Published online 24 February 2004
Nucleic Acids Research, 2004, Vol. 32, No. 4 1345-1353
© 2004 Oxford University Press
The DNA-binding properties of the ARID-containing subunits of yeast and mammalian SWI/SNF complexes
Fels Institute for Cancer Research, Temple University School of Medicine, Philadelphia, PA, USA 1 Beckman Research Institute of the City of Hope, Duarte, CA, USA and 2 TVW Telethon Institute for Child Health Research and the Center for Child Health Research, Subiaco, Australia
*To whom correspondence should be addressed. Tel: +1 215 707 7313; Fax: +1 215 707 6989; Email: betty{at}temple.edu
Received October 3, 2003; Revised January 6, 2004; Accepted January 21, 2004
| ABSTRACT |
|---|
|
|
|---|
SWI/SNF complexes are ATP-dependent chromatin remodeling complexes that are highly conserved from yeast to human. From yeast to human the complexes contain a subunit with an ARID (A-T-rich interaction domain) DNA-binding domain. In yeast this subunit is SWI1 and in human there are two closely related alternative subunits, p270 and ARID1B. We describe here a comparison of the DNA-binding properties of the yeast and human SWI/SNF ARID-containing subunits. We have determined that SWI1 is an unusual member of the ARID family in both its ARID sequence and in the fact that its DNA-binding affinity is weaker than that of other ARID family members, including its human counterparts, p270 and ARID1B. Sequence analysis and substitution mutagenesis reveals that the weak DNA-binding affinity of the SWI1 ARID is an intrinsic feature of its sequence, arising from specific variations in the major groove interaction site. In addition, this work confirms the finding that p270 binds DNA without regard to sequence specificity, excluding the possibility that the intrinsic role of the ARID is to recruit SWI/SNF complexes to specific promoter sequences. These results emphasize that care must be taken when comparing yeast and higher eukaryotic SWI/SNF complexes in terms of DNA-binding mechanisms.
| INTRODUCTION |
|---|
|
|
|---|
The SWI/SNF complex is an ATP-dependent chromatin remodeling complex that is highly conserved from yeast to human. Most of the subunits of the complex in yeast have recognizable orthologs in higher eukaryotes (reviewed in 1,2). Upon recruitment to specific promoters, the SWI/SNF complex uses the energy of ATP hydrolysis to remodel chromatin. The complex itself binds DNA with high affinity and contains DNA-crosslinking subunits (3,4). From yeast to human, the complex has been found to contain a subunit with an ARID DNA-binding domain. In yeast the subunit is SWI1 and in human there are two alternative subunits: p270 (5,6) and a p270-related protein reported under various names (710) and designated ARID1B here in accordance with nomenclature recently approved by both the HUGO Gene Nomenclature Committee (HGNC) (http://www.gene.ucl.ac.uk/nomenclature/) and the Mouse Genomic Nomenclature Committee (MGNC) (http://www.informatics.jax.org/mgihome/nomen/index.shtml). According to this system, the human p270 gene (SMARCF1) now has the alternative designation ARID1A.
The ARID (A-T rich interaction domain) defines a distinct family of DNA-binding proteins: 15 in human, six in Drosophila and two in yeast. They have been found in all eukaryotic organisms studied. ARID family proteins are diverse in function, but all are implicated in the control of cell growth, differentiation or development (reviewed in 11,12). The consensus sequence for the domain extends across 94 amino acid residues and is well conserved. The founding members of the ARID family are Drosophila Dri (13) and the closely related mammalian protein Bright (14). Both proteins bind with high affinity to AT-rich sequences, which prompted the naming of the domain. Another mammalian family member, MRF2, shows similar sequence specificity (15). However, sequence-specific DNA binding has not been reported for most ARID proteins. There is clearly variation in ARID family DNA binding behavior, as p270 and its closest Drosophila ortholog Osa show no preference for specific sequences (16,17). While examining the DNA-binding properties of the SWI/SNF complex, we have determined that yeast SWI1 is unusual among members of the ARID family in that it binds DNA with much weaker affinity than other ARID proteins, including its human counterparts p270 and ARID1B. We show here the difference in DNA-binding properties between yeast and human ARID subunits of SWI/SNF complexes. The weak affinity of SWI1 for DNA is largely attributable to a gap in the ARID consensus sequence and to the presence of acidic rather than basic residues in the vicinity of a major DNA contact site. SWI/SNF complexes are well conserved between yeast and humans, so the different DNA-binding behaviors of the respective ARID-containing subunits is unexpected and underscores the greater degree of complexity in the mammalian versions of the complexes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids
GST fusion constructs. The p270 fusion protein is the product of plasmid pNDX (described in 16). The Dri fusion protein is the product of p410 (13), which was kindly provided by R. Saint. The MRF2 fusion protein is the product of pMRF2-GST, which was constructed by ligating a BamHISalI restriction fragment from the insert of MRF2pQE30 into the pGEX4T vector (Pharmacia Biotech). The MRF2pQE30 plasmid was described in Yuan et al. (18). The SWI1 fusion protein is the product of pSWI1-GST, which was constructed by PCR using plasmid CP623 as template. CP623 was kindly provided by Craig Peterson. Sequence from base pair 1471 to 2399 (numbered according to accession no. X12493 [GenBank] ) was amplified and cloned into the TOPO vector (Invitrogen) and subcloned into the pGEX4T vector. The translation product extends from residue 264 to 552 according to accession no. P09547 [GenBank] (the SWI1 ARID extends from residue 402 to 492).
In vitro translation constructs. The p270 NE9-B2 in vitro expression plasmid contains p270 base pairs 30713931 (according to accession no. NM_006015
[GenBank]
) in the pGEM5Zf(+) vector (Promega). The translation product extends from residue 901 to 1187 (the p270 ARID extends from residue 1013 to 1107). The deletion and substitution mutant plasmids p270
L2 and p270
L2-DES were constructed in a NE9-B2 background. The p270 pNNE3
ARID in vitro expression plasmid contains p270 base pairs 30714505 in the pGEM5Zf(+) vector, with deletion of base pairs 33563748. The translation product extends from residue 901 to 1376 with deletion of residues 9961126. The ARID1B in vitro expression plasmid KM15 contains DNA base pairs 20033972 generated by RTPCR from Saos2 cells. The sequence of the entire PCR product was verified according to accession no. NM_020732
[GenBank]
and numbered according to the cDNA sequence in accession no. AF253515
[GenBank]
. The translation product extends from residue 658 to 1313 (the ARID extends from residue 768 to 864). The dead ringer in vitro expression plasmid pDriT2 contains Dri sequences expressing residues 258410 inserted into the pSK-BBV expression vector (the ARID consensus extends from residue 277 to 369). The pSK-BBV vector (described in 19) is a derivative of Bluescript SKII+ engineered to contain black beetle virus ribosome binding sequences to promote more efficient translation in vitro. The SWI1 in vitro expression plasmid pSWI1.SZ is the TOPO vector construct containing the base pair 14712399 PCR fragment described above.
Other plasmids. The pBSII-
99 plasmid was described previously (20) and was kindly provided by A. Bank.
Generation of p270 amino acid substitution mutations
All mutations were generated using the QuikChange (Stratagene) system according to the manufacturers instructions. The forward primer used to generate the amino acid substitutions was DES (CCAACCTCAATGTGAGTG ACGCCAGCTCCTTGGAGAGCCAGTATATCCAG) (substituted bases underlined).
Deletion mutants were generated by a loop-out technique using a primer designed to form a junction between residues at the borders of the deletion. The sequences of the forward primers used to generate the deletions were
ARID (CCCAAGACAGAATCCAAATCCCAGCCCAAGATCCAGCCTCC) and
L2 (CAACCAACCTCAATGTGAGTGC TGCCAGCTCCTTG) (nucleotides that mark the boundaries of the loop are underlined).
The sequence changes and the integrity of the surrounding sequences for all mutants were verified by DNA sequencing.
Sequence-specific selection of DNA
GST fusion proteins were used in pull-down assays with the pools of DNA restriction fragments described in the text. The assay was performed as described in Collins et al. (17). Restriction fragments were filled in with [
-32P]dATP. Labeled DNA (0.8 µg) was incubated with 100 ng of GST fusion protein bound to glutathioneagarose beads for 1 h at 4°C in
DNA binding buffer [20 mM HEPES pH 7.6, 1 mM EDTA pH 8, 10 mM (NH4)2SO4, 0.2% Tween-20, 1 mM dithiothreitol (DTT), 25 µg/ml bovine serum albumin (BSA) and 25 µg/ml poly(dI·dC)] plus varying amounts of KCl, as indicated in the text. The beads were washed three times with
DNA binding buffer minus DTT, BSA and poly(dI·dC). Bound DNA was eluted by boiling in formamide loading buffer [90% formamide, 1x TBE (89 mM Tris base, 89 mM Boric acid, 2 mM EDTA), 0.04% bromophenol blue and 0.04% xylene cyanol], separated on a 6% sequencing gel and visualized by autoradiography.
In vitro translation and DNA cellulose chromatography
The wild-type and mutant plasmid constructs were used to generate [35S]methionine-labeled polypeptides using the TNT coupled reticulocyte system (Promega). In vitro translated proteins were diluted in 1 bed volume (0.5 ml) of column loading buffer (10 mM potassium phosphate pH 6.2, 0.5% NP40, 10% glycerol, 1 mM DTT, 1 mg/ml aprotinin, 1 mg/ml pepstatin and 1 mg/ml leupeptin) and applied to native DNAcellulose columns (Pharmacia). The protein sample was passed through the column four times. Unbound material is designated flow-through (FT). The columns were then washed multiple times with 1.0 bed volume column loading buffer containing 50 mM NaCl (these are the 50 mM wash fractions) and eluted stepwise with column loading buffer adjusted to contain increasing concentrations of NaCl from 100 to 800 mM, as indicated in the text. Fractions were analyzed by SDSPAGE. The signal on the dried gel was quantified using a phosphoimager (Fuji) and associated software.
| RESULTS |
|---|
|
|
|---|
p270 binds DNA without sequence specificity
p270 was originally identified as a protein sharing antigenic specificity with p300 and CBP (5,21). Analysis of p270-associated proteins revealed that p270 is a component of human SWI/SNF complexes and determination of the cDNA sequence suggested that p270 is an ortholog of yeast SWI1 (5,16). The presence of p270 in human SWI/SNF complexes was independently confirmed when a SWI/SNF complex-associated factor designated BAF250 was cloned and yielded a cDNA sequence co-linear with p270 (6). The p270/BAF250 cDNA is now designated the product of the ARID1A gene by the Nomenclature Committee of the Human Genome Organization.
We have previously shown by DNA affinity assays and PCR-amplified random oligonucleotide selection that p270 binds duplex DNA with high affinity, but without regard to sequence specificity (16). DNA binding without sequence preference is also a property of Osa, the closest Drosophila counterpart of p270 (17). The DNA-binding properties of p270 are illustrated here in a different approach, utilizing natural instead of synthetic DNA. GST fusion proteins were used to probe for preferential binding within a large pool of
DNA restriction fragments (Fig. 1). Control ARID family proteins Dri and MRF2 show selectivity in this assay, as they did in other approaches (13,15). Increasing the stringency of the interaction by adjusting the salt concentration results in increasingly more specific preference for selected fragments (lanes 57 and 810). In contrast, a p270 fusion binds the fragments with no obvious selectivity (lanes 24). Increasing stringency does not reveal a preference for specific fragments, except for eventual selection of longer fragments over shorter ones, probably because there are more binding surfaces on longer pieces of DNA.
|
Following our report on the non-selectivity of p270 in the PCR-amplified random oligonucleotide selection assay, Nie et al. (6) reported that p270/BAF250 binds selectively in an EMSA assay to a specific pyrimidine-rich sequence. A SWI/SNF-like complex called PYR had previously been identified by its ability to bind this 99 bp stretch of pyrimidine-rich DNA (95% pyrimidine on one strand), which lies between the human fetal and adult ß-globin genes (22) and is involved in regulation of the switch from fetal to adult expression. Nie et al. (6) proposed that p270/BAF250 is the component responsible for recruiting PYR to the
-globin gene through its ability to bind the
99 sequence. Simultaneously, though, the transcription factor Ikaros was identified as the PYR component that binds pyrimidine-rich DNA (20). Ikaros is not an ARID protein and has no detectable relationship to p270. While p270 has not been identified in the PYR complex, there is still the question whether p270 binds preferentially to pyrimidine-rich sequences in a manner that was not detected in the oligonucleotide selection assay. We therefore tested the ability of p270 to select the
99 sequence from a pool of restriction fragments generated from a
99-containing plasmid. p270 shows no selectivity for the 110 bp restriction fragment that contains the
99 sequence (Fig. 2A, lane 2). An alternative restriction digest in which the
99 sequence is released as part of a 332 bp fragment was also probed. Even with the advantage of greater length, the pyrimidine-rich fragment was not pulled down selectively by p270 (Fig. 2B). We conclude that p270 does not prefer pyrimidine-rich DNA or the
99 sequence specifically, but in fact binds DNA without regard to sequence. The previously reported preference for this sequence may have been a reflection of the EMSA assay in which a limited range of competing DNA sequences was used to challenge selectivity for the
99 sequence and the competing nucleotide fragments were shorter.
|
SWI1 has weaker DNA binding affinity than human ARID-containing SWI/SNF subunits
The yeast SWI/SNF complex binds to DNA without sequence specificity (3,23), but the source of the DNA-binding activity in the complex is not well characterized. The SWI1 protein as part of the complex crosslinks to DNA (3,4), but alone has not actually been shown to have DNA-binding activity. When we considered the question of whether SWI1 has sequence specificity we found that SWI1 does not bind well to DNA at all. This is shown in Figure 3. Most of the DNA was released by the 100 mM salt wash and there was no evidence of sequence selectivity. To explore this question and better understand the relationship between yeast and human SWI/SNF complexes, we compared the DNA-binding properties of SWI1 and the ARID-containing subunits of human SWI/SNF complexes. In addition to p270, a partial cDNA product of an independent gene has been identified, originally designated KIAA1235 (24), which has a high degree of overall identity to p270, including the presence of an ARID consensus (710). The Human Genome Organization now recommends that ARID family members carry gene designations that reflect their relationship. According to this scheme, the p270 gene product previously designated SMARCF1 is designated ARID1A and the KIAA1235 gene is designated ARID1B. p270 and ARID1B are alternative, mutually exclusive subunits of human SWI/SNF complexes (X. Wang, N.G. Nagl, Jr, M. Van Scoy, S. Pacchione, P.B. Dallas and E. Moran, in preparation). The relationships of p270 and ARID1B to their Drosophila and yeast counterparts are shown schematically in Figure 4.
|
|
The DNA binding affinity of the yeast and human ARID-containing SWI/SNF components was compared in a DNAcellulose column chromatography assay, an approach that is unbiased with regard to sequence specificity. 35S-labeled in vitro translated proteins were applied to a native DNAcellulose column and eluted with increasing salt concentrations. The fractions were separated by SDSPAGE and the protein signal was quantitated by phosphoimager. The signal in each fraction was plotted as a percentage of the total recovered (Fig. 5). What is immediately apparent in this assay is that p270 and ARID1B show the same high affinity binding as the prototypical ARID protein Dri, but SWI1 has markedly lower affinity for DNA. A control p270 ARID deletion construct (p270
ARID) verifies that the DNA-binding activity observed is a property of the ARID domain.
|
The SWI1 ARID is poorly conserved in the Loop 2 and H5 region
The ARID is a structurally distinct helixturnhelix motif based DNA-binding domain. Structures for three ARID proteins have been described: human MRF2, Drosophila Dri and yeast SWI1/ADR6 (18,2529). The ARID regions of these proteins are aligned in Figure 6. The ARID consensus forms six
-helices (H1H6). Dri has two additional
-helices (H0 and H7) formed by sequences immediately flanking the consensus. Flexible loops or ß-sheets also occur in the structure. NMR studies done on Dri and MRF2 in complex with DNA (25,27) have determined that two regions of the ARID are involved in minor groove and phosphodiester backbone interactions: the Loop 1/ß-sheet region and the C-terminus. An interaction point with the major groove was mapped to H5 and the loop preceding it. Sixteen DNA contact residues have been identified in Dri (27); these are indicated by red text in Figure 6. Generally similar contact regions were noted in MRF2, although individual contact residues were not identified (25). NMR of the SWI1 ARID shows that it contains the basic core of six
-helices (28,29). The SWI1 ARID structure was not determined in complex with DNA, so contact residues have not been identified.
|
A comparison of the SWI1 ARID sequence with p270, Dri and MRF2 does not reveal any obvious deficiency in the predicted minor groove and phosphodiester backbone interaction regions in Loop 1 or the C-terminus of the SWI1 ARID. Basic residues (R and K) are present in positions similar to those seen in p270. However, inspection of the sequence alignments in Figure 6 reveals potentially important differences in the predicted major groove interaction site formed by Loop 2 and H5. A more comprehensive comparison of the Loop 2 and H5 regions is shown in Figure 7. A sequence alignment of SWI1 with all known human, Drosophila and yeast ARID family members reveals that SWI1 is a highly unusual member of the family in terms of the length of Loop 2. Loop 2 varies in length by one or two residues among other ARIDs, but is notably shorter in SWI1. SWI1 is also unusual in the distribution of basic and acidic residues in H5. These are indicated by blue and pink shading, respectively in Figure 7. The invariant tyrosine (Y) in H5 is shaded yellow for orientation. A basic residue, R or K, exactly three positions 5' of this tyrosine is nearly invariant and is an identified DNA contact residue in Dri. SWI1 is one of a small subset of ARID proteins that has an acidic residue at or near this position. In the case of SWI1, this is a glutamic acid (E). SWI1 is the only ARID protein known that contains no basic residues between the beginning of Loop 2 and the invariant tyrosine. The lack of positively charged (basic) residues in this region, combined with the presence of negative charges from the acidic residues, very likely contributes to the poor affinity of SWI1 for DNA. The effect of the specific differences between SWI1 and p270 on DNA binding affinity was probed directly as described below.
|
The sequence differences in Loop 2 and H5 of SWI1 are sufficient to cause defective DNA binding in p270
To evaluate the effect of the specific differences between SWI1 and p270 on DNA binding affinity, site-directed mutagenesis was performed on p270 to mimic the sequence of SWI1. Four residues in Loop 2 of p270, corresponding to the missing residues in SWI1, were deleted. Additionally, three residues in H5 were changed to the corresponding SWI1 residues, as shown in Figure 8. These positions were chosen because they represent the most striking differences in the pattern of basic and acidic residues between the two proteins. The p270 mutant constructs were in vitro translated and their affinity for DNA was tested by DNAcellulose chromatography. The wild-type p270 and SWI1 elution profiles are repeated from Figure 5 for ease of comparison. Deletion of four residues from Loop 2 (p270
L2) is sufficient to weaken the DNA binding affinity of p270 (Fig. 9). These results are all consistent with the interpretation that Loop 2 makes a significant DNA contact that is lacking in SWI1. It is possible that the length of Loop 2 plays an important role in positioning DNA contact residues in Loop 2 and H5 properly on the DNA. The Loop 2 difference alone, however, is not sufficient to account entirely for the weak DNA binding of SWI1. When the H5 substitutions were introduced into p270 in addition to the Loop 2 deletion (p270
L2-DES) the DNA binding affinity of p270 was dramatically impaired and resembled more closely the phenotype of SWI1. The severe effect of these changes demonstrates the significance of the roles of the charged residues in H5. The remainder of the SWI1 ARID sequence may partly compensate for the differences between p270 and SWI1 in the Loop 2/H5 region, as the p270
L2-DES mutant is even more severely impaired in this assay than SWI1. Nevertheless, the overall conclusion is that the SWI1 ARID region has a weak DNA binding activity that on its own is not likely to be physiologically significant. Our results indicate that this is an intrinsic feature of the ARID sequence in SWI1, arising from an unusual difference in the length of Loop 2 and from the specific presence of acidic instead of basic amino acid residues at or near a major DNA contact site.
|
|
| DISCUSSION |
|---|
|
|
|---|
SWI1 is an unusual member of the ARID family of DNA-binding proteins. Other ARID family members differ in whether or not their binding is sequence specific, but all family members studied previously show high affinity binding to DNA. The weak DNA binding affinity of the SWI1 ARID is an intrinsic feature of its sequence, arising from specific variations in the major groove interaction site. The human counterparts of SWI1 do, however, bind DNA with an affinity typical of true DNA-binding proteins. This is not the only difference between yeast and human complexes, although the composition and subunit structure of yeast and human complexes are generally well conserved. While the yeast complex has only one ATPase and one ARID-containing protein, human complexes have two alternative ATPase subunits and alternative ARID-containing subunits. Human complexes also have an additional DNA-binding component that has no counterpart in yeast. This is the HMG-containing subunit BAF57, which binds selectively to four-way junction DNA (30). Drosophila complexes contain a counterpart to BAF57, designated BAP111 (31), so this is a consistent feature of higher eukaryotes. Human complexes that lack BAF57 are able to bind DNA and remodel chromatin in vitro (30), consistent with the fact that there are multiple DNA-binding subunits in the complex.
In spite of the weak DNA-binding activity of SWI1, the yeast SWI/SNF complex does bind DNA with high affinity. In early UV crosslinking experiments, three components were found crosslinked to naked DNA; SWI1 and two other components, p68 and p78, whose DNA-binding properties have not been further characterized (3). In a later study several other members were found to crosslink with nucleosomal DNA (4). These other components may account for the high affinity binding of the complex. The interaction of yeast SWI/SNF complexes with naked DNA is distamycin-sensitive and so appears to occur through minor groove interactions (3,23). This is consistent with our conclusion that the major groove contact region is not functionally conserved in the SWI1 ARID. The complex is not displaced by distamycin when bound to nucleosomes, indicating that other stabilizing interactions occur (23).
Yeast SWI1, Drosophila Osa and human p270 bind DNA without sequence specificity. Thus, the role of the ARID per se is not to recruit the complex to specific promoter elements. The exact biochemical role of the ARID family proteins in SWI/SNF complexes remains to be determined. Deletion of the ARID region of SWI1 does not affect the ability of yeast to grow in conditions that require a functional SWI/SNF complex or the ability of the yeast SWI/SNF complex to remodel nucleosomes in vitro (32). Nevertheless, the presence of a functional ARID in the ARID family components of the human and Drosophila complexes suggests that this domain has a physiological role in higher eukaryotes. There is experimental evidence that the ARID plays a role in the biological activity of p270 and ARID1B. Deletion of the ARID region of p270 partially reduces its ability to enhance glucocorticoid receptor-mediated transcription in a co- transfection reporter assay (6). Deletion of the ARID from ARID1B abrogates its activity in a similar assay (9). The differences between the complexes in yeast and higher eukaryotes emphasize that caution must be used in making direct comparisons between them.
| ACKNOWLEDGEMENTS |
|---|
We thank Michael Van Scoy, Dina Halegua and Damien Collins for excellent technical assistance and Arthur Bank, Robert Saint and Takahiro Nagase for gifts of plasmids. We are also grateful to Lois Maltais, Charles Grubmeyer, Dale Haines, Scott Shore, Carmen Sapienza, Xavier Graña-Amat and members of our laboratory for advice and discussions. This work was supported by PHS grant CA53592 (E.M.) from the NIH and a shared resources grant to the Fels Institute, CA88261. D.W. is the recipient of a DOD BCRP fellowship (DAMD-17-01-1-0407) and a Daniel Swern Fellowship from Temple University. A.P. is the recipient of a DOD BCRP fellowship (DAMD-17-02-1-0578).
| REFERENCES |
|---|
|
|
|---|
- Vignali,M., Hassan,A.H., Neely,K.E. and Workman,J.L. (2000) ATP-dependent chromatin-remodeling complexes. Mol. Cell. Biol., 20, 18991910.
[Free Full Text] - Martens,J.A. and Winston,F. (2003) Recent advances in understanding chromatin remodeling by Swi/Snf complexes. Curr. Opin. Genet. Dev., 13, 136142.[CrossRef][Web of Science][Medline]
- Quinn,J., Fyrberg,A.M., Ganster,R.W., Schmidt,M.C. and Peterson,C.L. (1996) DNA-binding properties of the yeast SWI/SNF complex. Nature, 379, 844847.[CrossRef][Medline]
- Sengupta,S.M., Van Kanegan,M., Persinger,J., Logie,C., Cairns,B.R., Peterson,C.L. and Bartholomew,B. (2001) The interactions of yeast SWI/SNF and RSC with the nucleosome before and after chromatin remodeling. J. Biol. Chem., 276, 1263612644.
[Abstract/Free Full Text] - Dallas,P.B., Cheney,I.W., Liao,D., Bowrin,V., Byam,W., Pacchione,S., Kobayashi,R., Yaciuk,P. and Moran,E. (1998) p300/CREB binding protein-related protein p270 is a component of mammalian SWI/SNF complexes. Mol. Cell. Biol., 18, 35963603.
[Abstract/Free Full Text] - Nie,Z., Xue,Y., Yang,D., Zhou,S., Deroo,B.J., Archer,T.K. and Wang,W. (2000) A specificity and targeting subunit of a human SWI/SNF family-related chromatin-remodeling complex. Mol. Cell. Biol., 20, 88798888.
[Abstract/Free Full Text] - Kato,H., Tjernberg,A., Zhang,W., Krutchinsky,A.N., An,W., Takeuchi,T., Ohtsuki,Y., Sugano,S., de Bruijn,D.R., Chait,B.T. and Roeder,R.G. (2002) SYT associates with human SNF/SWI complexes and the C-terminal region of its fusion partner SSX1 targets histones. J. Biol. Chem., 277, 54985505.
[Abstract/Free Full Text] - Hurlstone,A.F.L., Olave,I.A., Barker,N., van Noort,M. and Clevers,H. (2002) Cloning and characterization of hELD/OSA1, a novel BRG1 interacting protein. Biochem. J., 364, 255264.[CrossRef][Web of Science][Medline]
- Inoue,H., Furukawa,T., Giannakopoulos,S., Zhou,S., King,D.S. and Tanese,N. (2002) Largest subunits of the human SWI/SNF chromatin-remodeling complex promote transcriptional activation by steroid hormone receptors. J. Biol. Chem., 277, 4167441685.
[Abstract/Free Full Text] - Nie,Z., Yan,Z., Chen,E.H., Sechi,S., Ling,C., Zhou,S., Xue,Y., Yang,D., Murray,D., Kanakubo,E., Cleary,M.L. and Wang,W. (2003) Novel SWI/SNF chromatin-remodeling complexes contain a mixed-lineage leukemia chromosomal translocation partner. Mol. Cell. Biol., 23, 29422952.
[Abstract/Free Full Text] - Wilsker,D., Patsialou,A., Dallas,P.B. and Moran,E. (2002) ARID proteins: a diverse family of DNA binding proteins implicated in the control of cell growth, differentiation and development. Cell Growth Differ., 13, 95106.
[Abstract/Free Full Text] - Kortschak,R.D., Tucker,P.W. and Saint,R. (2000) ARID proteins come in from the desert. Trends Biochem. Sci., 25, 294299.[CrossRef][Web of Science][Medline]
- Gregory,S.L., Kortschak,R.D., Kalionis,B. and Saint,R. (1996) Characterization of the dead ringer gene identifies a novel, highly conserved family of sequence-specific DNA binding proteins. Mol. Cell. Biol., 16, 792799.[Abstract]
- Herrscher,R.F., Kaplan,M.H., Lelsz,D.L., Das,C., Scheuermann,C. and Tucker,P.W. (1995) The immunoglobulin heavy-chain matrix-associating regions are bound by Bright: a B cell-specific trans-activator that describes a new DNA-binding protein family. Genes Dev., 9, 30673082.
[Abstract/Free Full Text] - Whitson,R.H., Huang,T. and Itakura.K. (1999) The novel Mrf-2 DNA-binding domain recognizes a five-base core sequence through major and minor-groove contacts. Biochem. Biophys. Res. Commun., 258, 326331.[CrossRef][Web of Science][Medline]
- Dallas,P.B., Pacchione,S., Wilsker,D., Bowrin,V., Kobayashi,R. and Moran,E. (2000) The human SWI/SNF complex protein, p270, is an ARID family member with nonsequence-specific DNA binding activity. Mol. Cell. Biol., 20, 31373146.
[Abstract/Free Full Text] - Collins,R.T., Furukawa,T., Tanese,N. and Treisman,J.E. (1999) Osa associates with the Brahma chromatin remodeling complex and promotes the activation of some target genes. EMBO J., 18, 70297040.[CrossRef][Web of Science][Medline]
- Yuan,Y.C., Whitson,R.H., Liu,Q., Itakura,K. and Chen,Y. (1998) A novel DNA-binding motif shares structural homology to DNA replication and repair nucleases and polymerases. Nature Struct. Biol., 5, 959964.[CrossRef][Web of Science][Medline]
- Boyd,M.T., Vlatkovic,N. and Haines,D.S. (2000) A novel cellular protein (MTBP) binds to MDM2 and induces a G1 arrest that is suppressed by MDM2. J. Biol. Chem., 275, 3188331890.
[Abstract/Free Full Text] - ONeill,D.W., Schoetz,S.S., Lopez,R.A., Castle,M., Rabinowitz,L., Shor,E., Krawchuk,D., Goll,M.G., Renz,M., Seelig,H.P. et al. (2000) An ikaros-containing chromatin-remodeling complex in adult-type erythroid cells. Mol. Cell. Biol., 20, 75727582.
[Abstract/Free Full Text] - Dallas,P.B., Yaciuk,P. and Moran,E. (1997) Characterization of monoclonal antibodies raised against p300: both p300 and CBP are present in intracellular TBP complexes. J. Virol., 71, 17261731.[Abstract]
- ONeill,D., Yang,J., Erdjument-Bromage,H., Bornschlegel,K., Tempst,P. and Bank,A. (1999) Tissue-specific and developmental stage-specific DNA binding by a mammalian SWI/SNF complex associated with human fetal-to-adult globin gene switching. Proc. Natl Acad. Sci. USA, 96, 349354.
[Abstract/Free Full Text] - Cote,J., Peterson,C.L. and Workman,J.L. (1998) Perturbation of nucleosome core structure by the SWI/SNF complex persists after its detachment, enhancing subsequent transcription factor binding. Proc. Natl Acad. Sci. USA, 95, 49474952.
[Abstract/Free Full Text] - Nagase,T., Ishikawa,K., Kikuno,R., Hirosawa,M., Nomura,N. and Ohara,O. (1999) Prediction of the coding sequences of unidentified human genes. XV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res., 6, 337345.[Abstract]
- Zhu,L., Hu,J., Lin,D., Whitson,R., Itakura,K. and Chen,Y. (2001) Dynamics of the Mrf-2 DNA binding domain free and in complex with DNA. Biochemistry, 40, 91429150.[CrossRef][Medline]
- Iwahara,J. and Clubb,R.T. (1999) Solution structure of the DNA binding domain from Dead ringer, a sequence-specific AT-rich interaction domain (ARID). EMBO J., 18, 60846094.[CrossRef][Web of Science][Medline]
- Iwahara,J., Iwahara,M., Daughdrill,G.W., Ford,J. and Clubb,R.T. (2002) The structure of the Dead ringerDNA complex reveals how AT-rich interaction domains (ARIDs) recognize DNA. EMBO J., 21, 11971209.[CrossRef][Web of Science][Medline]
- Tu,X., Xiao,Y., Zeng,W. and Shi,Y. (2000) Expression and purification of a recombinant DNA-binding domain of ADR6 protein from Escherichia coli and its secondary structure characterization. Biochim. Biophys. Acta, 1481, 167174.[CrossRef][Medline]
- Tu,X., Wu,J., Xu,Y. and Shi,Y. (2001) 1H, 13C and 15N resonance assignments and secondary structure of ADR6 DNA-binding domain. J. Biomol. NMR, 21, 187188.[CrossRef][Web of Science][Medline]
- Wang,W., Chi,T., Xue,Y., Zhou,S., Kuo,A. and Crabtree,G.R. (1998) Architectural DNA binding by a high-mobility-group/kinesin-like subunit in mammalian SWI/SNF-related complexes. Proc. Natl Acad. Sci. USA, 95, 492498.
[Abstract/Free Full Text] - Papoulas,O., Daubresse,G., Armstrong,J.A., Jin,J., Scott,M.P. and Tamkun,J.W. (2001) The HMG-domain protein BAP111 is important for the function of the BRM chromatin-remodeling complex in vivo. Proc. Natl Acad. Sci. USA, 98, 57285733
[Abstract/Free Full Text] - Prochasson,P., Neely,K.E., Hassan,A.H. Li,B. and Workman,J.L. (2003) Targeting activity is required for SWI/SNF function in vivo and is accomplished through two partially redundant activator-interaction domains. Mol. Cell, 12, 983990.[CrossRef][Web of Science][Medline]
- Le Douarin,B., Nielsen,A.L., Garnier,J.M., Ichinose,H., Jeanmougin,F., Losson,R. and Chambon P. (1996) A possible involvement of TIF1 alpha and TIF1 beta in the epigenetic control of transcription by nuclear receptors. EMBO J., 15, 67016715.[Web of Science][Medline]
- Heery,D.M., Kalkhoven,E., Hoare,S. and Parker,M.G. (1997) A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature, 387, 733736.[CrossRef][Medline]
- Seipel,K., Georgiev,O. and Schaffner,W. (1992) Different activation domains stimulate transcription from remote (enhancer) and proximal (promoter) positions. EMBO J., 11, 49614968.[Web of Science][Medline]
- Depiereux,E., Baudoux,G., Briffeuil,P., Reginster,I., DeBolle,X., Vinals,C. and Feytmans,E. (1997) Match-Box_server: a multiple sequence alignment tool placing emphasis on reliability. Comput. Appl. Biosci., 13, 249256.
[Abstract/Free Full Text] - Kim,S., Zhu,L., Yu,B. and Chen,Y. (2003) Letter to the editor: Assignment of 1H, 13C and 15N resonances of the ARID domain of p270. J. Biomol. NMR, 27, 227278.
This article has been cited by other articles:
![]() |
K. W. Trotter, H.-Y. Fan, M. L. Ivey, R. E. Kingston, and T. K. Archer The HSA Domain of BRG1 Mediates Critical Interactions Required for Glucocorticoid Receptor-Dependent Transcriptional Activation In Vivo Mol. Cell. Biol., February 15, 2008; 28(4): 1413 - 1426. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Huarte, F. Lan, T. Kim, M. W. Vaughn, M. Zaratiegui, R. A. Martienssen, S. Buratowski, and Y. Shi The Fission Yeast Jmj2 Reverses Histone H3 Lysine 4 Trimethylation J. Biol. Chem., July 27, 2007; 282(30): 21662 - 21670. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kim, L. Probst, C. Das, and P. W. Tucker REKLES Is an ARID3-restricted Multifunctional Domain J. Biol. Chem., May 25, 2007; 282(21): 15768 - 15777. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Wang, L.-H. Su, and C.-H. Sun A Novel ARID/Bright-like Protein Involved in Transcriptional Activation of Cyst Wall Protein 1 Gene in Giardia lamblia J. Biol. Chem., March 23, 2007; 282(12): 8905 - 8914. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Patsialou, D. Wilsker, and E. Moran DNA-binding properties of ARID family proteins Nucleic Acids Res., January 7, 2005; 33(1): 66 - 80. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










