Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (176K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Wichlacz, A.
Right arrow Articles by Ciesiolka, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wichlacz, A.
Right arrow Articles by Ciesiolka, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published online 18 February 2004

Nucleic Acids Research, 2004, Vol. 32, No. 3 e39
© 2004 Oxford University Press

Generating in vitro transcripts with homogenous 3' ends using trans-acting antigenomic delta ribozyme

Agnieszka Wichlacz, Michal Legiewicz and Jerzy Ciesiolka*

Institute of Bioorganic Chemistry, Polish Academy of Sciences, Noskowskiego 12/14, 61-704 Poznan, Poland

*To whom correspondence should be addressed. Tel: +48 61 8528503; Fax: +48 61 8520532; Email: ciesiolk{at}ibch.poznan.pl
Paper dedicated to Professor Maciej Wiewiorowski on the occasion of his 85th birthday

Received November 14, 2003; Accepted January 30, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
In most in vitro run-off transcription reactions with T7 RNA polymerase, transcripts with heterogeneous ends are commonly obtained. Towards the goal of finding a simple and effective procedure for correct processing of their 3' ends we propose the use of trans-acting antigenomic delta ribozyme. We demonstrate that the extension of nascent transcripts with only seven nucleotides complementary to the ribozyme’s recognition site, and subsequently, the removal of those nucleotides with the ribozyme acting in trans, is an efficient procedure for generating transcripts with homogenous 3' ends. This approach was tested on two model RNA molecules: an in vitro transcript of yeast tRNAPhe and a delta ribozyme, which processed itself during transcription. The proposed procedure is a simple alternative to the use of ribozymes as cis-cleaving autocatalytic cassettes attached to transcript 3' ends. As there is little possibility that the required additional stretch, only seven nucleotides long, enters into stable interactions with other parts of the transcripts, it can be cleaved off with high efficacy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
RNA research has been significantly facilitated since transcription in vitro using phage polymerases became a widely used method of synthesis of oligoribonucleotides. It allows production of RNA molecules of desired sequence and length in quantities sufficient for most applications, including X-ray and NMR studies. However, the method is not as precise as the process occurring in vivo. It has been reported that during in vitro run-off transcription RNA polymerases often generate molecules with heterogeneous ends (14). In particular, T7 RNA polymerase attaches one or two non-template encoded nucleotides to the 3' end of the nascent RNA transcript and at the same time it may show premature termination close to its 3' end (1,2). 5'-terminal heterogeneity is another drawback. This has been observed in transcripts that begin with multiple, consecutive guanosine residues (3). All these inaccuracies result in a decreased number of full-length, correctly transcribed RNA products. However, in many applications such as NMR spectroscopy, X-ray crystallographic studies and ligation reactions, homogeneous transcripts of defined length are indispensable (5,6).

To solve the problem of 3' end heterogeneity of RNA transcripts obtained in vitro, several approaches have been developed. A commonly used procedure is a careful purification of transcription products by denaturing polyacrylamide gel electrophoresis. It is recommended to perform non-denaturing PAGE or HPLC purification afterwards (7,8). Another method uses modified DNA templates with the penultimate or the last two nucleotides with 2'-methoxy moieties (9). Still another approach to the preparation of RNA transcripts with homogeneous 3' ends employs ribozymes that excise full-length RNAs from flanking regions (1013). Hammerhead, hairpin and delta ribozymes acting in cis are frequently used for that purpose. However, ribozymes acting in trans offer some potential benefits in comparison to the cis-acting ones (11). They recognize and cleave off a short oligonucleotide stretch, which can readily be introduced into the template using PCR. Moreover, when isotopically labeled RNA transcripts are needed for NMR studies, the use of trans ribozymes allows to spare the expensive nucleotide precursors, which otherwise would be incorporated in the cis-acting ribozyme sequence and wasted upon cleavage. Finally, a trans ribozyme is able to work in several rounds. However, to achieve satisfactory cleavage extents, the reaction time has to be considerably extended which may not be advantageous in practical applications.

Although ribozymes have been used for trimming RNA transcripts for several years, further improvements of the methods are still being investigated. Recently, the use of delta ribozyme acting in cis has been proposed for processing of the 3' ends of RNA transcribed in vitro (12). Unlike hammerhead or hairpin ribozymes, delta ribozymes do not require any particular sequence upstream of the cleavage site, and therefore they can be applied to any RNA. Very recently, two general plasmid vectors have been created for in vitro transcription of defined RNA sequences. The vectors encode hammerhead and delta ribozyme sequences that excise homogeneous RNAs from flanking regions (13).

In this communication, we propose the use of antigenomic delta ribozyme acting in trans for the purpose of correct processing of the 3' ends of RNA transcripts. The RNA transcripts are extended with the sequence of only seven nucleotides complementary to the ribozyme’s recognition site. Subsequently, these extra nucleotides are cleaved off with trans-acting delta ribozyme. The procedure has been tested on two model RNA molecules: an in vitro transcript of yeast tRNAPhe and a delta ribozyme.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Materials
The enzymes were purchased from MBI Fermentas, except for T2 ribonuclease, which was purchased from Sigma. The chemicals were purchased from Fluka or Sigma. Chemically synthesized oligodeoxyribonucleotides: TD, 5'-CCGACCC TGGTGCGAATTCTGTG-3' and HDVD, 5'-CCGACCC GAAAAGTGGCTCTCC-3' with seven-nucleotide long stretches complementary to delta ribozyme recognition site underlined, as well as two primers: T7T, 5'-TAATAC GACTCACTATAG-3' and T7HDV, 5'-TAATACGACTCACT ATAGGGCATCTCCACC-3' with the T7 RNA polymerase promoter marked in italics, were purchased from DNA Sequencing and Oligonucleotide Service of the Institute of Biochemistry and Biophysics, PAN, Warsaw. [{gamma}-32P]ATP (5000 Ci/mmol) was from ICN.

DNA preparation
Synthetic oligodeoxyribonucleotides were purified by electrophoresis on denaturing 8% polyacrylamide gels. DNA bands were excised, eluted from the gels with 0.3 M sodium acetate, pH 5.7, ethanol precipitated and dissolved in TE buffer.

Construction of DNA template for tRNAPhe/7nt intermediate (‘from gene’)
The DNA transcription template was generated by PCR using the dsDNA encoding yeast tRNAPhe: 5'-TAATACGACTCAC TATAGCGGATTTAGCTCAGTTGGGAGAGAGCGCC A GACTGAAGATCTGGAGGTCCTGTGTTCGATCCACA GAATTCGCACCA-3' (letters in italics mark the T7 RNA polymerase promoter) and equimolar amounts of two primers: an upstream T7T primer and oligomer TD (14). After PCR, DNA was recovered by phenol/chloroform extraction, ethanol precipitated and dissolved in TE buffer.

Construction of DNA template for delta ribozyme/7nt intermediate (‘from RNA’)
The cDNA was obtained via reverse transcription reaction using oligomer HDVD and delta ribozyme as a template: 5'- GGGCAUCUCCACCUCCUCGCGGUCCGACCUGGGCAU CCGAGCACUCGGAUGGCUAAGGGAGAGCCACUUUUC-3' (15). The reaction was carried out with M-MuLV reverse transcriptase, according to the manufacturer’s protocol. Subsequently, RNase A enzyme was added to a final concentration of 1 mg/ml to digest the RNA template. The cDNA was then amplified by PCR with primers: T7HDV primer and oligomer HDVD. dsDNA was recovered as described above.

RNA preparation
The RNA intermediates, tRNAPhe and delta ribozyme extended with seven nucleotides GGGUCGG attached to their 3' ends, were obtained by transcription of the corresponding DNA templates with 2000 U/ml T7 RNA polymerase, 40 mM Tris–HCl pH 8.0, 10 mM MgCl2, 2 mM spermidine, 5 mM DTT, 1 mM each NTP, 0.01% Triton X-100, 4 mM guanosine, in a final volume of 100 µl (15). The transcription mixture was incubated at 37°C for 4 h. During transcription of the delta ribozyme intermediate, most of the transcripts underwent 3' processing already in the reaction mixture. The transcription products were ethanol precipitated and purified by electrophoresis on an 8% polyacrylamide gel containing 7 M urea. The band corresponding to the RNA was visualized under UV light, cut out and RNA was eluted from the gel with 0.3 M sodium acetate pH 5.7, 0.1 mM EDTA, ethanol precipitated and dissolved in sterile water containing 0.1 mM EDTA.

5'-end labeling
Purified RNA transcripts were denatured at 100°C for 2 min, cooled on ice for 10 min, and labeled with 32P at their 5' ends by incubation with [{gamma}-32P]ATP and T4 polynucleotide kinase according to standard procedures at 37°C for 30 min. The radioactive product was purified by electrophoresis on a denaturing 8% polyacrylamide gel. The labeled zone located by autoradiography was excised, eluted from the gel as described above, ethanol precipitated and dissolved in sterile water containing 0.1 mM EDTA.

Cleavage reaction
Cleavage reactions of the 5'-32P-end-labeled tRNAPhe/7nt intermediate were carried out with excess of the delta ribozyme (specified in the figure legends). For example, in the reaction with 2-fold excess of the ribozyme, 1–3 pmol radioactive RNA intermediate (50 000 c.p.m.) supplemented with 20 pmol unlabeled RNA was mixed with 40 pmol delta ribozyme and subjected to a denaturation–renaturation procedure in the buffer Tris–HCl pH 7.5, 0.1 mM EDTA: incubated for 2 min at 100°C, cooled on ice for 10 min, and finally, incubated for 10 min at 37°C. The reaction was initiated by adding magnesium chloride solution to 10 mM final concentration and proceeded at 37°C. Aliquots of the reaction mixture (5 µl) were removed at specified time points and quenched with equal volumes of 20 mM EDTA and 7 M urea. The reaction products were analyzed by electrophoresis on 12% polyacrylamide gels containing 8.3 M urea, visualized by autoradiography or quantified using phosphorimaging screens and a Typhoon 8600 Imager with ImageQuant software (Molecular Dynamics). First-order cleavage rate constants (kobs) were calculated using Microcal Origin 6.0 software.

3'-end labeling and determination of 3' terminal nucleotide
The 3' terminal nucleotide of the delta ribozyme transcript, which had been processed at its 3' end, was determined as follows. The terminal cyclic phosphate that occurred as a result of the ribozyme catalyzed cleavage reaction was opened with maleic acid treatment and the resulting monophosphates were removed with calf intestine alkaline phosphatase (CIAP) (16,17). Decyclization was carried out in the presence of 0.8 M maleic acid–NaOH buffer, pH 2, at 25°C for 80 min. The RNA was ethanol precipitated three times and dephosphorylated with 10 U/ml CIAP at 56°C for 25 min. The 3' terminal nucleotide was then coupled to [5'-32P]pCp in the presence of 1000 U/ml T4 RNA ligase, at 4°C for 18 h. The labeled RNA was purified by electrophoresis on a denaturing 8% polyacrylamide gel, located by autoradiography, eluted from the gel, ethanol precipitated and dissolved in sterile water containing 0.1 mM EDTA. Subsequently, the RNA was completely digested with 20 U/ml T2 ribonuclease at 37°C, for 20 min, the digestion products were applied to 20 x 20 cm cellulose F254 sheets (Merck) and resolved by two-dimensional thin-layer chromatography in isobutyric acid–conc. NH4OH–H2O (66:1:3, v/v/v) and 0.1 M sodium phosphate, pH 6.8–ammonium sulphate–n-propanol (100:60:2, v/w/v) (18). Zones corresponding to nucleotide markers were located under UV light. Radioactive zones were detected using phosphorimaging screens and Typhoon 8600 Imager, and quantified with ImageQuant software.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
The trans-acting variant of antigenomic delta ribozyme used in our experiments as ‘molecular scissors’ is shown in Figure 1. The wild-type ribozyme sequence is separated in the J1/2 region between A9 and U10 into the ribozyme and substrate strands, and at the same time U residue in position 10 is mutated to G, which facilitates in vitro transcription of the ribozyme strand by T7 RNA polymerase. Additionally, C8 and C9 are deleted from the substrate strand. The P4 stem, which is not directly involved in catalysis, is substantially shortened. This region contributes to structural heterogeneity of the wild-type ribozyme by increasing the number of non-active, misfolded molecules. This results in low final cleavage extents, frequently observed in the case of cis-acting variants. The variant shown in Figure 1 is very similar to those most commonly used in the studies on the ribozyme cleavage mechanism and it is also an attractive tool in the strategy of directed RNA degradation (reviewed in 1921). Its catalytic properties have been characterized earlier in our laboratory (15).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Secondary structures of trans-acting antigenomic delta ribozyme and RNA intermediate of yeast tRNAPhe in vitro transcript with seven additional nucleotides attached to its 3' end, which are complementary to delta ribozyme’s recognition site. Numbering of nucleotides corresponds to the wild-type RNA sequences. In the ribozyme structure base-paired segments are denoted P1 to P4. Catalytic cleavage sites are marked by filled triangles.

 
The general scheme of the procedure to obtain RNA transcripts with homogeneous 3' ends is presented in Figure 2. In the first step, a transcription template is generated, which encodes the RNA sequence of interest extended with an additional seven nucleotides GGGUCGG complementary to the delta ribozyme’s recognition site. We propose two alternative ways to generate the DNA template: ‘from a gene’ and ‘from RNA’. Following RNA transcription, the extra nucleotides are cleaved off with the trans-acting ribozyme in a reaction induced by magnesium ions.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. The general schemes showing two alternative procedures to obtain RNA in vitro transcripts with homogeneous 3' ends. The abbreviation RRS denotes the seven-nucleotide long stretches that correspond to the delta ribozyme’s recognition site. These nucleotides are cleaved off from the RNA transcription intermediates in the last step of the procedure.

 
The ‘from gene’ alternative was examined on the yeast tRNAPhe in vitro transcript (Fig. 1 and Fig. 2, left panel). The transcription template encoding tRNAPhe sequence and the extra seven-nucleotide stretch attached to its 3' terminus was constructed via re-amplification of the tRNA gene by PCR method. Following transcription with T7 RNA polymerase and gel purification of the tRNAPhe/7nt intermediate, we added the delta ribozyme and then Mg2+ ions, which induced the cleavage reaction. Although the delta ribozymes are known to be active at a relatively low Mg2+ concentration, it was reported that catalytic activity of the variant used in our studies increased ~5-fold upon increasing Mg2+ concentration from 1 to 10 mM (15). For that reason, we decided to process all cleavage reactions at 10 mM concentration of Mg2+ ions.

In order to determine proper cleavage conditions, the reaction was performed using different excess of delta ribozyme over the tRNAPhe/7nt substrate. It turned out that a decrease in ribozyme excess from 100-fold to just 2-fold has a relatively small effect on the final cleavage extent (Fig. 3A). We proved that sufficient reaction rate (the reaction plateau is achieved within ~10 min) and the final cleavage extent of ~90% could be reached with just double excess of the ribozyme. A delta ribozyme can also be used in sub-stoichiometric amounts since it is able to work under multi-turnover conditions (1921 and our unpublished observations). However, in order to achieve high cleavage extents, the reaction time has to be prolonged to a few hours. Since this might result in an increased level of unspecific degradation of RNA, such conditions are not recommended for practical ribozyme applications. Examples of cleavage kinetics, at the ratio of ribozyme and tRNAPhe/7nt substrate of 10:1 and 2:1, are shown in Figure 3B. The calculated first-order rate constants were 0.57 and 0.46 min–1, respectively. These values are comparable to 0.92 min–1 obtained with a small, 11-nucleotide substrate and 300-fold excess of the ribozyme under similar conditions (15). As expected, based on strict sequence requirements of the delta ribozyme (1921), the cleavage of tRNAPhe/7nt intermediate occurred with high specificity; no other products were detected on a polyacrylamide gel (Fig. 3B).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Cleavage reaction of 5'-32P-end-labeled tRNAPhe/7nt intermediate with trans-acting antigenomic delta ribozyme. (A) Dependence of the cleavage reaction on different ribozyme-to-substrate ratios. The reactions were carried out in the buffer Tris–HCl, pH 7.5, in the presence of 10 mM MgCl2, the products were separated on 12% polyacrylamide gels and visualized by autoradiography. (B) Cleavage reaction kinetics with 2- and 10-fold excess of the ribozyme (left panel, filled squares and circles, respectively). The autoradiogram shows the reaction products observed with 2-fold excess of the ribozyme at times ranging from 20 s to 60 min (right panel; C, control lane, RNA incubated in the presence of 10 mM Mg2+ ions for 60 min, no ribozyme added; L, formamide ladder; T1, limited digestion with RNase T1). (C) Dependence of the cleavage reaction on various ribozyme and substrate concentrations at a constant 2:1 ratio.

 
We have also examined the cleavage reaction with different concentrations of ribozyme and tRNAPhe/7nt substrate at a constant 2:1 ratio (Fig. 3C). The highest concentrations suggested for practical applications turned out to be 6 µM ribozyme and 3 µM RNA substrate. With concentrations increased to 12 µM and 6 µM, respectively, the reaction became less specific and some side products appeared. Although we did not study their nature or origin, one might speculate that cleavages occurred at other, unpredicted sites of the transcript due to formation of stable but imperfect helix P1 or shortening its length (Fig. 1). However, earlier studies on the delta ribozymes (reviewed in 1921) have demonstrated that disruption of Watson–Crick pairing in P1 abolished or severely reduced their catalytic activity. Similarly, varying the length of P1 was generally detrimental to cleavage. For example, in the genomic ribozyme, shortening P1 by 2 bp destroyed activity while its shortening by 1 bp resulted in up to a 50-fold decreased rate of cleavage. Thus the danger of unwanted cleavage at ‘imperfectly matched’ sites seems to be relatively low for trans-acting delta ribozymes. However, it has to be taken into account if cleavage conditions stimulate non-specific RNA–RNA interactions, for example, at high RNA concentration.

In order to obtain the delta ribozyme molecule homogeneous at its 3' end, we applied an alternative procedure, shown in Figure 2, which we named ‘from RNA’. First, the reverse transcription reaction was performed to generate cDNA encoding ribozyme sequence extended with the desired additional seven nucleotides. Subsequently, the RNA template was digested with RNase A to ensure that the delta ribozyme molecules present in the last step of the procedure exclusively originate from the newly synthesized transcription templates. After PCR amplification of cDNA, the dsDNA template was transcribed. During transcription, the seven-nucleotide stretch from extended delta ribozyme sequence was cleaved off in the presence of Mg2+ ions, which were present in the reaction mixture.

We demonstrated that the delta ribozyme transcript processed by our method showed high homogeneity at its 3' end. In order to determine 3' terminal nucleotide, the RNA was radioactively labeled at its 3' end by pCp ligation, then it was subjected to complete digestion with T2 ribonuclease, and finally the hydrolysate was analyzed by thin layer chromatography. Before 3' end labeling 2',3'-cyclic phosphates, formed during ribozyme cleavage, were opened with maleic acid and the resulting monophosphates were removed with CIAP (17). Experimental data obtained from two independent trials showed more than 98% of C at the transcript 3' end and less than 1% of A, G and U. A standard run-off transcription gave much more heterogeneous 3' end and the proper 3' terminal C residue was present in only ~80% of molecules.

The results demonstrate that the delta ribozyme acting in trans is very useful in producing in vitro transcripts with homogeneous 3' ends. The procedure can be easily adapted to most RNA molecules or RNA genes. To ensure high cleavage efficiency of RNA intermediates, the additional seven-nucleotide long stretch should be accessible to the delta ribozyme. Thus any possibility of extensive pairing of that stretch with other regions of the transcript should be analyzed and avoided while constructing the transcription template. We have shown that the ribozyme was still able to cleave off the seven-nucleotide long stretch embedded into a model RNA hairpin where four out of seven nucleotides were paired with nucleotides of the opposite hairpin strand (unpublished observations of our laboratory). Cleavage occurred, however, with reduced efficacy. Our procedure is an effective and simple alternative to the use of ribozymes as cis-cleaving autocatalytic cassettes attached to transcript 3' ends. In those cases, improper folding of ribozymes within the context of full-length molecules is likely to be responsible for the frequently observed low cleavage efficiency. As there is little probability that the additional seven-nucleotide long stretch required in the procedure described in this paper enters into stable interactions with other parts of transcribed sequences, these extra nucleotides can be cleaved off by trans-acting delta ribozyme with high efficacy.

The trans-acting delta ribozyme system has some considerable advantages over the system employing the VS ribozyme, which has been proposed previously (11). As regards the VS ribozyme system, the additional oligonucleotide stretch attached to transcript 3' ends consists of ~20 nucleotides. It is substantially longer than the seven-nucleotide stretch required by the delta ribozyme, and therefore, its introduction into DNA templates by PCR is more laborious. Moreover, that longer additional stretch may interact with other regions of transcripts more easily, thus lowering their cleavage efficacy. Finally, the VS ribozyme is twice as long as the delta ribozyme, and in practice it has to be transcribed from a plasmid DNA template. In contrast, the delta ribozyme can be transcribed from a template consisting of chemically synthesized oligodeoxyribonucleotides which makes this ribozyme fully available for practical applications. In summary, we propose an effective and simple alternative to the existing protocols, which extends the applicability of ribozymes to producing in vitro RNA transcripts with homogeneous 3' ends.


    ACKNOWLEDGEMENTS
 
We thank members of our laboratory for valuable comments on the manuscript. This work was supported by the Polish Committee for Scientific Research, grant no. 6P04B 01720 to J.C.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Milliggan,J.F., Groebe,J.F., Witherell,D.R. and Uhlenbeck,O.C. (1987) Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nucleic Acids Res., 15, 8783–8798.[Abstract/Free Full Text]

  2. Cazenave,C. and Uhlenbeck,O.C. (1994) RNA template-directed RNA synthesis by T7 RNA polymerase. Biochemistry, 91, 6972–6976.

  3. Pleiss,J.A., Derrick,M.L. and Uhlenbeck,O.C. (1998) T7 RNA polymerase produces 5' end heterogeneity during in vitro transcription from certain templates. RNA, 4, 1313–1317.[Abstract]

  4. Helm,M., Brule,H., Giege,R. and Florentz,C. (1999) More mistakes by T7 RNA polymerase at the 5' ends of in vitro-transcribed RNAs. RNA, 5, 618–621.[CrossRef][ISI][Medline]

  5. Price,S.R., Ito,N., Outbridge,C., Avis,J.M. and Nagai,K. (1995) Crystallization of RNA–protein complexes. I. Methods for the large-scale preparation of RNA suitable for crystallographic studies. J. Mol. Biol., 249, 398–408.[CrossRef][ISI][Medline]

  6. Sherlin,L.D., Bullock,T.L., Nissan,T.A., Perona,J.J., Lariviere,F.J., Uhlenbeck,O.C. and Scaringe,S.A. (2001) Chemical and enzymatic synthesis of tRNAs for high-throughput crystallization. RNA, 7, 1671–1678.[Abstract]

  7. Kholod,N., Vassilenko,K., Shlyapnikov,M., Ksenzenko,V. and Kisselev,L. (1998) Preparation of active tRNA gene transcripts devoid of 3'-extended products and dimers. Nucleic Acids Res., 26, 2500–2501.[Abstract/Free Full Text]

  8. Anderson,A.C., Scaringe,S.A., Earp,B.E. and Frederick,C.A. (1996) HPLC purification of RNA for crystallography and NMR. RNA, 2, 110–117.[Abstract]

  9. Kao,C., Zheng,M. and Rüdisser,S. (1999) A simple and efficient method to reduce nontemplated nucleotide addition at the 3' terminus of RNAs transcribed by T7 RNA polymerase. RNA, 5, 1268–1272.[Abstract]

  10. Grosshans,C.A. and Cech,T.R. (1991) A hammerhead ribozyme allows synthesis of a new form of the Tetrahymena ribozyme homogeneous in length with a 3' end blocked for transesterification. Nucleic Acids Res., 19, 3875–3880.[Abstract/Free Full Text]

  11. Ferre-D’Amare,A.R. and Doudna,J.A. (1996) Use of cis- and trans-ribozymes to remove 5' and 3' heterogeneities from milligrams of in vitro transcribed RNA. Nucleic Acids Res., 24, 977–978.[Free Full Text]

  12. Schürer,H., Lang,K., Schuster,J. and Mörl,M. (2002) A universal method to produce in vitro transcripts with homogeneous 3' ends. Nucleic Acids Res., 30, e56.[Abstract/Free Full Text]

  13. Walker,S.C., Avis,J.M. and Conn,G.L. (2003) General plasmids for producing RNA in vitro transcripts with homogeneous ends. Nucleic Acids Res., 31, e82.[Abstract/Free Full Text]

  14. Matysiak,M., Wrzesinski,J. and Ciesiolka,J. (1999) Sequential folding of the genomic ribozyme of the hepatitis delta virus: structural analysis of RNA transcription intermediates. J. Mol. Biol., 291, 283–294.[CrossRef][ISI][Medline]

  15. Wrzesinski,J., Legiewicz,M., Smolska,B. and Ciesiolka,J. (2001) Catalytic cleavage of cis- and trans-acting antigenomic delta ribozymes in the presence of various divalent metal ions. Nucleic Acids Res., 29, 4482–4492.[Abstract/Free Full Text]

  16. Buzayan,J.M., Gerlach,W.L., Bruening,G., Keese,P. and Gould,A.R. (1986) Nucleotide sequence of Satellite tobacco ringspot virus RNA and its relationship to multimeric forms. Virology, 151, 186–199.[CrossRef][ISI]

  17. Alam,S.L., Nelson,C.C., Felden,B., Atkins,J.F. and Gesteland,R.F. (1998) Effects of 3'-terminal phosphates in RNA produced by ribozyme cleavage. RNA, 4, 607–612.[CrossRef][ISI][Medline]

  18. Silberklang,M., Gillum,A.M. and RajBhandary,U.L. (1979) Use of in vitro 32P labeling in the sequence analysis of nonradioactive tRNAs. In Moldave,K. and Grossman,L. (eds), Methods in Enzymology, Academic Press, NY, Vol. 59, pp. 58–109.

  19. Been,M.D. and Wickham,G.S. (1997) The self cleaving ribozymes of hepatitis delta virus. Eur. J. Biochem., 247, 741–753.[ISI][Medline]

  20. Ciesiolka,J., Wrzesinski,J., Legiewicz,M., Smolska,B. and Dutkiewicz,M. (2001) Ribozymes of the hepatitis delta virus: Recent findings on their structure, mechanism of catalysis and possible applications. Acta Biochim. Pol., 48, 409–418.[ISI][Medline]

  21. Wadkins,T.S. and Been,M. (2002) Ribozyme activity in the genomic and antigenomic RNA strands of hepatitis delta virus. Cell. Mol. Life Sci., 59, 112–125.[CrossRef][ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
M. Legiewicz, A. Wichlacz, B. Brzezicha, and J. Ciesiolka
Antigenomic delta ribozyme variants with mutations in the catalytic core obtained by the in vitro selection method
Nucleic Acids Res., March 2, 2006; 34(4): 1270 - 1280.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Takaku, A. Minagawa, M. Takagi, and M. Nashimoto
A novel 4-base-recognizing RNA cutter that can remove the single 3' terminal nucleotides from RNA molecules
Nucleic Acids Res., June 28, 2004; 32(11): e91 - e91.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (176K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Wichlacz, A.
Right arrow Articles by Ciesiolka, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wichlacz, A.
Right arrow Articles by Ciesiolka, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?