Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (366K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Kozaki, A.
Right arrow Articles by Colasanti, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kozaki, A.
Right arrow Articles by Colasanti, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published online 12 March 2004

Nucleic Acids Research, 2004, Vol. 32, No. 5 1710-1720
© 2004 Oxford University Press

The maize ID1 flowering time regulator is a zinc finger protein with novel DNA binding properties

Akiko Kozaki1, Sarah Hake1 and Joseph Colasanti*,1,2

1 Department of Plant and Microbial Biology, University of California, Berkeley, and the Plant Gene Expression Center, Albany, CA 94720, USA and 2 Department of Molecular Biology and Genetics, University of Guelph, Guelph, Ontario N1G 2W1, Canada

*To whom correspondence should be addressed. Tel: +1 519 824 4120 ext. 58052; Fax: +1 519 837 2075; Email: jcolasan{at}uoguelph.ca

Received December 20, 2003; Revised February 10, 2004; Accepted February 19, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The INDETERMINATE protein, ID1, plays a key role in regulating the transition to flowering in maize. ID1 is the founding member of a plant-specific zinc finger protein family that is defined by a highly conserved amino sequence called the ID domain. The ID domain includes a cluster of three different types of zinc fingers separated from a fourth C2H2 finger by a long spacer; ID1 is distinct from other ID domain proteins by having a much longer spacer. In vitro DNA selection and amplification binding assays and DNA binding experiments showed that ID1 binds selectively to an 11 bp consensus motif via the ID domain. Unexpectedly, site-directed mutagenesis of the ID1 protein showed that zinc fingers located at each end of the ID domain are not required for binding to the consensus motif despite the fact that one of these zinc fingers is a canonical C2H2 DNA binding domain. In addition, an ID1 in vitro deletion mutant that lacks the extra spacer between zinc fingers binds the same 11 bp motif as normal ID1, suggesting that all ID domain-containing proteins recognize the same DNA target sequence. Our results demonstrate that maize ID1 and ID domain proteins have novel zinc finger configurations with unique DNA binding properties.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The C2H2-type zinc fingers are among the best characterized DNA binding proteins of eukaryotic transcription factors and have been shown to play important roles in specific development processes (1,2). The canonical C2H2-type zinc finger motif is typified by the amino acid sequence F/Y-X-C-X2-5-C-X3-F/Y-X5-{Psi}-X2-H-X3-5-H, where X represents any amino acid and {Psi} is a hydrophobic residue. Two cysteine (C) and two histidine (H) residues tetrahedrally coordinate a zinc ion to form a compact structure containing two ß-sheets and an {alpha}-helix (ßß{alpha}) that interacts with the major groove of DNA in a sequence-specific manner (3,4). Each C2H2-type zinc finger motif consists of a module of approximately 30 amino acids that recognizes a triplet of double-stranded DNA (dsDNA). In animals, multiple zinc finger modules are linked in tandem arrays, with each finger separated by a conserved short sequence of seven amino acids known as the H/C link. In these cluster-type zinc finger proteins key amino acid residues in the {alpha}-helix of each finger interact with a triplet of base pairs (5,6).

In plants, the C2H2 class of zinc finger proteins is one of the largest families of transcription factors to be identified, although they appear to not be as prevalent as C2H2 proteins in animals (7,8). Genetic and functional analyses of various genes that encode plant zinc finger proteins show that many are involved in diverse biological processes. Among plant C2H2-type zinc fingers, the DNA binding activity of the petunia EPF protein family has been characterized to the greatest extent. The EPF family differs from most C2H2-type zinc fingers found in animal and yeast cells by the presence of amino acid spacers of various lengths between zinc fingers (1–65 amino acids) and by the signature QALGGH motif (9). EPF proteins were reported to recognize two separate AGT core sequences; presumably, each separate finger binds an AGT triplet. The distance between the zinc finger domains appears to dictate the amount of space between the binding site and, therefore, the identity of the core target sequence (10,11). Mutagenesis analysis has demonstrated that the conserved QALGGH sequence is critical for DNA binding activity of EPF proteins and that at least two zinc finger domains are necessary for this interaction (11,12). Recently, the QALGGH-containing EPF-like protein with a single C2H2-type zinc finger encoded by SUPERMAN, an Arabidopsis flower development gene, was reported to have specific DNA binding activity (13).

Another class of plant C2H2-type zinc finger proteins that lacks the QALGGH motif was identified and shown to regulate important plant processes such as flowering time, gametophyte formation and leaf development. The maize INDETERMINATE1 gene, id1 (14), and the Arabidopsis TRANSPARENT TESTA1 gene, TT1 (15), each contain at least two zinc fingers. Other Arabidopsis proteins, FERTILIZATION-INDEPENDENT SEED 2, FIS2 (16), EMBRYONIC FLOWER2, EMF2 (17) and VERNALIZATION2, VRN2 (18), each have single C2H2 zinc fingers that show significant homology with Su(z)12, a Drosophila polycomb group gene (19). Similarly, the Arabidopsis SERRATE gene (SE1) also contains a single zinc finger that may function through chromatin modification (20).

Genetic analysis and expression studies demonstrated that the id1 gene plays a key role in regulating the transition from vegetative to reproductive growth in maize by controlling the production or transmission of leaf-derived floral inductive signals (14,21). The ID1 protein defines a new family of zinc finger proteins, termed ID-like proteins, which are found in all higher plants. The ID domain, a highly conserved stretch of amino acids common to all ID-like proteins, was originally described as having two typical C2H2 and C2HC zinc finger motifs (14). Visual inspection of the deduced ID1 amino acid sequence reveals two additional atypical zinc fingers in the ID domain.

As a prelude to the identification of target genes regulated by ID1 we present here a detailed study of the target binding site specificity and the DNA binding activity of ID1. Using in vitro analysis techniques we show that the ID domain recognizes and specifically interacts with a contiguous 11 bp sequence. We also describe an unusual feature of ID1 interaction with DNA in which an additional T residue at the –1 position of the consensus facilitates ID1 interaction with sequences that differ slightly from the defined 11 bp consensus motif. Mutation analysis of the ID1 protein revealed that only the C2HC finger domain and an adjacent putative zinc finger are essential for recognizing the target sequence. The other zinc finger domains, although highly conserved in all ID domain proteins, are not required for interaction with the consensus motif. We also show that variations in spacing between zinc fingers in ID1 and ID-like family proteins do not alter DNA binding specificity. These results reveal that ID domain proteins exhibit novel DNA binding characteristics that do not conform entirely to standard rules for zinc finger–DNA interaction.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of deletion mutants of ID1, VEG7 and VEG9
Fragments of deletion mutants of ID1 were amplified by PCR using full-length id1 cDNA in pBluescriptSK vector (pBSK–; Stratagene) as a template. The conserved region of the ID1 protein (ID domain; amino acid residues 67–254) was amplified by PCR using forward primer IDKRKRF (5'-GCGGATCCAAGAGGAAGAGAAGCCAGCCG-3') and reverse primer IDSART7 (5'-GCCTCGAGTCAACCCA TTTGCTGTCCACCAGTCATGCTAGCCATCCTCGCGCTC TCCTC-3'). The deletion fragment encoding the N-terminal 232 amino acid residues (Z4del) was amplified using forward primer IDEcoRIF (5'-GCGAATTCATGCAGATGATGA TGCTCTC-3') and reverse primer Z4delT7 (5'-CTCGAG TCAACCCATTTGCTGTCCACCAGTCATGCTAGCCATGA AGAAGAGGATGCCGCA-3'). Primers IDKRKRF and IDEcoRIF have BamHI and EcoRI sites, respectively (underlined), and IDSART7 and Z4delT7 have XhoI sites (underlined), a stop codon (bold) and a T7-tag sequence (italics).

Three PCR steps were used to amplify the fragment of IDdel1 (the deletion mutant lacking the insertion between zinc fingers). Forward primer IDEcoRIF and reverse primer IDdel1R (5'-GACGCGCTTCGGGACGACGAGGCTGCT-3') were used in the first PCR amplification. In the second PCR, forward primer IDdel1F (5'-GTCGTCCGGAA GCGCGTCTACGTC-3') and reverse primer IDXhoR (5'-GCCTCGAGCTAGAAGTTGTGGCTCCAGGTC-3') were used. IDXhoR contains an XhoI site (underlined) and stop codon (bold). In the first and second PCR steps full-length id1 cDNA was used as a template. The first and second PCR products were purified by electrophoresis on 1% agarose gel and extracted from the gel using QIAEX II (Qiagen). The mixture containing the first and second PCR products was used as a template for the final PCR, which was performed using forward primer IDEcoRIF and reverse primer IDSART7.

Full-length cDNA clones for VEG7 or VEG9, cloned into the pBSK vector, were used as templates for amplification of VEG7 and VEG9 fragments. The VEG7 fragment was amplified using forward primer VEG7KKKRBF (5'-GCGGATCCAAGAAGAAGAGGAACCAG-3') and reverse primer VEG7SAQT7 (5'-GCCTCGAGTCAACCCATTTG CTGTCCACCAGTCATGCTAGCCATCTGCGCGCTCTCA CG-3'), and the VEG9 fragment was amplified using forward primer VEG9BF (5'-GCGGATCCATGGCATCGAATTCA TCG-3') and reverse primer VEG9SART7 (5'-GTCG ACTCAACCCATTTGCTGTCCACCAGTCATGCTAGCCAT GCGCGCGCTTTCCTG-3'). VEG7KKKRBF and VEG9BF have a BamHI site (underlined). VEG7SAQT7 and VEG9SART7 have XhoI and SalI, respectively (underlined), a stop codon (bold) and T7-tag sequence (italics). The fragment for VEG7 contains the ID domain only and the fragments for IDdel1 and VEG9 contain the ID domain with 49 extra amino acids of the N-terminal region because expression of the ID domain alone in Escherichia coli was not successful.

PCR was performed for 35 cycles (10 s at 96°C, 30 s at 55°C and 2 min at 72°C) using Pfu turbo or Herculase Enhanced DNA polymerase (Stratagene). The final PCR products were purified and cloned into the pCR-Blunt vector (Invitrogen) and sequenced.

Construction of expression vectors
To construct the plasmid for the expression of glutathione S-transferase (GST)–ID1 fusion protein the BamHI–XhoI fragment from id1 cDNA in pBSK was inserted into the BamHI–XhoI site of pGEX-4T (Pharmacia). The BamHI site is inside the id1 coding region (52 bp from the translation start) and the XhoI site is in the multi-cloning site of the pBSK vector. The expression vectors for other GST fusion proteins, except the vector for VEG9, Z3M and Z4M expression, were constructed by inserting BamHI–XhoI fragments into the BamHI–XhoI site of pGEX-4T. The expression vector for GST–VEG9 NZ was constructed by insertion of the BamHI–SalI fragment into the BamHI–SalI site of pGEX-4T and EcoRI–XhoI fragments of Z3M (C164A,C169A) and Z4M (C226A,C228A) were inserted into the EcoRI–XhoI site of pGEX-4T.

Expression and purification of recombinant proteins
Escherichia coli BL21 CodonPlus-RP cells (Stratagene) were transformed with the expression vectors and grown in LB medium at 37°C until the absorbance A600 reached 0.6; at this point isopropyl ß-D-thiogalactopyranoside (IPTG) inducer was added to a final concentration of 0.3 mM and the culture was grown for an additional 14 h at 20°C. The cells were harvested and suspended in a 1/50 to 1/100 culture volume of 1x PBS (40 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.3) with 5 mM DTT and protease inhibitor cocktail (Sigma). The cells were disrupted by sonication and the lysate was centrifuged at 16 000 g for 20 min at 4°C. The fusion protein was allowed to bind to the glutathione–Sepharose 4B (Pharmacia) for 1 h at 4°C. The glutathione–Sepharose was washed four times with 1x PBS and proteins were eluted with elution buffer (50 mM Tris–HCl, pH 8, 10 mM reduced glutathione and 100 mM NaCl).

Selection and amplification binding (SAAB) assay
The GST–ID1 fusion protein (~10 µg) was immobilized on 100 µl of glutathione–Sepharose 4B resin or 20 ul of Dynabeads ProteinG (DYNAL) coupled with anti-ID1 protein-specific antibody (5 µg). Affinity-purified anti-ID1 antibody was generated in rabbits immunized with a 20 amino acid peptide that corresponds to the C-terminus of the deduced ID1 protein coupled to Keyhole Limpet Hemaocyanin. Resins were washed with 1x PBS three times, and suspended in 300 µl of binding buffer P {10 mM Tris–HCl (pH 7.5), 75 mM NaCl, 1 mM DTT, 6% glycerol, 1% BSA, 1% Nonidet P-40, poly[d(I,C)] and 10 µM ZnCl}. The suspension was divided into six portions and one portion was used for each round of selection. In the first round, one portion of protein mixture was incubated with 20 pmol of randomly synthesized DNA for 3 h at 4°C.

A library of randomly synthesized DNA, a gift from Dr Harley Smith (University of California, Berkeley), was used as described to identify binding sites for the maize KNOTTED protein (22). Bound DNA was eluted in 50 µl of H2O by boiling for 10 min after washing the resin six times with washing buffer (15 mM Tris–HCL, pH7.5, 75 mM NaCl, 0.15% Triton X-100 and 1% BSA) and then twice with washing buffer without BSA. For each step, 10 µl of eluted DNA was amplified by 15 cycles of PCR (10 s at 96°C, 30 s at 52°C and 1 min at 72°C) using forward primer SAABHAND-F (5'-GAGAGGATCCAGTCAGCATG-3') and reverse primer SAABHAND-R (5'-TGTCGAATTCTCGAGGCTGAG-3'). The 10 µl of PCR products were subjected to the second selection. After six cycles of selection, populations of DNA were cloned into the pCR Blunt vector and sequenced.

Electromobility shift assays (EMSAs)
For EMSA experiments, 5'-end biotin-labeled probes were made with biotin-labeled SAABHAND-F and -R primers. For the binding test of the SAAB-selected sequence, insertions in pCR-blunt vector were amplified using these primers. To produce mutant probes, oligonucleotides of the desired sequence were synthesized and dsDNAs were synthesized and amplified by PCR using biotin-labeled SAABHAND-F and -R primers. In the reaction, 100 ng of partially purified protein was incubated for 30 min on ice with 30–50 fmol of the labeled probes in binding buffer, as used in the SAAB assay. After incubation, the mixture was loaded on a 6% polyacrylamide gel (acrylamide/bisacrylamide, 29:1) and run in 0.25x Tris-borate–EDTA buffer at 4°C. DNA–protein complexes were transferred to a Hybond-N+ membrane (Amersham) and detected with a LightShift Chemilumines cent EMSA kit (Pierce). Approximate quantification of DNA–protein interactions were assessed by intensity of the shifted bands determined with the NIH Image analysis program.

Site-directed mutagenesis
Site-directed mutagenesis was introduced by three-step PCR, using the same protocol as described above. Full-length id1 cDNA was used as template in the first and second PCR amplifications. In the first PCR, the forward primer IDEcoRIF and reverse primers containing the desired mutation were used. In the second PCR, the forward primers, the complement sequence of the reverse primer, and reverse primer ID XhoR were used. The first and second PCR products were purified and this mixture was used as a template for the final PCR. Final PCR for Z3M (C164A,C169A) and Z4M (C226A,C228A) was performed using forward primer 6HKRKRF (5'-GCGAATTCATGCACCACCACCACCACC ACAAGAGGAAGAGAAGCCAG-3') and reverse primer SARstop (5'-GCCTCGAGCTACCTGGCGCTCTCCTCT GC-3'). EcoRI and XhoI, respectively, are underlined, 6HKRKF has 6x His (italics) and SARstop has a stop codon (bold). For amplification of Z1M (C98A,C101A) and Z2M (C199A,C202A), primers IDEcoRIF and SARstop were used because GST fusion proteins of these mutants with the ID domains alone could not be expressed in E.coli. PCR was performed as described above and the final products were inserted into the pCR-Blunt vector and confirmed by sequences analysis.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The maize ID1 protein binds to a specific DNA sequence
BLAST analysis of the maize id1 gene indicated that the deduced ID1 protein contains two zinc fingers similar to the Drosophila Krüppel-like zinc fingers—a C2H2 finger and the less prevalent C2HC zinc finger (14). The presence of zinc finger motifs and the localization of ID1 protein to the nucleus (J. Colasanti, unpublished results) suggest that ID1 binds DNA and acts as a transcriptional regulator. Full-length ID1 was fused with GST and the recombinant protein was used for a SAAB assay to determine whether ID1 protein recognizes and interacts with a particular DNA sequence. The GST–ID1 fusion protein was immobilized and used to select DNA sequences that specifically bind ID1 from a population of dsDNA oligonucleotides containing 20 bp of random sequences. After several rounds of capture by the protein complex followed by PCR amplification, 38 clones were isolated and sequenced (see Materials and Methods).

The MEME motif identification program (Multiple Em for Motif Elicitation; http://meme.sdsc.edu/meme/website/meme.html) identified an 11 bp consensus motif that was prominent in 19 out of the 38 SAAB-selected clones (Fig. 1A). To determine whether ID1 interacts with this 11 bp motif an EMSA was performed with each of the 19 sequences using GST–ID1 fusion protein. The ID1 protein bound to 16 out of the 19 MEME-selected sequences with varying affinities. Three clones (clones 21, 42 and 45) did not bind to the GST–ID1 fusion protein (Fig. 1A). No shifted bands were detected in reactions with GST protein alone (data not shown). A consensus motif based on the binding activity and frequency of nucleotide utilization was derived (Fig. 1B).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Determination of DNA sequences bound by ID1 protein. (A) Sequences of oligonucleotides selected by SAAB and identified by MEME analysis. (B) Consensus sequence determined from the binding sequences in (A). (C) SAAB-selected sequences that were not selected by MEME analysis but which showed binding to ID1. Sequences are aligned and oriented to match the consensus sequences. Binding ability was tested by EMSA in which a constant amount of protein was used in each binding reaction. The approximate percentage of bound probe in each reaction was used to characterize the relative binding affinities, as indicated with +++, ++, + and (+) corresponding to reactions in which >70, 40–70, 10–40 and <10% of the probe was bound, respectively. Flanking primer sequences are indicated with lower case letters.

 
The remaining 19 sequences derived from the SAAB assay, but not selected by MEME analysis, were screened individually by EMSA; five of these sequences were found to bind to ID1 (Fig. 1C). These oligonucleotide probes all contained the sequence, TTTTGTCG/C, which matches 7 bp of the 11 bp consensus motif. A common feature of this motif is a T residue in the –1 position; the significance of this finding is discussed below.

To further define the binding specificity of the ID1 protein we identified the essential core motif by scanning mutation of the 11 bp consensus sequence. As shown in Figure 2A, replacement of any single base in the 11 bp consensus sequence by a non-consensus base completely abolished, or severely reduced, binding. Competition experiments with unlabeled mutant probes versus labeled wild-type probe further supported these results (data not shown). These findings confirm the binding test of selected sequences (Fig. 1A), where a perfect consensus showed very strong binding, and any variation from the consensus showed weaker binding, or the inability to bind, to ID1 protein.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Ability of GST–ID1 fusion protein to bind mutant variants of the consensus motif. (A) EMSA using single base mutant probes. (B) EMSA using single base mutant probes that have additional Ts at position –1 and –2. Mutated bases are shown as boxed lower case letters. The sequences of the probes are shown under the panels. An arrowhead indicates the ID1/DNA complex. Less intense lower bands are not associated with the specific shifted bands. Relative binding affinity of each probe was compared with that of consensus sequence (WT: TTTGTCGTATT) and indicated with +++, ++ + and (+) corresponding to >70, 40–70, 10–40 and <10% of the binding to the WT consensus sequence.

 
Sequences outside the 11 bp DNA consensus motif affect ID1 binding
As described above, an exception to the binding specificity of the 11 bp consensus was the 8 bp motif TTTTGTCG/C found in five probe sequences but not identified by MEME (Fig. 1C). A common feature of these five probes was an additional T residue at the 5' end (the –1 position). SAAB-selected sequences 16, 13 and 19, which contain a non-consensus G at positions 9, 11 and 8, respectively, showed relatively strong binding to ID1. In contrast, scanning mutation experiments with the 11 bp consensus motif without the T at –1 showed that base changes in these same positions severely reduced binding.

To test the possibility that an extra T residue 5' of the 11 bp consensus can alter ID1 binding specificity, the scanning mutation experiment was repeated with mutant probes containing Ts in the –1 and –2 positions and a series of single nucleotide replacements at positions 3–8 (Fig. 2B). Surprisingly, most mutant probes showed binding affinity that was comparable to, or slightly lower than, binding to the 11 bp consensus motif. Only mutations in consensus positions 3, 4 and 6 (TT-M3, TT-M4 and TT-M6) showed weak or no binding to ID1 (Fig. 2B). Probes with mutations at positions 1 and 2 also showed comparable binding to the consensus sequence (data not shown). Similar base changes in the 11 bp consensus sequence alone showed very weak or no binding to ID1 (Fig. 2A). Competition experiments showed that a T residue at the –1 position of the 11 bp consensus sequence does not simply increase the binding affinity of ID1 for this sequence above that of the consensus motif without a T residue in the 5' position (data not shown). Rather, a T residue at the –1 position specifically enables ID1 to bind variants of the consensus motif with less stringent requirements for interaction.

Both typical and putative novel zinc fingers in the ID domain interact with DNA
ID1 defines a family of zinc finger proteins that are unique to plants (J. Colasanti, K. Briggs, M. Muszynski, R.Tremblay and A. Kozaki, unpublished results). The Arabidopsis genome has 16 id-like genes, and we have isolated 4 id-like cDNAs from maize, in addition to the id1 gene (14). The ID domain, a stretch of approximately 170 amino acids, begins with a putative nuclear localization signal and contains two BLAST-identified zinc fingers, Z1 and Z2 (Fig. 3A). The highly conserved ID domain is common to all ID-like proteins and is a defining feature of the ID-like protein family. Figure 3 shows an alignment of the ID domains of ID1 and two maize ID-like proteins, VEG7 and VEG9. Note that an additional 23–25 amino acids between zinc fingers distinguishes maize ID1 from most ID family proteins examined so far (see below).



View larger version (53K):
[in this window]
[in a new window]
 
Figure 3. Sequence alignment of ID domain and comparison of structure of Z4 to the third zinc finger of SWI5. (A) Amino acid sequence alignment of ID domains of ID1, VEG7 and VEG9. (B) The structure of the Z4 region in (A) is compared with that of the third zinc finger of SWI5. Conserved C and H residues are boxed and conserved amino acids are shaded. Numbers on the sequence indicate the amino acid number of ID1 protein; the entire ID1 protein is 436 amino acids. Asterisks indicate the conserved hydrophobic residues in zinc fingers. Dots indicate the sequence homologous to the H/C link and the double underline indicates putative nuclear localization signal. Each zinc finger region or zinc finger-like region is underlined.

 
In addition to Z1 and Z2, visual examination of the ID domain revealed two other potential zinc finger domains that were not identified by BLAST similarity searches. One putative zinc finger, designated Z3, is located between Z1 and Z2, and another potential zinc finger motif, Z4, is downstream of Z2 (Figs 4 and 5A). The Z3 sequence contains two conserved cysteines (C164 and C169) and two histidines (H187 and H192), however, the 17 amino acids between C169 and H187 differ from the 12 residues found in typical C2H2 zinc fingers (5). The six amino acid sequence immediately upstream of C199 in Z2 is similar to the H/C link motif, an amino acid spacer that separates modules in cluster-type zinc finger proteins. H/C links often contain the sequence TGEKP, therefore the sequence GEKRWC between Z3 and Z2 could be a putative H/C link (23).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Analysis of the DNA binding function of each putative zinc finger motif. (A) Schematic diagram of mutant proteins used in EMSA experiments. Structure of the ID domain common to all ID-like family proteins is shown on top. Zinc fingers (Z1 and Z2) and putative zinc fingers (Z3 and Z4) are indicated as hatched boxes. C and H indicate cysteines and histidines that define putative zinc fingers. Numbers indicate the amino acid position of C and H residues of the ID1 protein. A black box indicates the position of a putative nuclear localization signal. (B) DNA binding of wild-type and mutant proteins in which each putative zinc finger was disrupted. Mutant proteins (as GST fusions) were incubated with biotin-labeled consensus sequences (WT: TTTGTCGTATT). Arrowheads indicate the complex of proteins and probes. (C) Preparation of the partially purified mutant proteins used in (B). Proteins were separated by SDS–PAGE and stained with Coomassie Brilliant Blue. Arrows show the positions of full-length GST fusion proteins, indicating that they essentially are intact and present in similar concentrations. Molecular-weight markers (M) are shown on the left (kDa).

 


View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. DNA binding of deletion mutants of ID and maize ID-like proteins VEG7 and VEG9. (A) Summary of binding of deletion mutant and ID-like proteins. Relative binding affinity of each probe to each protein was compared with binding to the consensus motif (WT: TTTGTCGTATT) and indicated with +++, ++, + and (+), corresponding to >70, 40–70, 10–40 and <10% of the binding to WT (m19 sequence). (B) EMSA showing some of the DNA/protein complexes with several of the probes in (A).

 
The other candidate, Z4, is a potential C2HC zinc finger that contains cysteines (Cys226, Cys228 and Cys245), a histidine (His241) and hydrophobic residues in positions that conform to the rules for C2H2 zinc fingers (Fig. 3A). Moreover, the structure of Z4 is similar to the third zinc finger of the yeast SWI5 transcription factor which also has the unusual feature of a single amino acid separating Cys226 and Cys228 (Fig. 3B) (24). Overall, the four putative zinc finger domains are highly conserved among all ID-like family members analyzed so far, with >80% amino acid identity (Fig. 3A and J. Colasanti, K. Briggs, M. Muszynski, R.Tremblay and A. Kozaki, unpublished results).

The addition of metal chelators such as EDTA and 1,10-phenanthroline abolished the shifted band ID1–DNA complex in EMSA experiments, indicating that the DNA binding ability of ID1 protein is zinc dependent (data not shown). In most cluster-type C2H2 zinc fingers in animals, and EPF-type zinc fingers in plants, each finger domain has been shown to recognize a triplet of base pairs (9,23). If the general rule of one zinc finger module binding a triplet of DNA is applied here, then ID1 would require three or four zinc fingers in its DNA binding domain to recognize an 11 bp target site.

To further characterize the mode of DNA binding by ID1, we determined whether the ID domain alone mediates specific DNA binding. A recombinant, partially purified GST–ID domain fusion protein was used for EMSA. As shown in Figure 4B, the ID domain of ID1 binds to the 11 bp consensus motif and showed the same specificity in binding to mutant probes as does the full-length ID1 protein, suggesting that the ID domain is sufficient for mediating specific DNA binding.

The contribution to DNA binding made by zinc fingers Z1 and Z2, as well as Z3 and Z4 motifs, was tested by disrupting each putative zinc finger and determining if the mutant ID domains could recognize the consensus sequence. Zinc fingers were disrupted by replacing the first cysteine pair of each module with two alanine residues; i.e. Z1M (C98A,C101A), Z2M (C199A,C202A), Z3M (C164A,C169A) and Z4M (C226A,C228A) represent ID domain proteins with mutant versions of Z1, Z2, Z3 and Z4, respectively (Fig. 4A). Mutant expression constructs consisted of the ID domain (amino acids 67–254) fused to GST, except for Z1M and Z2M, which could not be expressed in E.coli. Expression of these mutant proteins in E.coli required that a slightly longer region (amino acids 18–254) be used for adequate levels of expression (Fig. 4C). This longer protein shows the same binding properties as full-length wild-type ID1 or ID domain only protein (data not shown).

The results in Figure 4B show that mutating the first two cysteines of zinc fingers Z2 or Z3 (Z2M and Z3M, respectively) abolished the binding activity of the ID domain, indicating that functional versions of each of these zinc fingers are required for binding the consensus motif. Unexpectedly, ID domain proteins with mutant Z1 or Z4 zinc fingers (Z1M and Z4M, respectively) retained DNA binding activity that was comparable with the wild-type ID domain (Fig. 4B). Moreover, scanning mutation experiments showed that loss of functional Z1 or Z4 zinc fingers does not change the binding specificity to mutated consensus probes (data not shown), further demonstrating that Z1 and Z4 do not contribute to ID domain DNA binding specificity. Overall, our data suggest that only two of the four possible zinc fingers in the ID domain, Z2 and Z3, are required for interacting with the DNA consensus motif.

Additional amino acids between ID1 zinc fingers do not alter DNA recognition
A unique feature of maize ID1, relative to other ID domain proteins, is an additional 23–25 amino acids between the first two zinc fingers (Fig. 3A). Assuming that Z3 is a true zinc finger, the distance between Z1 and Z3 in all other ID-like proteins identified so far ranges from 20 to 22 amino acids, whereas 45 amino acids separate these motifs in ID1. Although no other ID domain protein has such a long spacer, a putative id1 ortholog from rice, idOs, has an eight amino acid extension (A. Kozaki and J. Colasanti, unpublished results). For most animal C2H2-type proteins, the zinc finger modules are grouped into clusters, with spacing between fingers invariant for any particular family (23). In contrast, many plant zinc finger proteins appear to be more flexible with respect to spacing between fingers. In the petunia EPF-like proteins, where family members are classified based on the distance between fingers, studies suggest that the spacing between the fingers dictates the specificity of the DNA binding site (12,25). In the case of ID1, our results suggest that zinc finger Z1 is not essential for specific DNA binding and the function of the long spacer between Z1 and the Z3–Z2–Z4 cluster is different from that of the inter-finger spacers found in EPF proteins.

We compared the DNA binding ability of the ID domain with and without the 25 amino acid spacer to test whether the extra distance between Z1 and Z3 alters the ID1 binding site preference such that it recognizes target sites that are significantly different from sequences recognized by other ID-like family proteins. The ID domain of ID1 that lacked the insertion (IDdel1; Fig. 4A) was fused to GST and partially purified recombinant protein was used for EMSA. As shown in Figure 5, the IDdel1 protein bound to the 11 bp consensus motif and showed the same binding properties to mutant probes as did full-length ID1, although binding to the probe with the mutation at position 11 (M11) is slightly stronger. This finding suggests that, unlike EPF-like proteins, the presence of additional amino acids between zinc fingers does not affect binding specificity relative to other ID domain proteins.

ID1 and ID-like proteins recognize the same consensus sequence
Since IDdel1 has DNA binding properties similar to wild-type ID1, we tested whether other ID-like proteins could interact with the 11 bp consensus motif. We used EMSA to test the DNA binding capabilities of maize ID domain proteins VEG7 and VEG9 (Fig. 3). Figure 5 shows that both VEG7 and VEG9 bind to oligonucleotides containing the 11 bp consensus motif; i.e., they exhibit binding properties similar to ID1 and the IDdel1 mutant.

As shown in Figure 5A, ID1, IDdel1 and the ID-like proteins VEG7 and VEG9 did not bind probes with mutations at positions 3–8, indicating that bases at these positions are important for protein–DNA interaction. On the other hand, these proteins showed weak binding to mutant probes with mutations at positions 1, 2, 9, 10 and 11. The binding of VEG7 and VEG9 to the M11 probe was comparable to their interaction with the consensus motif, and the binding of IDdel1 to M11 was slightly stronger than that of ID1. These observations may reflect differences in binding sequence specificity of ID-like family proteins or ID1 may be more sensitive to the base change at this position (position 11) than proteins without insertion between zinc fingers. These results suggest that sequences recognized by VEG7 or VEG9 are similar to that of ID1 even though they lack the long spacer between zinc fingers present in the ID1 protein.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We are investigating the biochemical function of the maize ID1 protein by characterizing its DNA binding properties in vitro, and by examining the structural role of the ID domain zinc fingers in recognizing the specific DNA consensus motif. The presence of zinc finger domains that interact with specific DNA sequences is further evidence that maize ID1, and most likely all ID domain proteins, function as transcriptional regulators.

ID1 protein has unique structural features
ID1 is a zinc finger protein with several unique characteristics. First, the ID domain, the structural component of ID1 that interacts with DNA and defines the ID-like protein family, is composed of different types of zinc fingers (Fig. 3). Zinc finger Z1 has the hallmarks of canonical C2H2 zinc fingers typified by Krüppel-like proteins and the general transcription factor TFIIIA. Zinc finger Z2 encodes an atypical C2HC domain that has the same structure as canonical C2H2 zinc fingers except for a histidine replacing the last cysteine. The other putative zinc fingers, Z3 and Z4, were not recognized as typical zinc fingers in genome-wide similarity searches (J. Colasanti, unpublished results). However, alignment of ID domains from several plant species reveals that the sequences of Z3 and Z4 are highly conserved, suggesting that they may have an important function, possibly by acting as functional zinc fingers that mediate DNA recognition (Fig. 4). Here we have shown that Z3, but not Z4, is required for recognition of the 11 bp consensus motif. DNA binding zinc fingers with the structure of Z3, YXCX4CX17H4H, have not been reported. However, the baculoviral IAP BIR2 domain has a primary structure, CX2CX16HX6C, that differs from typical C2H2 zinc fingers, yet is able to chelate zinc and form a three-dimensional structure similar to C2H2 zinc fingers (26). Moreover, the six amino acid spacer separating the Z3 and Z2 domains resembles the conserved H/C link motifs that often separate cluster-type zinc fingers (5,27), further supporting the possibility that Z3 functions as a DNA binding zinc finger module. The structure of Z4, YXCXCX3FX8HX3C, satisfies the requirements of canonical C2H2 fingers, except that a single amino acid separates the two cysteines that are presumed to chelate zinc. In addition, the similarity of Z4 to the third zinc finger of the yeast SWI5 transcription factor (24) strongly suggests that the Z4 domain is a functional zinc finger (Fig. 4B). Overall, ID1 and all ID domain family members contain four distinct types of zinc finger modules.

The other unique structural feature of ID1 is that three of the four putative zinc fingers, Z2, Z3 and Z4, are arrayed in a tandem cluster, as is found with most animal zinc finger proteins, but one finger, Z1, is separated from the cluster by a long spacer. Separation of zinc finger modules by long, variable length spacers appears to be a common characteristic of plant zinc finger proteins (8,11,12,25).

The ID1 protein binds to a specific DNA sequence via zinc fingers of the ID domain
The role of ID1 as a regulator of gene expression was supported by the finding that ID1 protein binds to a specific 11 bp DNA consensus motif, 5'-T-T-T-G-T-C-G/C-T/C-T/a-T/a-T-3'. We showed that recognition of this consensus sequence occurs via the ID domain, and therefore, is likely to be mediated by the zinc finger modules located within this structure. The 11 bp sequence recognized by ID1 is the approximate length expected for a protein with four zinc fingers if one assumes that each module interacts with a DNA triplet (6,11). However, by mutating each zinc finger in ID1 we have shown that not all the presumed zinc binding motifs participate in recognition of the consensus sequence. An unexpected finding was that Z1, which has the structure of a typical C2H2 zinc finger, is not required for interaction with the consensus motif. Likewise, binding experiments with mutant Z4 proteins showed that Z4 is not required for specific DNA binding to the consensus (Fig. 4B). In contrast, site-directed mutagenesis of Z2 and Z3 showed that they are essential for optimal DNA binding, presumably because they form functional DNA binding zinc fingers. It is possible that Z2 and Z3 are required for mediating protein–protein interaction, and that disruption of this interaction would cause loss of DNA binding activity. At present we do not know if dimerization of ID domain proteins is required for consensus motif recognition. Although the proposed rules for zinc finger interaction with DNA would require more than two zinc fingers to bind an 11 bp sequence, it is possible that motifs outside the ID domain zinc fingers could interact with DNA. For example, the Drosophila GAGA protein contains basic amino acids that were shown to act in concert with a single zinc finger module to bind a specific 7 bp DNA motif (28). Although more biochemical and structural evidence is needed to prove that the unorthodox Z3 motif forms a zinc finger, the mutagenesis experiments presented here support the possibility that Z3 does interact with DNA.

Our results suggest that the binding ability of each putative zinc finger domain of ID1 could not be predicted based on similarity to previously characterized DNA binding proteins. All ID domain proteins examined to date contain two putative C2HC-type zinc fingers, Z2 and Z4, and we have shown that Z2 is essential for specific DNA binding. The ability of a C2HC-type zinc finger to bind DNA in vitro was shown recently (29), but, so far, most studies of naturally occurring C2HC-type domains report that this type of zinc finger more often has a role in protein–protein interaction or RNA binding, rather than DNA binding (30,31). For example, the C2HC domains of the Friend of GATA (FOG) proteins are involved in mediating interaction with GATA-1 proteins (32). Akhtar and Becker (33) showed that a C2HC-type finger in the MOF protein is involved in nucleosome binding and also is essential for the H4 histone acetyltransferase activity of this protein. On the other hand, the third zinc finger of the yeast SWI5 protein, an unusual C2HC-type finger that is similar to Z4, is reported to be involved in DNA binding (34). We find that the putative Z4 finger of ID1 is not involved in binding to the 11 bp consensus motif, therefore it may have another, undiscovered function.

The surprising result that Z1 does not interact with the consensus motif suggests that the binding ability of even canonical zinc finger motifs must be tested on a case-by-case basis. However, the position of Z1 within the ID domain may contribute to this unusual finding. The Z3, Z2 and Z4 modules together form a zinc finger cluster, but Z1 is separated from this cluster by a long spacer. In animals, the REST protein, a repressor of type II sodium channel genes, has a cluster of eight zinc fingers that is involved in DNA binding, and one zinc finger, separated from this cluster, that is reported to be essential for suppressor activity, but not DNA binding (35). An arrangement of zinc fingers similar to ID domain proteins is observed in the maize TRM1 protein, a YY1-like suppressor of rbc-m3 expression (36). The TRM1 protein, which is reported to bind DNA, contains five putative zinc fingers; four in a cluster and one finger separated from the cluster. However, the function of each of these domains has not been determined. Therefore, the high level of conservation of the Z1 finger of ID1, as well as Z4, suggest that these domains may have other functions, such as mediating protein–protein interaction or RNA binding. However, the ability of Z1 to recognize sequences separated from the 11 bp motif remains a possibility.

Different spacing between ID domain zinc fingers does not alter DNA binding specificity
The additional 25 amino acids between zinc fingers Z1 and Z3 distinguishes ID1 from all other known members of the ID-like family (Fig. 3). We wanted to determine whether this amino acid insertion contributes to the specific ID1 function of controlling flowering time by specifying interaction with particular target genes. However, we found that an ID1 protein lacking this 25 amino acid insertion recognized the 11 bp binding motif with the same specificity as the complete ID1 protein (Fig. 5). Furthermore, two ID family proteins from maize that naturally lack the 25 amino acid addition, VEG7 and VEG9, are able to recognize the ID1 consensus motif, suggesting that they interact with the same 11 bp site or they share an overlapping set of binding sequences. As of yet, no function has been ascribed to any of the ID domain family proteins. Although VEG7 and VEG9 mRNAs are expressed in the same tissues as ID1 protein (i.e. immature leaves), genetic evidence does not suggest that they share with ID1 the function of controlling flowering time (J. Colasanti, unpublished results).

The finding that changing the spacing between zinc fingers of the ID1 protein has little effect on its ability to recognize the 11 bp binding motif contrasts with the situation for EPF-type proteins, where the distance between fingers dictates the spacing between core binding motifs (11). However, our findings might not be unexpected since the isolated Z1 zinc finger does not seem to be required for recognition of the 11 bp consensus motif. Therefore, it is likely that the additional amino acids between domains Z1 and Z3 in the ID1 protein do not participate in contacting the cognate DNA sequence and might have another function, such as mediating protein–protein interaction.

Sequences outside the consensus motif affect ID1 binding
Although ID1 interacts with a specific target sequence, an unexpected finding was that the addition of a T residue at the –1 position changes ID1 binding specificity for this consensus motif. Selectivity for sequences outside the core binding site for some C2H2-type zinc fingers has been reported (37,38). Nagaoka et al. (37) found that the zinc finger protein Sp1 selectivity binds a G triplet outside the Sp1 GC box core binding motif, thus revealing a novel binding site outside the defined Sp1 consensus motif. Sp1 was shown to recognize this alternate binding sequence with higher affinity than the GC box. Therefore, the ability to recognize alternate sequence motifs might be a feature of some zinc finger DNA binding proteins.

It is possible that ID1 recognizes alternative sequences when T is present at the –1 position, as in the case of the alternative GC box mentioned above. In fact, probes with slight variations from the consensus motif that had an extra T at the –1 position were selected by the SAAB assay and showed relatively high binding affinity to ID1 (Fig. 1A). Perhaps the T outside the consensus sequence stabilizes the DNA–protein complex. Although we do not know whether T at the –1 position of the consensus is preferred in vivo or not, this property might provide valuable information when searching for ID1 target genes. Analysis of the Arabidopsis and maize genomes reveals ID domain binding motifs, with and without additional –1 T residues, in upstream positions of many different genes (A. Kozaki and J. Colasanti, unpublished results). Experiments are in progress to determine if any of these particular sequences are preferred in vivo targets.

Biological relevance of ID1 protein function
Our study of the DNA binding properties of ID1 and the ID family proteins reveals novel DNA recognition properties for zinc finger proteins containing both typical C2H2-type and atypical C2HC-type zinc fingers. Recently, Sagasser et al. reported that the Arabidopsis transparent testa 1 gene, TT1, is a member of the WIP domain family of proteins, which also have a combination of C2H2-type and C2HC-type zinc finger motifs (15). Although WIP domain proteins show significant homology to ID domain proteins (40% identity), the id-like genes form a distinct, highly conserved sub-family. The authors point out that additional conserved cysteine and histidine residues in the C-terminus of the WIP domain might lead to the formation of two additional fingers (15). Therefore, it is possible that the various types of zinc fingers in WIP domain proteins, like ID1, may mediate DNA binding, whereas others may have other functions.

Our finding that DNA recognition by ID1 does not conform entirely to prescribed rules for zinc finger–DNA interaction is of considerable interest in light of recent endeavors to engineer ‘polydactyl’ zinc finger proteins to bind specific DNA targets for altering expression of particular genes in vivo (39,40) or for targeting nucleases to specific sites in the genome to enhance homologous recombination (41). Investigation of the class of plant proteins represented by ID1 may provide novel insights into how zinc finger proteins work in general.


    ACKNOWLEDGEMENTS
 
We thank Harley Smith and George Chuck for critical comments on the manuscript and Ryan Geil for editorial assistance. This research is supported by grants to J.C. from the National Science Foundation (MCB-9982714), Pioneer Hi-bred International, Inc., and the Natural Sciences and Engineering Research Council of Canada.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bieker,J.J. (2001) Kruppel-like factors: three fingers in many pies. J. Biol. Chem., 276, 34355–34358.[Free Full Text]

  2. Klug,A. and Schwabe,J.W.R. (1995) Protein motifs. 5. Zinc fingers. FASEB J., 9, 597–604.[Abstract]

  3. Parraga,G., Horvath,S.J., Eisen,A., Taylor,W.E. and Hood,L. (1988) Zinc-dependent structure of a single-finger domain of yeast ADR1. Science, 241, 1489–1492.[Abstract/Free Full Text]

  4. Lee,M.S., Gippert,G.P., Soman,K.V., Case,D.A. and Wright,P.E. (1989) Three-dimensional solution structure of a single zinc finger DNA-binding domain. Science, 245, 635–637.[Abstract/Free Full Text]

  5. Wolfe,S.A., Nekludova,L. and Pabo,C.O. (2000) DNA recognition by Cys(2)His(2) zinc finger proteins. Annu. Rev. Biophys Biomol. Struct., 29, 183–212.[CrossRef][Web of Science][Medline]

  6. Pavletich,N.P. and Pabo,C.O. (1991) Zinc finger DNA recognition—crystal-structure of a Zif268-DNA complex at 2.1-A. Science, 252, 809–817.[Abstract/Free Full Text]

  7. Riechmann,J.L., Heard,J., Martin,G., Reuber,L., Jiang,C.Z., Keddie,J., Adam,L., Pineda,O., Ratcliffe,O.J., Samaha,R.R. et al. (2000) Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science, 290, 2105–2110.[Abstract/Free Full Text]

  8. Takatsuji,H. (1998) Zinc-finger transcription factors in plants. Cell. Mol. Life Sci., 54, 582–596.[CrossRef][Web of Science][Medline]

  9. Takatsuji,H. (1999) Zinc-finger proteins: the classical zinc finger emerges in contemporary plant science. Plant Mol. Biol., 39, 1073–1078.[CrossRef][Web of Science][Medline]

  10. Takatsuji,H., Nakamura,N. and Katsumoto,Y. (1994) A new family of zinc-finger proteins in petunia—structure, DNA-sequence recognition and floral organ-specific expression. Plant Cell, 6, 947–958.[Abstract]

  11. Takatsuji,H. and Matsumoto,T. (1996) Target sequence recognition by separate type Cys(2)/His(2) zinc finger proteins in plants. J. Biol. Chem., 271, 23368–23373.[Abstract/Free Full Text]

  12. Kubo,K., Sakamoto,A., Kobayashi,A., Rybka,Z., Kanno,Y., Nakagawa,H., Nishino,T. and Takatsuji,H. (1998) Cys(2)/His(2) zinc-finger protein family of petunia: evolution and general mechanism of target-sequence recognition. Nucleic Acids Res., 26, 608–615.[Abstract/Free Full Text]

  13. Dathan,N., Zaccaro,L., Esposito,S., Isernia,C., Omichinski,J.G., Riccio,A., Pedone,C., Di Blasio,B., Fattorusso,R. and Pedone,P.V. (2002) The Arabidopsis SUPERMAN protein is able to specifically bind DNA through its single Cys(2)-His(2) zinc finger motif. Nucleic Acids Res., 30, 4945–4951.[Abstract/Free Full Text]

  14. Colasanti,J., Yuan,Z. and Sundaresan,V. (1998) The indeterminate gene encodes a zinc finger protein and regulates a leaf-generated signal required for the transition to flowering in maize. Cell, 93, 593–603.[CrossRef][Web of Science][Medline]

  15. Sagasser,M., Lu,G.H., Hahlbrock,K. and Weisshaar,B. (2002) A-thaliana TRANSPARENT TESTA 1 is involved in seed coat development and defines the WIP subfamily of plant zinc finger proteins. Genes Dev., 16, 138–149.[Abstract/Free Full Text]

  16. Luo,M., Bilodeau,P., Koltunow,A., Dennis,E.S., Peacock,W.J. and Chaudhury,A.M. (1999) Genes controlling fertilization-independent seed development in Arabidopsis thaliana. Proc. Natl Acad. Sci. USA, 96, 296–301.[Abstract/Free Full Text]

  17. Yoshida,N., Yanai,Y., Chen,L.J., Kato,Y., Hiratsuka,J., Miwa,T., Sung,Z.R. and Takahashi,S. (2001) EMBRYONIC FLOWER2, a novel polycomb group protein homolog, mediates shoot development and flowering in Arabidopsis. Plant Cell, 13, 2471–2481.[Abstract/Free Full Text]

  18. Gendall,A.R., Levy,Y.Y., Wilson,A. and Dean,C. (2001) The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization in Arabidopsis. Cell, 107, 525–535.[CrossRef][Web of Science][Medline]

  19. Birve,A., Sengupta,A.K., Beuchle,D., Larsson,J., Kennison,J.A., Rasmuson-Lestander,A. and Muller,J. (2001) Su(z)12, a novel Drosophila Polycomb group gene that is conserved in vertebrates and plants. Development, 128, 3371–3379.[Abstract/Free Full Text]

  20. Prigge,M.J. and Wagner,D.R. (2001) The Arabidopsis SERRATE gene encodes a zinc-finger protein required for normal shoot development. Plant Cell, 13, 1263–1279.[Abstract/Free Full Text]

  21. Colasanti,J. and Sundaresan,V. (2000) ‘Florigen’ enters the molecular age: long-distance signals that cause plants to flower. Trends Biochem. Sci., 25, 236–240.[CrossRef][Web of Science][Medline]

  22. Smith,H.M.S., Boschke,I. and Hake,S. (2002) Selective interaction of plant homeodomain proteins mediates high DNA-binding affinity. Proc. Natl Acad. Sci. USA, 99, 9579–9584.[Abstract/Free Full Text]

  23. Pabo,C.O., Peisach,E. and Grant,R.A. (2001) Design and selection of novel Cys(2)His(2) zinc finger proteins. Annu. Rev. Biochem., 70, 313–340.[CrossRef][Web of Science][Medline]

  24. Stillman,D.J., Bankier,A.T., Seddon,A., Groenhout,E.G. and Nasmyth,K.A. (1988) Characterization of a transcription factor involved in mother cell specific transcription of the yeast HO gene. EMBO J., 7, 485–494.[Web of Science][Medline]

  25. Yoshioka,K., Fukushima,S., Yamazaki,T., Yoshida,M. and Takatsuji,H. (2001) The plant zinc finger protein ZPT2-2 has a unique mode of DNA interaction. J. Biol. Chem., 276, 35802–35807.[Abstract/Free Full Text]

  26. Sun,C.H., Cai,M.L., Gunasekera,A.H., Meadows,R.P., Wang,H., Chen,J., Zhang,H.C., Wu,W., Xu,N., Ng,S.C. et al. (1999) NMR structure and mutagenesis of the inhibitor-of-apoptosis protein XIAP. Nature, 401, 818–822.[CrossRef][Medline]

  27. Schuh,R., Aicher,W., Gaul,U., Cote,S., Preiss,A., Maier,D., Seifert,E., Nauber,U., Schroder,C., Kemler,R. et al. (1986) A conserved family of nuclear proteins containing structural elements of the finger protein encoded by Kruppel, a Drosophila segmentation gene. Cell, 47, 1025–1032.[CrossRef][Web of Science][Medline]

  28. Pedone,P.V., Ghirlando,R., Clore,G.M., Gronenborn,A.M., Felsenfeld,G. and Omichinski,J.G. (1996) The single Cys(2)-His(2) zinc finger domain of the GAGA protein flanked by basic residues is sufficient for high-affinity specific DNA binding. Proc. Natl Acad. Sci. USA, 93, 2822–2826.[Abstract/Free Full Text]

  29. Simpson,R.J.Y., Cram,E.D., Czolij,R., Matthews,J.M., Crossley,M. and Mackay,J.P. (2003) CCHX zinc finger derivatives retain the ability to bind Zn(II) and mediate protein–DNA interactions. J. Biol. Chem., 278, 28011–28018.[Abstract/Free Full Text]

  30. Schmeichel,K.L. and Beckerle,M.C. (1997) Molecular dissection of a LIM domain. Mol. Biol. Cell, 8, 219–230.[Abstract]

  31. Arrizabalaga,G. and Lehmann,I. (1999) A selective screen reveals discrete functional domains in Drosophila Nanos. Genetics, 153, 1825–1838.[Abstract/Free Full Text]

  32. Tsang,A.P., Visvader,J.E., Turner,C.A., Fujiwara,Y., Yu,C.N., Weiss,M.J., Crossley,M. and Orkin,S.H. (1997) FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation. Cell, 90, 109–119.[CrossRef][Web of Science][Medline]

  33. Akhtar,A. and Becker,P.B. (2001) The histone H4 acetyltransferase MOF uses a C2HC zinc finger for substrate recognition. EMBO Rep., 2, 113–118.[CrossRef][Web of Science][Medline]

  34. Nakaseko,Y., Neuhaus,D., Klug,A. and Rhodes,D. (1992) Adjacent zinc-finger motifs in multiple zinc-finger peptides from Swi5 form structurally independent, flexibly linked domains. J. Mol. Biol., 228, 619–636.[CrossRef][Web of Science][Medline]

  35. TapiaRamirez,J., Eggen,B.J.L., PeralRubio,M.J., ToledoAral,J.J. and Mandel,G. (1997) A single zinc finger motif in the silencing factor REST represses the neural-specific type II sodium channel promoter. Proc. Natl Acad. Sci. USA, 94, 1177–1182.[Abstract/Free Full Text]

  36. Xu,T., Purcell,M., Zucchi,P., Helentjaris,T. and Bogorad,L. (2001) TRM1, a YY1-like suppressor of rbcS-m3 expression in maize mesophyll cells. Proc. Natl Acad. Sci. USA, 98, 2295–2300.[Abstract/Free Full Text]

  37. Nagaoka,M., Shiraishi,Y. and Sugiura,Y. (2001) Selected base sequence outside the target binding site of zinc finger protein Sp1. Nucleic Acids Res., 29, 4920–4929.[Abstract/Free Full Text]

  38. Swirnoff,A.H. and Milbrandt,J. (1995) DNA-binding specificity of Ngfi-a and related zinc-finger transcription factors. Mol. Cell. Biol., 15, 2275–2287.[Abstract]

  39. Segal,D.J. (2002) The use of zinc finger peptides to study the role of specific factor binding sites in the chromatin environment. Methods, 26, 76–83.[CrossRef][Web of Science][Medline]

  40. Beerli,R.R. and Barbas,C.F. (2002) Engineering polydactyl zinc-finger transcription factors. Nat. Biotechnol., 20, 135–141.[CrossRef][Web of Science][Medline]

  41. Bibikova,M., Beumer,K., Trautman,J.K. and Carroll,D. (2003) Enhancing gene targeting with designed zinc finger nucleases. Science, 300, 764.[Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Takahashi, K. M. Teshima, S. Yokoi, H. Innan, and K. Shimamoto
Variations in Hd1 proteins, Hd3a promoters, and Ehd1 expression levels contribute to diversity of flowering time in cultivated rice
PNAS, March 17, 2009; 106(11): 4555 - 4560.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
J. Colasanti and V. Coneva
Mechanisms of Floral Induction in Grasses: Something Borrowed, Something New
Plant Physiology, January 1, 2009; 149(1): 56 - 62.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
K. Matsubara, U. Yamanouchi, Z.-X. Wang, Y. Minobe, T. Izawa, and M. Yano
Ehd2, a Rice Ortholog of the Maize INDETERMINATE1 Gene, Promotes Flowering by Up-Regulating Ehd1
Plant Physiology, November 1, 2008; 148(3): 1425 - 1435.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Wu, C. You, C. Li, T. Long, G. Chen, M. E. Byrne, and Q. Zhang
RID1, encoding a Cys2/His2-type zinc finger transcription factor, acts as a master switch from vegetative to floral development in rice
PNAS, September 2, 2008; 105(35): 12915 - 12920.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
O. N. Danilevskaya, X. Meng, D. A. Selinger, S. Deschamps, P. Hermon, G. Vansant, R. Gupta, E. V. Ananiev, and M. G. Muszynski
Involvement of the MADS-Box Gene ZMM4 in Floral Induction and Inflorescence Development in Maize
Plant Physiology, August 1, 2008; 147(4): 2054 - 2069.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
V. Coneva, T. Zhu, and J. Colasanti
Expression differences between normal and indeterminate1 maize suggest downstream targets of ID1, a floral transition regulator in maize
J. Exp. Bot., October 10, 2007; (2007) erm217v1.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
D. Welch, H. Hassan, I. Blilou, R. Immink, R. Heidstra, and B. Scheres
Arabidopsis JACKDAW and MAGPIE zinc finger proteins delimit asymmetric cell division and stabilize tissue boundaries by restricting SHORT-ROOT action
Genes & Dev., September 1, 2007; 21(17): 2196 - 2204.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
A. Y. M. Wong and J. Colasanti
Maize floral regulator protein INDETERMINATE1 is localized to developing leaves and is not altered by light or the sink/source transition
J. Exp. Bot., February 1, 2007; 58(3): 403 - 414.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. G. Muszynski, T. Dam, B. Li, D. M. Shirbroun, Z. Hou, E. Bruggemann, R. Archibald, E. V. Ananiev, and O. N. Danilevskaya
delayed flowering1 Encodes a Basic Leucine Zipper Protein That Mediates Floral Inductive Signals at the Shoot Apex in Maize
Plant Physiology, December 1, 2006; 142(4): 1523 - 1536.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. O. Steffens, C. Galuschka, M. Schindler, L. Bulow, and R. Hehl
AthaMap web tools for database-assisted identification of combinatorial cis-regulatory elements and the display of highly conserved transcription factor binding sites in Arabidopsis thaliana
Nucleic Acids Res., July 1, 2005; 33(suppl_2): W397 - W402.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (366K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Kozaki, A.
Right arrow Articles by Colasanti, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kozaki, A.
Right arrow Articles by Colasanti, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?