Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (376K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Pestryakov, P. E.
Right arrow Articles by Lavrik, O. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pestryakov, P. E.
Right arrow Articles by Lavrik, O. I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published online 26 March 2004

Nucleic Acids Research, 2004, Vol. 32, No. 6 1894-1903
© 2004 Oxford University Press

Human replication protein A (RPA) binds a primer–template junction in the absence of its major ssDNA-binding domains

Pavel E. Pestryakov, Denis Y. Khlimankov, Elena Bochkareva1, Alexey Bochkarev1 and Olga I. Lavrik*

Institute of Chemical Biology and Fundamental Medicine, Siberian Division of Russian Academy of Sciences, Prospect Lavrentieva 8, 630090, Novosibirsk, Russia and 1 Department of Biochemistry and Molecular Biology, University of Oklahoma Health Sciences Center, 975 NE 10th Street, BRC-466, Oklahoma City, OK 73190, USA

*To whom correspondence should be addressed. Tel: +7 3832 344296; Fax: +7 3832 333677; Email: lavrik{at}niboch.nsc.ru
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors

Received October 1, 2003; Revised January 14, 2004; Accepted March 1, 2004


    ABSTRACT
 TOP
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The human nuclear single-stranded (ss) DNA- binding protein, replication protein A (RPA), is a heterotrimer consisting of three subunits: p70, p32 and p14. The protein–DNA interaction is mediated by several DNA-binding domains (DBDs): two major (A and B, also known as p70A and p70B) and several minor (C and D, also known as p70C and p32D, and, presumably, by p70N). Here, using crosslinking experiments, we investigated an interaction of RPA deletion mutants containing a subset of the DBDs with partial DNA duplexes containing 5'-protruding ssDNA tails of 10, 20 and 30 nt. The crosslinks were generated using either a ‘zero-length’ photoreactive group (4-thio-2'-deoxyuridine-5'-monophosphate) embedded in the 3' end of the DNA primer, or a group connected to the 3' end by a lengthy linker (5-{N-[N-(4-azido-2,5-difluoro-3- chloropyridine-6-yl)-3-aminopropionyl]-trans-3-aminopropenyl-1}-2'-deoxyuridine-5'-monophosphate). In the absence of two major DBDs, p70A and p70B, the RPA trimerization core (p70C·p32D·p14) was capable of correctly recognizing the primer– template junction and adopting an orientation similar to that in native RPA. Both p70C and p32D contributed to this recognition. However, the domain contribution differed depending on the size of the ssDNA. In contrast with the trimerization core, the RPA dimerization core (p32D·p14) was incapable of detectably recognizing the DNA- junction structures, suggesting an orchestrating role for p70C in this process.


    Introduction
 TOP
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The eukaryotic single-stranded (ss) DNA-binding protein, replication protein A (RPA), plays a central role in replication, recombination and repair. Human RPA is a heterotrimer comprising three subunits of molecular masses 70, 32 and 14 kDa, which are referred to as p70, p32 and p14, respectively. In DNA-processing events, RPA also interacts with many additional nuclear proteins and these interactions both regulate and are regulated by an interaction with ssDNA [for reviews see (1,2)].

The DNA-binding function of four DBDs, which are referred to as p70A, p70B, p70C and p32D (also DBD-A, -B, -C and -D), is well documented [reviewed in (2,3)]. The p70N protein domain is also surmised to be in a very weak interaction with DNA and has been shown to be important for unwinding of double-stranded (ds) DNA (46). These five domains, as well as the intact p14 subunit, share the same structural motif, the oligonucleotide/oligosaccharide binding fold (OB-fold) (3,7). The greater part of ssDNA-binding activity is associated with the central part of the p70 subunit [amino acids 181–422] (8,9) and is localized in two major DNA-binding domains: p70A (amino acids 181–290) and p70B (amino acids 300–422) (10). In crystals and in solution, p70A and p70B contact ssDNA in tandem. Binding of p70A and p70B is coordinated perforce by a linkage effect (1012). The C-terminal domain of p70 (p70C; amino acids 436–616) and the central domain of p32 (p32D; amino acids 43–171) possess weak ssDNA-binding activity (1315). These two minor DNA-binding domains, together with the entire p14 subunit, form the RPA trimerization core (p70C·p32·p14), the assembly that keeps the three RPA subunits together (16). In vitro the two smaller subunits p32 and p14 form a dimeric subcomplex (p32·p14), which is assembled via a dimerization core (p32D·p14) and contains the DNA-binding domain p32D (13,17,18).

The possible mechanism by which DBDs bind ssDNA is hypothesized to include a sequential binding pathway (19). It is initiated by p70A and mediated by successive 5'-to-3'-directed (with respect to the bound DNA strand) loading of DBD-B, -C and -D (11,12,16,2022). DNA binding by p70A is a transient state that immediately resolves to the binding mode with an apparent binding site of 8–10 nt (11). This relatively stable low affinity and highly cooperative binding mode (designated as RPA8–10) is mediated by the two major DNA-binding domains, A and B (23). Subsequent steps are associated with a major conformational change. Binding by the three DBDs of p70 (p70A, p70B and p70C) is associated with the 13–14 nt mode that may be yet another intermediate (24). A stable high affinity and low cooperativity DNA-binding mode is mediated by four DBDs: p70A, p70B, p70C and p70D. Such a binding mode is characterized by an occluded site of 30 nt per RPA heterotrimer (designated RPA30) (25,26). It is also possible that, depending on the specific structural form of the DNA being bound by RPA, additional interactions of p70N can also contribute to additional specific binding modes. All transitions in RPA conformation have been documented by crystallography, nuclear magnetic resonance (NMR), electron microscopy, photoaffinity labeling and limited proteolysis (8,11,12,16, 24,26,27).

Photoaffinity labeling studies have previously demonstrated specific polar binding of RPA to DNA gaps and the specific orientation of the subunits around the primer–template junctions (21). In DNA duplexes with 5'-protruding ssDNA tails, the extent of primer binding and subunit orientation around the primer–template junction strongly depends on the size of the ssDNA tail (24). The results of in vivo photoaffinity labeling of the RPA subunits are in agreement with in vitro experiments (28). It was also shown that the 3' end of the DNA primer directly contacts the central part of p32 or the C-terminal part of p70 (27). These data are consistent with the interpretation that RPA binds the primer–template junction by contacting it with the RPA trimerization core. It remained unclear whether ssDNA binding by the cluster of major DBDs, p70AB, is a prerequisite for junction binding by the trimerization core with proper orientation, or whether these two processes can be separated.

In this report we compare the binding of the intact RPA trimer and its mutant forms, p70ABC·p32D·p14 (RPA-ABCD), p70AB (RPA-AB), p70C·p32D·p14 (RPA-CD), and p32D·p14 (RPA-D), with partial DNA duplexes and show that the two major DNA-binding domains, p70A and p70B, are dispensable for correct junction recognition by the RPA trimerization core (RPA-CD). In contrast, the RPA dimerization core RPA-D, which contains DBD-D, was not sufficient for detectable crosslinking with such DNA structures.


    Materials and methods
 TOP
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Proteins and nucleotides
Recombinant DNA polymerase ß (pol ß) was purified as described previously (29). Recombinant RPA was expressed in Escherichia coli, isolated and purified as described previously (17,30). Mutant forms of RPA were expressed and purified as described (15,16,19,31). [{gamma}-32P]ATP (5000 Ci/mmol) was from Biosan (Novosibirsk, Russia). Synthetic oligonucleotides were obtained from Eurogentec (Belgium). The 10 kDa protein ladder, pre-stained protein molecular mass markers and ‘rainbow’ colored protein molecular mass markers were from Invitrogen (Heidelberg, Germany), Sigma (Taufkirchen, Germany) and Amersham Biosciences (Freiburg, Germany), respectively. Monoclonal antibodies specific to the p14 or p32 subunit of RPA and secondary antibody conjugates with alkaline phosphatase (AP) or horse radish peroxidase were from Gentar (Belgium). The enhanced chemiluminescence (ECL) kit for immunoblotting was from Amersham Biosciences; 5-bromo-4-chloro-3-indolylphosphate/Nitro Blue Tetrazolium (BCIP/NBT) substrates for immunoblotting were from Sigma. The photoreactive dNTP analogs: FAP-dUTP (5-{N-[N-(4-azido-2, 5-difluoro-3-chloropyridine-6-yl)-3-aminopropionyl]-trans-3-aminopropenyl-1}-2'-deoxyuridine-5'-triphosphate) and S4-dUTP (4-thio-2'-deoxyuridine-5'-triphosphate) were kind gifts of Drs D. Kolpashchikov and V. Bogachev, respectively (Institute of Chemical Biology and Fundamental Medicine, Novosibirsk, Russia).

Oligonucleotides
The designations and sequences of oligonucleotides were as follows: primer: d(GGTAGGGGCTATACACU); template-10: d(TCGTAGTTCTAGTGTATAGCCCCTACC), 10 nt ssDNA extension; template-20: d(TGGTTCGATATCGTAGTTCTAGTGTATAGCCCCTACC), 20 nt ssDNA extension; template-30: d(TTTTTTTTTTTGGTTCGATATC GTAGTTCTAGTGTATAGCCCCTACC), 30 nt ssDNA extension.

Primer labeling and annealing
Primer was 5'-32P-phosphorylated with T4 polynucleotide kinase as described previously (32). Unreacted [{gamma}-32P]ATP was separated by passing the mixture over a MicroSpin G-25 column (Amersham Biosciences) according to the manufacturer’s suggested protocol. Radioactively labeled primer was annealed to its template at a molar ratio of 1:1 in 10 mM Tris–HCl pH 7.5, 10 mM KCl by heating the mixture to 95°C for 5 min and then slowly cooling it down to room temperature.

Elongation of the primer in the presence of photoreactive dNTP analogs and photochemical crosslinking
To obtain photoreactive DNA-10, -20 and -30 (Fig. 1A), reaction mixtures (300 µl) contained 50 mM Tris–HCl pH 7.8, 5 mM MgCl2, 50 mM NaCl, 0.4 µM pol ß, 0.5 µM of primer–template DNA complex and 1 µM FAP-dUTP or S4-dTTP. The reaction mixtures were incubated at 25°C for 30 min to allow elongation of the primers. Subsequently the mixtures were incubated at 90°C for 3 min, cooled slowly and centrifuged to remove precipitated pol ß. To check the resulting annealing efficiency, aliquots of 0.5 or 1 µl of the sample volume were brought to a final concentration of 5% Ficoll-400 and 0.05% bromophenol blue and electrophoresed on a 12% polyacrylamide gel containing 89 mM Tris–HCl, 89 mM boric acid and 2 mM EDTA pH 8.8 at 100 V/cm. Radioactive bands were visualized by autoradiography and excised, and the radioactivity was quantified by scintillation counting. In all our experiments the percentage of annealed substrate was >99.9%. The reaction mixture was then divided into 15 µl aliquots and RPA or one of its mutant forms (RPA-ABCD, RPA-CD, RPA-AB, RPA-D) was added to the samples to give final concentrations of 1.72, 0.86, 0.42 and 0.21 µM. Reaction mixtures were additionally incubated in micro-Eppendorf tubes for 5 min at room temperature and UV-irradiated on ice through the open top for 1 min in the case of FAP-dUTP and 40 min in the case of S4-dUTP. A Lomo VIO-1 UV-crosslinker (St Petersburg, Russia) equipped with lamps producing UV light of 334–365 nm was used as a light source. Reactions were stopped by adding Laemmli loading buffer and heating for 5 min at 100°C. The photochemically crosslinked protein–DNA samples were separated by 12.5% or 15% SDS–PAGE (33). Gels were either subjected to immunoblotting or stained with silver (34), dried and subjected to autoradiography.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. DNA structures, photoreactive residues and protein constructs used in this study. (A) Photoreactive DNA duplexes containing 10-, 20- and 30-nt 5'-protruding tails (DNA-10, -20 and -30, respectively). U* denotes the photoreactive residue. (B) UR (‘long’ FAP-dUMP) and (C) US (‘zero-length’ S4-dUMP) photoreactive dUMP moiety incorporated into the 3' end of the primer using either FAP-dUTP or S4-dUTP. (D) Schematic structure of wild-type and mutant forms of RPA used in this study: RPA, p70ABC·p32D·p14 (RPA-ABCD), p70AB (RPA-AB), p70C·p32D·p14 (RPA-CD) and p32D·p14 (RPA-D).

 
Gel mobility shift assays
To establish the relative saturation of DNA under the conditions used for photocrosslinking, RPA or one of its mutant forms (RPA-ABCD, RPA-CD, RPA-AB, RPA-D) was incubated at 25°C for 30 min at the indicated concentrations in reaction mixtures (15 µl) containing 50 mM Tris–HCl pH 7.8, 5 mM MgCl2, 50 mM NaCl, 0.1 g/l bovine serum albumin and 0.5 µM radioactively labeled DNA-10, -20 or -30. Subsequently mixtures were adjusted to contain 5% Ficoll-400, 0.05% bromophenol blue and electrophoresed on 6% polyacrylamide gel containing 89 mM Tris–HCl, 89 mM boric acid and 5 mM MgCl2 pH 8.8 at 100 V/cm. The gels were then dried on DE81 paper, radioactive bands corresponding to free and bound DNA were visualized, and radioactivity was quantified using a Bio-Rad FX Pro Plus phosphorimager.

Partial duplex-DNA destabilization assays
Double-stranded DNA destabilization assays were performed as described previously for gel mobility shift assays, except that incubations were terminated by adding SDS to a final concentration of 0.5% (to disrupt RPA–DNA complexes) and separated on a 12% polyacrylamide gel containing 89 mM Tris–HCl, 89 mM boric acid and 2 mM EDTA pH 8.8 at 100 V/cm.

Immunoblotting
Protein samples were separated by 15% SDS–PAGE (33) and transferred to polyvinylidene fluoride (PVDF) membrane (Millipore, USA) using a ‘semi-dry’ transfer apparatus (Hoefer Scientific Instruments, San Francisco, CA) according to the manufacturer’s instructions. The membrane was probed with monoclonal antibodies specific to the p14 or p32 subunit of RPA. Secondary antibody conjugates, ECL detection and BCIP/NBT detection kits were used according to manufacturer protocols.


    Results
 TOP
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
To elucidate the role of different RPA domains/subunits and their arrangement at the primer–template junction we examined the crosslinking patterns of several mutant forms of RPA, namely RPA-ABCD (p70181–616·p3243–171·p14), RPA-AB (p70181–422), RPA-CD (p70436–616·p3243–171·p14) and RPA-D (p3243–171·p14) (Fig. 1D). These mutants contain subsets of the four RPA DBDs, A, B, C and D, and p14, which is necessary for RPA complex formation. Other RPA domains, p70N, p32N and p32C, which are known to be key players in mediating protein–protein interactions, were excluded in the mutants.

Photoaffinity labeling using photoreactive nicked and gapped DNA duplexes as models of DNA-replication/-repair intermediates has been used to examine the arrangement of RPA and other proteins on these structures, and also to monitor conformational changes that accompany the transitions between different binding modes. Such photoreactive intermediates were obtained enzymatically using base- substituted dUTP analogs of various structures (21,24, 27,35). In this work a comparison of modification patterns mediated by deoxyuridine monophosphate (dUMP) analogs with spacers of various lengths was of particular interest. The spacer length carrying a ‘long’ photoreactive group was 14 Å (FAP-dUTP), which corresponds to the distance covered by approximately 4–5 nt (Fig. 1B). Another crosslinking reagent, S4-dUTP, was of ‘zero-length’ (Fig. 1C). Photoreactive partial duplexes, DNA-10, -20 and -30 (Fig. 1A), were synthesized by DNA polymerase ß in the presence of either FAP-dUTP or S4-dUTP, starting with synthetic deoxyoligonucleotide partial duplexes. Therefore, different photoreagents allowed us to probe the protein domain alignment at different distances from the 3' end of the primer, whereas varying lengths of protruding template tail were chosen to specify different modes of RPA binding to ssDNA tail (from RPA8–10 to RPA30).

Conditions described previously (35) allowed us to introduce a single photoreactive dUMP residue into the 3' end of 32P-labeled primer (data not shown). After complete primer elongation and pol ß removal, RPA or one of its mutants was added to the reaction mixtures containing photoreactive DNAs and irradiated with long-wavelength UV light (for conditions see Materials and Methods).

Polypeptide chains of p32D (p32, amino acids 43–171) and p14 (total 121 amino acids) differ in their molecular mass by <2 kDa, making it difficult to distinguish their possible protein–DNA conjugates based on electrophoretic mobility. Crosslinking and immunoblotting with monoclonal antibodies specific to p32 and p14 demonstrated that the protein–DNA conjugates with a molecular mass of ~25 kDa are derived from the p32 subunit, i.e. they correspond to p32D (Fig. 2). No protein–DNA crosslinks with the p14 subunit were detected in any mutant analyzed in this study (data not shown).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 2. Identification of the low-weight crosslinking product. Western blot analysis was performed to identify the origin of the low molecular weight crosslinking product of RPA-ABCD. The reaction mixtures contained the photoreactive DNA-30 duplex structure with the ‘long’ FAP-dUMP photoreactive residue (1 µM) and RPA-ABCD (1 µM). Mixtures were preincubated for 20 min at 25°C and were either UV-irradiated (+) or not irradiated (–). Protein samples were then separated on 15% SDS–polyacrylamide gels and either silver stained (lanes 5 and 6 for non-irradiated and irradiated mixtures, respectively) or transferred to a PVDF membrane and visualized with antibodies. Lanes 1 and 3 contained non-irradiated probes, and lanes 2 and 4 contained irradiated probes preadsorbed with monoclonal antibodies specific to p32 and p14, respectively. The positions of protein markers are indicated in the left margin.

 
The labeling patterns of all proteins used for photoreactive DNA-30 and -20 with either a ‘long’ or a ‘zero-length’ photoreactive group were almost indistinguishable (not shown), but strikingly different from that of DNA-10. It should be emphasized that under the conditions used in this study, all of the proteins (except RPA-D) were shown to be similar with respect to the order of magnitude of DNA-30 saturation (Fig. 3A). Also, all of the proteins saturated DNA-10 very poorly, as revealed by gel mobility shift assays (data not shown). This fact allowed us to focus solely on comparing the crosslinking pattern of the protein constructs used.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 3. Partial duplex DNA saturation and unwinding by mutant RPA forms. (A) RPA-ABCD (lanes 2–5), RPA-AB (lanes 7–10), RPA-CD (lanes 11–14) and RPA-D (lanes 15–18) were incubated at the indicated concentrations (bottom) with reaction mixtures containing 0.5 µM radioactively labeled DNA-30 partial duplex DNA under photocrosslinking conditions (see Materials and Methods). No protein was added to the control reaction mixtures (lanes 1 and 6). The protein–DNA complexes formed were separated from unbound DNA by PAGE and visualized by autoradiography. DNA saturation was quantified as the percentage of bound DNA to the total amount of labeled DNA duplex. (B) A partial duplex DNA unwinding assay was performed to exclude the possibility of photolabeling by unwound photoreactive primer. RPA-ABCD (lanes 3–6), RPA-AB (lanes 9–12) and RPA-CD (lanes 13–16) were incubated at the indicated concentrations (bottom) with the reaction mixtures containing 0.5 µM radioactively labeled DNA-30 under photocrosslinking conditions (see Materials and Methods). No protein was added to the control reaction mixtures (lanes 2 and 8). Lanes 1 and 7 represent control mixtures containing only free radioactively labeled primer. Partial duplex DNA was separated from free primer by PAGE and visualized by autoradiography.

 
The pattern of RPA crosslinking to photoreactive DNA-30 was shown to depend on the RPA to DNA stoichiometry. The concentration of photoreactive DNA in all experiments was 0.5 µM. At low RPA concentration, the primer, bearing photoreactive group, was predominantly crosslinked to the p32 subunit, with the crosslinking to p70 being significantly less efficient (Fig. 4A and B, lanes 2–4). When RPA was taken at a higher molar excess (1.72 µM), p70 labeling increased to a larger extent than p32 labeling. In turn, p32 labeling either increased moderately, as with the ‘zero-length’ crosslinker (Fig. 4B, lane 5), or even decreased, as with the extended photoreactive group (Fig. 4A, lane 5). This evident change in crosslinking pattern reflects the formation of complexes in which a partial DNA duplex was bound by two protein molecules, as visualized using gel mobility shift assays. The photolabeling using DNA-10 was significantly different to that of DNA-30. The 3'-photoreactive primers were predominantly crosslinked to the p70 subunit of wild-type RPA, with less intensive crosslinking to p32. This concerted change was observed in both ‘zero-length’ and extended photoreagents (Fig. 5A and B, lanes 2–5). These data are consistent with previous reports about the binding modes of RPA to photoreactive DNA duplexes containing 10- and 30-nt protruding template tails or gaps (21,24).



View larger version (67K):
[in this window]
[in a new window]
 
Figure 4. Photoaffinity labeling of the intact and mutant RPA forms by the DNA-30 duplex containing ‘long’ (A) and ‘zero-length’ (B) photoreactive residues. RPA (lanes 2–5), RPA-ABCD (lanes 6–10), RPA-AB (lanes 11–15) and RPA-CD (lanes 16–20) were added to the photoreactive reaction mixtures at the indicated concentrations (bottom) and crosslinked by UV irradiation (see Materials and Methods). No protein was added to the control reaction mixtures (lanes 1, 6, 11 and 16). The crosslinked protein–DNA complexes were separated by SDS–PAGE and visualized using autoradiography. The positions of crosslinked products and protein markers are indicated in the right and left margins, respectively. UR and US denote FAP-dUMP and S4-dUMP moieties, respectively, incorporated in the 3' end of the primer.

 


View larger version (66K):
[in this window]
[in a new window]
 
Figure 5. Photoaffinity labeling of the intact and mutant RPA forms by the DNA-10 duplex containing ‘long’ (A) and ‘zero-length’ (B) photoreactive residues. RPA (lanes 2–5), RPA-ABCD (lanes 6–9), RPA-AB (lanes 10–13) and RPA-CD (lanes 14–17) were added to the photoreactive reaction mixtures at the indicated concentrations (bottom) and crosslinked by UV irradiation (see Materials and Methods). A control reaction mixture (lane 1) had no protein. The crosslinked protein–DNA complexes were separated by SDS–PAGE and visualized using autoradiography. The positions of crosslinked products and protein markers are indicated in the right and left margins, respectively. UR and US denote FAP-dUMP and S4-dUMP moieties, respectively, incorporated in the 3' end of the primer.

 
The crosslinking patterns to wild-type RPA and the RPA-ABCD mutant were very similar for all DNAs used. In the case of DNA-30 (DNA-20) at low and mid-range protein concentrations, a majority of p32D was modified, whereas at higher concentrations the p70-derived part was labeled to a great extent (Fig. 4A and B, lanes 7–10). Labeling of the RPA-ABCD mutant with DNA-10 showed that the 3' end of the primer predominantly crosslinks to the p70 subunit fragment (Fig. 5A and B, lanes 6–9). Taken together, these data suggest that RPA and RPA-ABCD form similar complexes with the partial DNA duplexes, containing protruding tails of different lengths.

Crosslinking of the p70AB mutant with DNA-30, bearing an extended photoreactive group, generated two products (Fig. 4A, lanes 12–15). A similar effect was detected in experiments using DNA-20 (data not shown) and DNA-10 (Fig. 5A and B, lanes 10–13). The protein samples used in our experiments were not detectably contaminated by proteolytic products, as confirmed by SDS–PAGE and Coomassie Brilliant Blue G-250 staining (data not shown). The coexistence of two crosslinking products with different electrophoretic mobilities may have the following explanation. p70AB may form at least two different complexes with DNA duplexes under the conditions used. Therefore, the existence of two crosslinking products with different electrophoretic mobilities can be attributed to modification of p70AB bound to DNA duplex in these two distinct complexes.

The RPA trimerization core, RPA-CD, could be labeled by all DNA duplexes used (Fig. 4A and B, lanes 17–20, and Fig. 5A and B, lanes 14–17). As shown by gel mobility shift assays, under the conditions used in this study saturation of DNA-30 by RPA-CD is of the same order of magnitude as that of wild-type RPA, RPA-ABCD and RPA-AB (Fig. 3). It was also shown that under the conditions used, all of the proteins were equally poor in binding DNA-10 (data not shown).

In contrast to RPA-CD, no detectable crosslinking or traces of complexes observed by gel mobility shift assays could be detected for the RPA-D mutant with any of the DNAs analyzed (Fig. 3A, lanes 15–18; data not shown).We conclude that p32D can only be part of the interaction interface near the 3' end of the primer if it is properly positioned by the accompanying p70C.

The general tendency in the labeling of wild-type RPA and RPA-ABCD with the ‘zero-length’ photoreactive group was more efficient crosslinking to p32 (or p32D) and less efficient crosslinking to p70 (or p70ABC) compared with the ‘long’ group (compare panels A and B in Figures 4 and 5). When the size of ssDNA decreased from 30 to 10 nt, the relative crosslinking intensity of p32 and p70 (or p32D and p70ABC) was redistributed: p32 decreased and p70 increased (compare panels A and B in Figures 4 and 5).

Surprisingly, in experiments with DNA-10 carrying the ‘long’ FAP-moiety and either wild-type RPA or RPA-ABCD, both p32 and p32D were crosslinked to an extremely small extent compared with the ‘zero-length’ crosslinking group (compare Fig. 5A and B). One possible explanation for this fact is that in such a configuration, p32D is located favorably to interact with the 3' end of the primer. The ‘long’ photoreactive group may extend towards the 5' end of the template strand and preferentially contact DBDs within p70. In contrast, the ‘zero-length’ photoreactive group is not sufficiently long to access p70 and crosslinks only to p32D.

In experiments with the RPA trimerization core (RPA-CD), we observed strikingly different labeling for ‘long’ and ‘zero-length’ photoreactive groups by both DNA-30 and DNA-10. In the case of DNA-30 and the ‘long’ group, both p70C and p32D were crosslinked to the primer (Fig. 4A, lanes 17–20). In contrast, only p32D was crosslinked when the primer contained the ‘zero-length’ group in the 3' end (Fig. 4B, lanes 12–15). In the case of DNA-10, only p70C was crosslinked to the ‘long’ photoreactive group and only p32D was modified by the ‘zero-length’ reagent (Fig. 5A and B, lanes 14–17). These data favor the hypothesis that the binding of partial DNA duplexes with 5'-protruding tails is specifically polar, with p70C being bound to the ssDNA part of the structure. In turn, p32D is located in direct contact with the 3' end of the primer, where it is modified by the ‘zero-length’ S4-dUMP photoreactive moiety. The ‘long’ photoreagent containing a FAP-arylazido group extends approximately 4–5 nt further from the 3' end and can only modify DNA-binding domain C (‘long’) or both DNA-binding domains C and D (‘zero-length’), depending on the protein conformation mediated by the length of the ssDNA tail. The similarity in crosslinking patterns of the intact RPA and RPA-CD strongly suggests a similar binding mode for RPA-CD in the presence and absence of RPA-AB.


    Discussion
 TOP
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
RPA is involved in multiple types of interactions with DNA, which include binding to ssDNA, dsDNA, ss–dsDNA junctions, partly unwound origin DNA and damaged DNA structures, and destabilizing dsDNA helices (5,3640). Although the major DNA-binding domains of p70, A and B, play a predominant role in ssDNA binding, two minor domains, C and D, are also necessary for optimal binding. A hypothetical model of sequential RPA binding to DNA is as follows. The binding of RPA to ssDNA initially involves an unstable recognition of 8 nt by domains A and B in tandem (11,12). Presumably, this initial binding raises the ‘effective’ concentration of DNA near the lower affinity domains C and D, and helps these domains bind DNA (16,20). This process converts RPA into a stable elongated complex. This sequential binding model is in agreement with the experimentally defined polarity of DNA-bound RPA (10,21,22,38). When a ss–dsDNA junction is on the way, the 3' end of the DNA primer is contacted by the central part of the p32 subunit and the C-terminal part of the p70 subunit (27). Additional binding of a suggested DBD, p70N, may require specific DNA form or sequence (12).

Photoaffinity labeling of RPA by DNA duplexes containing a photoreactive dNMP moiety embedded in the 3' end of the primer is a highly sensitive method for monitoring the rearrangement of RPA domains near primer–template junctions. This approach permitted us to identify changes in RPA conformation induced by the length of the 5'-protruding template tail, and also to show the polarity of RPA subunits interacting with a ssDNA platform (21,24,37). In the present work we used DNA duplex structures with three sizes of single-stranded extension of the template strand, modulating different binding modes. For the purpose of investigating domain arrangements at different distances from the 3' end of the primer, two different photoreactive groups were used: ‘zero-length’ 4-thio-2'-deoxyuridine-5'-monophosphate and ‘long’ 5-{N-[N-(4-azido-2,5-difluoro-3-chloropyridine-6-yl)-3-aminopropionyl]-trans-3-aminopropenyl-1}-2'-deoxyuridine-5'-monophosphate, in which the photoreactive group is situated 14 Å away from the nucleotide base. Mutant forms of RPA with different protein domains were used. Similar domain arrangements and protein orientations around the 3' end of the primer were observed for the RPA-ABCD mutant and the wild-type RPA in different binding modes. The transition between binding modes was monitored by photoaffinity labeling under varying protein-to-DNA ratios and by using DNA with protruding tails long enough to accommodate RPA in the RPA8–10 and RPA30 binding modes.

In contrast to RPA-AB and RPA-D, wild-type RPA, RPA-ABCD and RPA-CD contain the C-terminal domain of p70, which is reported to participate in dsDNA destabilization and unwinding (5). To prevent such unwinding, which could lead to crosslinking in the complex of RPA and displaced radioactive photoreactive primer, we used moderate ionic strength buffers enriched with Mg2+ in our experiments. No significant primer displacement was detected in these experiments. Moreover, deLaat and colleagues (22), working in similar buffer conditions, were not able to detect even local RPA-dependent duplex destabilization near the 3' end of the primer.

RPA-ABCD lacks the p70N and p32C domains, which play a significant role in protein–protein interactions, and the p32N domain, which carries all known RPA phosphorylation sites. There is also evidence that the interaction of the p70N domain with other proteins (e.g. the repair protein XPA) can be modulated by ssDNA, which shares the same binding site on the protein (41,42). However, our data did not detect any significant contribution of these domains in ss–dsDNA junction binding. The four DNA-binding domains of RPA, A, B, C and D, together with the p14 subunit are mechanistically sufficient for the binding of partial DNA-duplex and for maintaining the same 5'-to-3' polar binding pathway as intact RPA (16,21,22,38).

Consistent with our previous report, our data strongly suggest that the primer–template junction is contacted by either the central part of the p32 subunit or the C-terminal part of p70 (27). This conclusion is based on analysis of three RPA forms: wild-type RPA, RPA-ABCD and RPA-CD. RPA-CD contains the two minor DBDs, C and D, and the p14 subunit as its structural unit. This mutant can bind to partial DNA duplexes with both long (30 nt) and short (10 nt) protruding tails, although it does so to the latter only very poorly. Moreover, mapping the domains at different distances from the 3' end of the primer shows that even without the cluster of major DNA-binding domains A and B, RPA-CD can bind to primer–template junctions with an intrinsic polarity of p70C-p32D aligning in the 5'-to-3' direction.

The p32D domain contacts a primer-template junction, but only in the presence of other DBDs (RPA, RPA-ABCD and RPA-CD). In our experiments we were unable to detect crosslinks of the 3' end of the primer to the dimerization core of RPA, i.e. RPA-D. Additionally, a gel mobility shift assay under the conditions used for crosslinking was unable to detect any binding of RPA-D to the DNA duplexes. In previous reports we demonstrated that p70 on its own crosslinks to the primer, whereas crosslinking of the p32 subunit requires two orders of magnitude higher protein concentrations (43). It is likely that p32D alone is unable to interact efficiently with the primer–template junction or ssDNA tail, and coordinating action of p70C is required. Concerted action of p70C and p32D results in oriented binding of RPA-CD on the ssDNA tail of the partial DNA duplex and localization of p32D in close proximity to the 3' end. This model is outlined in Figure 6.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. Model depicting the labeling pattern of the RPA trimerization core (RPA-CD) using photoreactive partial DNA duplexes containing 5'-protruding tails of 30 (20) nt (panels A and B) and 10 nt (panels C and D). Panels (A) and (C) demonstrate patterns obtained using ‘long’ FAP-dUMP photoreactive moiety; panels (B) and (D), ‘zero-length’ 54-dUMP. Small and large stars indicate low and high levels of crosslinking intensity, respectively. White circles and Roman letters indicate approximate locations of DBD-D and DBD-C. For details see Discussion.

 
To summarize, DBDs A, B, C, D and p14 are sufficient for proper binding of partial DNA duplexes with 5'-protruding tails and for a correct transition between major binding modes. Furthermore, major DNA-binding domains A and B are dispensable for proper orientation of RPA-CD (trimerization core) on such DNA duplexes. Binding of RPA-CD to the primer–template junction requires the concerted action of both DBD-C and DBD-D.


    ACKNOWLEDGEMENTS
 
The authors wish to thank Drs Svetlana N. Khodyreva and Irina O. Petruseva for providing DNA polymerase ß and replication protein A, and Dr A. Favre for stimulating discussions in the initial stage of this project. They are also grateful to Richard d’Ari for careful reading of the manuscript. This work was supported in part by grants from the Russian Foundation for Basic Research to O.I.L. (01-04-48895, 02-04-48404, 00-04-22002, 03-04-06165, 03-04-06167, 04-04-48368), a grant from the Siberian Division of the RAS (dedicated to young scientists) to D.Y.K. and by funding from the US National Institutes of Health to A.B. (R01 GM61192). O.I.L. wishes to thank Université Paris 6 for grant PAST from the University International Agreement.


    REFERENCES
 TOP
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 

  1. Wold,M.S. (1997) Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Annu. Rev. Biochem., 66, 61–92.[CrossRef][ISI][Medline]

  2. Iftode,C., Daniely,Y. and Borowiec,J.A. (1999) Replication protein A (RPA): the eukaryotic SSB. Crit. Rev. Biochem. Mol. Biol., 34, 141–180.[Medline]

  3. Bochkarev,A. and Bochkareva,E. (2004) From RPA to BRCA2: lessons from single-stranded DNA binding by the OB-fold. Curr. Opin. Struct. Biol., 14, 36–42.[CrossRef][ISI][Medline]

  4. Braun,K.A., Lao,Y., He,Z., Ingles,C.J. and Wold,M.S. (1997) Role of protein–protein interactions in the function of replication protein A (RPA): RPA modulates the activity of DNA polymerase alpha by multiple mechanisms. Biochemistry, 36, 8443–8454.[CrossRef][Medline]

  5. Lao,Y., Lee,C.G. and Wold,M.S. (1999) Replication protein A interactions with DNA. 2. Characterization of double-stranded DNA-binding/helix-destabilization activities and the role of the zinc-finger domain in DNA interactions. Biochemistry, 38, 3974–3984.[CrossRef][Medline]

  6. Binz,S.K., Lao,Y., Lowry,D.F. and Wold,M.S. (2003) The phosphorylation domain of the 32-kDa subunit of replication protein A (RPA) modulates RPA–DNA interactions. Evidence for an intersubunit interaction. J. Biol. Chem., 278, 35584–35591.[Abstract/Free Full Text]

  7. Murzin,A.G. (1993) OB (oligonucleotide/oligosaccharide binding)-fold: common structural and functional solution for non-homologous sequences. EMBO J., 12, 861–867.[ISI][Medline]

  8. Gomes,X.V., Henricksen,L.A. and Wold,M.S. (1996) Proteolytic mapping of human replication protein A: evidence for multiple structural domains and a conformational change upon interaction with single-stranded DNA. Biochemistry, 35, 5586–5595.[CrossRef][Medline]

  9. Pfuetzner,R.A., Bochkarev,A., Frappier,L. and Edwards,A.M. (1997) Replication protein A. Characterization and crystallization of the DNA binding domain. J. Biol. Chem., 272, 430–434.[Abstract/Free Full Text]

  10. Bochkarev,A., Pfuetzner,R.A., Edwards,A.M. and Frappier,L. (1997) Structure of the single-stranded-DNA-binding domain of replication protein A bound to DNA. Nature, 385, 176–181.[CrossRef][Medline]

  11. Arunkumar,A.I., Stauffer,M.E., Bochkareva,E. and Bochkarev,A. (2003) Independent and coordinated functions of the replication protein A tandem high affinity ssDNA binding domains. J. Biol. Chem., 278, 41077–41082.[Abstract/Free Full Text]

  12. Wyka,I.M., Dhar,K., Binz,S.K. and Wold,M.S. (2003) Replication protein A interactions with DNA: differential binding of the core domains and analysis of the DNA interaction surface. Biochemistry, 42, 12909–12918.[CrossRef][Medline]

  13. Bochkarev,A., Bochkareva,E., Frappier,L. and Edwards,A.M. (1999) The crystal structure of the complex of replication protein A subunits RPA32 and RPA14 reveals a mechanism for single-stranded DNA binding. EMBO J., 18, 4498–4504.[CrossRef][ISI][Medline]

  14. Brill,S.J. and Bastin-Shanower,S. (1998) Identification and characterization of the fourth single-stranded-DNA binding domain of replication protein A. Mol. Cell. Biol., 18, 7225–7234.[Abstract/Free Full Text]

  15. Bochkareva,E., Korolev,S. and Bochkarev,A. (2000) The role for zinc in replication protein A. J. Biol. Chem., 275, 27332–27338.[Abstract/Free Full Text]

  16. Bochkareva,E., Korolev,S., Lees-Miller,S.P. and Bochkarev,A. (2002) Structure of the RPA trimerization core and its role in the multistep DNA-binding mechanism of RPA. EMBO J., 21, 1855–1863.[CrossRef][ISI][Medline]

  17. Henricksen,L.A., Umbricht,C.B. and Wold,M.S. (1994) Recombinant replication protein A: expression, complex formation, and functional characterization. J. Biol. Chem., 269, 11121–11132.[Abstract/Free Full Text]

  18. Sibenaller,Z.A., Sorensen,B.R. and Wold,M.S. (1998) The 32- and 14-kiloDalton subunits of replication protein A are responsible for species-specific interactions with single-stranded DNA. Biochemistry, 37, 12496–12506.[CrossRef][Medline]

  19. Bochkareva,E., Belegu,V., Korolev,S. and Bochkarev,A. (2001) Structure of the major single-stranded DNA-binding domain of replication protein A suggests a dynamic mechanism for DNA binding. EMBO J., 20, 612–618.[CrossRef][ISI][Medline]

  20. Bastin-Shanower,S.A. and Brill,S.J. (2001) Functional analysis of the four DNA binding domains of replication protein A. The role of RPA2 in ssDNA binding. J. Biol. Chem., 276, 36446–36453.[Abstract/Free Full Text]

  21. Kolpashchikov,D.M., Khodyreva,S.N., Khlimankov,D.Y., Wold,M.S., Favre,A. and Lavrik,O.I. (2001) Polarity of human replication protein A binding to DNA. Nucleic Acids Res., 29, 373–379.[Abstract/Free Full Text]

  22. de Laat,W.L., Appeldoorn,E., Sugasawa,K., Weterings.E., Jaspers,N.G. and Hoeijmakers,J.H. (1998) DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair. Genes Dev., 16, 2598–2609.

  23. Blackwell,L.J. and Borowiec,J.A. (1994) Human replication protein A binds single-stranded DNA in two distinct complexes. Mol. Cell. Biol., 14, 3993–4001.[Abstract/Free Full Text]

  24. Lavrik,O.I., Kolpashchikov,D.M., Weisshart,K., Nasheuer,H.P., Khodyreva,S.N. and Favre,A. (1999) RPA subunit arrangement near the 3'-end of the primer is modulated by the length of the template strand and cooperative protein interactions. Nucleic Acids Res., 27, 4235–4240.[Abstract/Free Full Text]

  25. Kim,C. and Wold,M.S. (1995) Recombinant human replication protein A binds to polynucleotides with low cooperativity. Biochemistry, 34, 2058–2064.[CrossRef][Medline]

  26. Blackwell,L.J., Borowiec,J.A. and Masrangelo,I.A. (1996) Single-stranded-DNA binding alters human replication protein A structure and facilitates interaction with DNA-dependent protein kinase. Mol. Cell. Biol., 16, 4798–4807.[Abstract]

  27. Pestryakov,P.E., Weisshart,K., Schlott,B., Khodyreva,S.N., Kremmer,E., Grosse,F., Lavrik,O.I. and Nasheuer,H.P. (2003) Human replication protein A. The C-terminal RPA70 and the central RPA32 domains are involved in the interactions with the 3'-end of a primer-template DNA. J. Biol. Chem., 278, 17515–17524.[Abstract/Free Full Text]

  28. Mass,G., Nethanel,T., Lavrik,O.I., Wold,M.S. and Kaufmann,G. (2001) Replication protein A modulates its interface with the primed DNA template during RNA–DNA primer elongation in replicating SV40 chromosomes. Nucleic Acids Res., 29, 3892–3899.[Abstract/Free Full Text]

  29. Beard,W.A. and Wilson,S.H. (1995) Purification and domain-mapping of mammalian DNA polymerase beta. Methods Enzymol., 262, 98–107.[CrossRef][ISI][Medline]

  30. Nasheuer,H.P., von Winkler,D., Schneider,C., Dornreiter,I., Gilbert,I. and Fanning,E. (1992) Purification and functional characterization of bovine RP-A in an in vitro SV40 DNA replication system. Chromosoma, 102, S52–S59.[CrossRef][ISI][Medline]

  31. Bochkareva,E., Frappier,L., Edwards,A.M. and Bochkarev,A. (1998) The RPA32 subunit of human replication protein A contains a single-stranded DNA-binding domain. J. Biol. Chem., 273, 3932–3936.[Abstract/Free Full Text]

  32. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

  33. Laemmli,U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685.[CrossRef][Medline]

  34. Swain,M. and Ross,N.W. (1995) A silver stain protocol for proteins yielding high resolution and transparent background in sodium dodecyl sulfate–polyacrylamide gels. Electrophoresis, 16, 948–951.[CrossRef][ISI][Medline]

  35. Khlimankov,D.Iu, Rechkunova,N.I., Khodyreva,S.N., Petruseva,I.O., Nazarkina,Zh.K., Belousova,E.A. and Lavrik,O.I. (2002) Interaction of replication protein A and flap endonuclease 1 with DNA duplexes containing a nick or flap. Mol. Biol. (Moskow, Russ. Fed., Engl. Ed.), 6, 1044–1053.

  36. Treuner,K., Ramsperger,U. and Knippers,R.J. (1996) Replication protein A induces the unwinding of long double-stranded DNA regions. Mol. Biol., 259, 104–112.

  37. Lavrik,O.I., Kolpashchikov,D.M., Nasheuer,H.P., Weisshart,K. and Favre,A. (1998) Alternative conformations of human replication protein A are detected by crosslinks with primers carrying a photoreactive group at the 3'-end. FEBS Lett., 441, 186–190.[CrossRef][ISI][Medline]

  38. Iftode,C. and Borowiec,J.A. (2000) 5' to 3' molecular polarity of human replication protein A (hRPA) binding to pseudo-origin DNA substrates. Biochemistry, 39, 11970–11981.[CrossRef][Medline]

  39. Iakoucheva,L.M., Walker,R.K., van Houten,B. and Ackerman,E.J. (2002) Equilibrium and stop-flow kinetic studies of fluorescently labeled DNA substrates with DNA repair proteins XPA and replication protein A. Biochemistry, 41, 131–143.[CrossRef][Medline]

  40. Hermanson-Miller,I.L. and Turchi,J.J. (2002) Strand-specific binding of RPA and XPA to damaged duplex DNA. Biochemistry, 41, 2402–2408.[CrossRef][Medline]

  41. Daughdrill,G.W., Buchko,G.W., Botuyan,M.V., Arrowsmith,C., Wold,M.S., Kennedy,M.A. and Lowry,D.F. (2003) Chemical shift changes provide evidence for overlapping single-stranded DNA- and XPA-binding sites on the 70 kDa subunit of human replication protein A. Nucleic Acids Res., 31, 4176–4183.[Abstract/Free Full Text]

  42. Daughdrill,G.W., Ackerman,J., Isern,N.G., Botuyan,M.V., Arrowsmith,C., Wold,M.S. and Lowry,D.F. (2001) The weak interdomain coupling observed in the 70 kDa subunit of human replication protein A is unaffected by ssDNA binding. Nucleic Acids Res., 29, 3270–3276.[Abstract/Free Full Text]

  43. Kolpashchikov,D.M., Weisshart,K., Nasheuer,H.P., Khodyreva,S.N., Fanning,E., Favre,A. and Lavrik,O.I. (1999) Interaction of the p70 subunit of RPA with a DNA template directs p32 to the 3'-end of nascent DNA. FEBS Lett., 450, 131–134.[CrossRef][ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. J. Haring, A. C. Mason, S. K. Binz, and M. S. Wold
Cellular Functions of Human RPA1: MULTIPLE ROLES OF DOMAINS IN REPLICATION, REPAIR, AND CHECKPOINTS
J. Biol. Chem., July 4, 2008; 283(27): 19095 - 19111.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Ishii, K. Mimori, H. Inoue, T. Inageta, K. Ishikawa, S. Semba, T. Druck, F. Trapasso, K. Tani, A. Vecchione, et al.
Fhit Modulates the DNA Damage Checkpoint Response
Cancer Res., December 1, 2006; 66(23): 11287 - 11292.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
E. Fanning, V. Klimovich, and A. R. Nager
A dynamic model for replication protein A (RPA) function in DNA processing pathways
Nucleic Acids Res., September 10, 2006; 34(15): 4126 - 4137.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Liu, M. Kvaratskhelia, S. Hess, Y. Qu, and Y. Zou
Modulation of Replication Protein A Function by Its Hyperphosphorylation-induced Conformational Change Involving DNA Binding Domain B
J. Biol. Chem., September 23, 2005; 280(38): 32775 - 32783.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Weisshart, P. Pestryakov, R. W. P. Smith, H. Hartmann, E. Kremmer, O. Lavrik, and H.-P. Nasheuer
Coordinated Regulation of Replication Protein A Activities by Its Subunits p14 and p32
J. Biol. Chem., August 20, 2004; 279(34): 35368 - 35376.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (376K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Pestryakov, P. E.
Right arrow Articles by Lavrik, O. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pestryakov, P. E.
Right arrow Articles by Lavrik, O. I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?