoma cells are preferentially sensitized by Zebularine Carcinogenesis, February 1, 2010; 31(2): 184 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Vassin, R. W. Anantha, E. Sokolova, S. Kanner, and J. A. Borowiec Human RPA phosphorylation by ATR stimulates DNA synthesis and prevents ssDNA accumulation during DNA-replication stress J. Cell Sci., November 15, 2009; 122(22): 4070 - 4080. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Stephan, C. Concannon, E. Kremmer, M. P. Carty, and H.-P. Nasheuer Ionizing radiation-dependent and independent phosphorylation of the 32-kDa subunit of replication protein A during mitosis Nucleic Acids Res., October 1, 2009; 37(18): 6028 - 6041. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Auclair, R. Rouget, E. B. Affar, and E. A. Drobetsky ATR kinase is required for global genomic nucleotide excision repair exclusively during S phase in human cells PNAS, November 18, 2008; 105(46): 17896 - 17901. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Blickwedehl, M. Agarwal, C. Seong, R. K. Pandita, T. Melendy, P. Sung, T. K. Pandita, and N. Bangia Role for proteasome activator PA200 and postglutamyl proteasome activity in genomic stability PNAS, October 21, 2008; 105(42): 16165 - 16170. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. DeHart, A. Bosque, R. S. Harris, and V. Planelles Human Immunodeficiency Virus Type 1 Vif Induces Cell Cycle Delay via Recruitment of the Same E3 Ubiquitin Ligase Complex That Targets APOBEC3 Proteins for Degradation J. Virol., September 15, 2008; 82(18): 9265 - 9272. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Anantha, E. Sokolova, and J. A. Borowiec RPA phosphorylation facilitates mitotic exit in response to mitotic DNA damage PNAS, September 2, 2008; 105(35): 12903 - 12908. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sakasai and R. Tibbetts RNF8-dependent and RNF8-independent Regulation of 53BP1 in Response to DNA Damage J. Biol. Chem., May 16, 2008; 283(20): 13549 - 13555. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Anantha, V. M. Vassin, and J. A. Borowiec Sequential and Synergistic Modification of Human RPA Stimulates Chromosomal DNA Repair J. Biol. Chem., December 7, 2007; 282(49): 35910 - 35923. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Manthey, S. Opiyo, J. G. Glanzer, D. Dimitrova, J. Elliott, and G. G. Oakley NBS1 mediates ATR-dependent RPA hyperphosphorylation following replication-fork stall and collapse J. Cell Sci., December 1, 2007; 120(23): 4221 - 4229. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Fanning, V. Klimovich, and A. R. Nager A dynamic model for replication protein A (RPA) function in DNA processing pathways Nucleic Acids Res., September 10, 2006; 34(15): 4126 - 4137. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Myers and D. Cortez Rapid Activation of ATR by Ionizing Radiation Requires ATM and Mre11 J. Biol. Chem., April 7, 2006; 281(14): 9346 - 9350. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sakasai, K. Shinohe, Y. Ichijima, N. Okita, A. Shibata, K. Asahina, and H. Teraoka Differential involvement of phosphatidylinositol 3-kinase-related protein kinases in hyperphosphorylation of replication protein A2 in response to replication-mediated DNA double-strand breaks Genes Cells, March 1, 2006; 11(3): 237 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bochkareva, L. Kaustov, A. Ayed, G.-S. Yi, Y. Lu, A. Pineda-Lucena, J. C. C. Liao, A. L. Okorokov, J. Milner, C. H. Arrowsmith, et al. Single-stranded DNA mimicry in the p53 transactivation domain interaction with replication protein A PNAS, October 25, 2005; 102(43): 15412 - 15417. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu, M. Kvaratskhelia, S. Hess, Y. Qu, and Y. Zou Modulation of Replication Protein A Function by Its Hyperphosphorylation-induced Conformational Change Involving DNA Binding Domain B J. Biol. Chem., September 23, 2005; 280(38): 32775 - 32783. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Robison, L. Lu, K. Dixon, and J. J. Bissler DNA Lesion-specific Co-localization of the Mre11/Rad50/Nbs1 (MRN) Complex and Replication Protein A (RPA) to Repair Foci J. Biol. Chem., April 1, 2005; 280(13): 12927 - 12934. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kim, D. D. Dimitrova, K. M. Carta, A. Saxena, M. Daras, and J. A. Borowiec Novel Checkpoint Response to Genotoxic Stress Mediated by Nucleolin-Replication Protein A Complex Formation Mol. Cell. Biol., March 15, 2005; 25(6): 2463 - 2474. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ferrara and E. B. Kmiec Camptothecin enhances the frequency of oligonucleotide-directed gene repair in mammalian cells by inducing DNA damage and activating homologous recombination Nucleic Acids Res., October 5, 2004; 32(17): 5239 - 5248. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. D. Block, D. Merkle, K. Meek, and S. P. Lees-Miller Selective inhibition of the DNA-dependent protein kinase (DNA-PK) by the radiosensitizing agent caffeine Nucleic Acids Res., April 1, 2004; 32(6): 1967 - 1972. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||















