Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (212K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Chen, F.
Right arrow Articles by Zhang, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, F.
Right arrow Articles by Zhang, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published online 28 April 2004

Nucleic Acids Research, 2004, Vol. 32, No. 8 2336-2341
© 2004 Oxford University Press

A novel replicating circular DNAzyme

Fei Chen, Ruijian Wang, Zhe Li, Bin Liu, Xiaoping Wang, Yanhong Sun, Dongyun Hao and Jin Zhang*

Key Lab for Molecular Enzymology and Engineering of the Ministry of Education (Jilin University), Changchun, 130023, P.R. China

*To whom correspondence should be addressed. Tel/Fax: +86 431 8980440; Email: zhangjin{at}jlu.edu.cn
Correspondence may also be addressed to Dongyun Hao. Tel/Fax: +86 431 8980440; Email: hao{at}jlu.edu.cn

Received January 10, 2004; Revised and Accepted March 25, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
10–23 DNAzyme has the potential to suppress gene expressions through sequence-specific mRNA cleavage. However, the dependence on exogenous delivery limits its applications. The objective of this work is to establish a replicating DNAzyme in bacteria using a single-stranded DNA vector. By cloning the 10–23 DNAzyme into the M13mp18 vector, we constructed two circular DNAzymes, C-Dz7 and C-Dz482, targeting the ß-lactamase mRNA. These circular DNAzymes showed in vitro catalytic efficiencies (kcat/KM) of 7.82 x 106 and 1.36 x 107 M–1·min–1, respectively. Their dependence on divalent metal ions is similar to that found with linear 10–23 DNAzyme. Importantly, the circular DNAzymes were not only capable of replicating in bacteria but also exhibited high activities in inhibiting ß-lactamase and bacterial growth. This study thus provides a novel strategy to produce replicating DNAzymes which may find widespread applications.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
10–23 DNAzyme was obtained by in vitro selection in 1997, and it cleaves RNA targets at the purine–pyrimidine junctions (1). The enzyme consists of a catalytic domain of 15 nucleotides, flanked by two substrate-recognition domains of 7–10 nucleotides (16). As a potential candidate of antisense drug in gene therapeutics, 10–23 DNAzyme has many advantages over other antisense drugs. Unlike antisense oligonucleotides, 10–23 DNAzyme not only binds the target RNAs but also cleaves them. Kurreck et al. showed that 10–23 DNAzymes have a much higher cleavage activity than the ribozymes (7). In fact, its catalytic efficiency (kcat/KM) may reach 109 M–1·min–1, which is about 100-fold higher than that of the most active ribozyme. It also has a remarkable stability 100 000-fold as high as that observed with ribozyme under physiological conditions. Furthermore, 10–23 DNAzyme exhibits high flexibility for cleaving-site selectivity and substrate specificity, because it may cleave the purine–pyrimidine junctions of any RNAs and a single base mismatch in its antisense arms significantly decreases the cleavage activity (110).

Despite all these favorable features, a major challenge facing the application of 10–23 DNAzyme is that it cannot replicate endogenously and, consequently, one has to rely on exogenous delivery. This usually gives rise to poor intracellular uptake and affects the stability of the DNAzymes. Thus, it becomes necessary to design a new type of DNAzyme capable of endogenous replication. Considering that the DNAzyme is a single-stranded oligodeoxynucleotide, we postulate that a single-stranded vector should be suitable to carry the enzyme replicated in vivo. To prove this, we designed two circular phage DNAzymes designated as C-Dz7 and C-Dz482, carried by the single-stranded phage vector, M13mp18. The DNAzymes target two conserved sites of TEM spectrum ß-lactamase mRNA. Our data demonstrate that the circular DNAzymes are capable of replication in E.coli cells and display catalytic activity in vitro and in bacteria.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Oligonucleotides and bacterial strains
All the DNA fragments used for construction of the circular DNAzymes (Table 1) and two control linear 10–23 DNAzymes L-Dz7 and L-Dz482 with sequences of 5'- GAAAATGTTGAAGGCTAGCTACAACGAACTCATAC TCTT-3' and 5'-GGTTCCCAACGAGGCTAGCTACAACG ACAAGGCGAGTTA-3', respectively, were synthesized by Sangon (Shanghai, China). The RNA substrates S7 and S482 (Fig. 1) were purchased from Takara (Dalian, China), and their 5'-termini were labeled with 32P using T4 polynucleotide kinase. The Ampicillin-resistant (Ampr) TEM-1 and TEM-3 ß-lactamase-producing E.coli strains, with a minimum inhibitory concentration (MIC) of 256 mg/l, were obtained from the Bacteria Department of Beijing Hospital (China). A replicative form (RF) of the M13mp18 vector and its bacterial host (TG1) were from Sangon (Shanghai, China).


View this table:
[in this window]
[in a new window]
 
Table 1. Cloning DNA fragmentsa
 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Structure of the circular DNAzymes and their RNA target. Two circular DNAzymes, C-Dz7 and C-Dz482, were designed to cleave the TEM spectrum ß-lactamase mRNA at the indicated sites in the initiation and coding regions, respectively. They were constructed through cloning 10–23 DNAzyme into M13mp18 vector. The arrows indicate the cleavage sites of the substrates.

 
Construction of circular DNAzymes
The complementary cloning fragments for construction of circular DNAzymes (Table 1) were annealed and ligated into the RF M13mp18 vector at the multiple cloning sites BamHI and HindIII. The ligation products were then transformed into bacterial host TG1. Positive clones were identified through color selection on agar-media containing IPTG and X-gal. A single colorless plaque was inoculated in a flask containing 100 ml of LB liquid medium with constant agitation at 37°C overnight. The recombinant circular DNAzymes were prepared by using the method described in the Molecular Cloning Manual (11) and their sequences were analyzed by Takara (Dalian, China). We thus generated two circular DNAzymes, namely, C-Dz7 and C-Dz482, and two mutant forms of the latter designated as C-Dz482m1 and C-Dz482m2.

In vitro activity assays of DNAzymes
In vitro cleavage activities of linear and circular DNAzymes were determined under multiple-turnover conditions. The reactions were performed at 37°C in a buffer containing 50 mM Tris–HCl (pH 7.6), 10 mM MgCl2 and 0.01% SDS. The concentration of DNAzymes was fixed at 2 nM, while the RNA substrate concentrations varied from 10 to 240 nM. At 5, 15, 30 and 60 min, aliquots of reaction mixtures were taken and quenched with 100 mM EDTA and 9 M urea. The resulting reaction mixtures were separated on 16% denaturing PAGE and visualized by autoradiography. The extent of cleavage was determined by measuring the radioactivity of the bands corresponding to the substrates and the cleaved products with a Bio-Rad PhosphorImager (Molecular Imager). Kinetic parameters, kcat and KM, were determined according to the Eadie–Hofstee plot (12). To analyze the effects of denaturation on in vitro activity of circular DNAzymes, C-Dz482 was first denatured by heating to 95°C for 5 min before cleavage activity assays as described above.

Detection of circular DNAzyme activity and its replication in bacteria
The circular DNAzymes were delivered into the Ampr bacteria by electroporation using a MicroPulser 165-2100 (Bio-Rad) according to the manufacturer’s technical instructions. The culture medium, SOC+, was a modified liquid SOC in which the Mg2+ and Amp concentration were changed to 10 mM and 100 µg/ml, respectively. Forty microliters of the diluted electro-competent cells were mixed with 2 µl of 5 µM circular DNAzyme. After incubation on ice for 1 min, the mixture was transferred to the pre-chilled 0.1 cm electroporation cuvette and pulsed once. Immediately, 1 ml SOC+ was added to the cuvette, and the cells were resuspended gently. A 10 µl aliquot of the electroporated bacteria suspension was used to determine the transformation efficiency of the phage DNAzymes. The sample was diluted to various concentrations and then mixed with 200 µl of overnight culture suspensions of the Ampr bacteria. Immediately, the mixtures were poured onto agar plates containing IPTG and X-gal. After incubation at 37°C for 12 h, plaques on the plates were counted, and the number of plaques per µg DNAzyme was defined as transformation efficiency. The rest of the electroporated bacteria suspension was transferred to a flask containing 50 ml SOC+ and cultured at 37°C in a shaker with a speed of 80–90 r.p.m. To examine the replication of the circular DNAzymes in the bacteria, 3-ml aliquots of the cultures were taken at appropriate moments. The single-stranded M13mp18 recombinant DNAs were then extracted from the supernatant of the cultures and analyzed by agarose gel electrophoresis. Growth of the bacteria was monitored by measuring spectrophotometric absorption of the cell culture suspensions at 600 nm. The growth inhibition rate was represented by (ODctrl – ODC-Dz)/ODctrl, where ODctrl and ODC-Dz denote the absorptions of control and DNAzyme-treated bacteria, respectively.

The ß-lactamase activity of the circular DNAzyme-treated bacteria was determined according to the iodometry method (13). Briefly, 10 ml of 9-h cultured bacteria was harvested, sonicated and ß-lactamase (sample solution) was extracted into 2 ml of a phosphate buffer (0.05 M, pH 7.0). The sample cell extracts (20 µl) were diluted into 1.25 ml with a 0.1 M phosphate buffer (pH 7.0), and then 0.25 ml of 2.5 mg/ml Amp solution was added. Following 30 min incubation, the reaction was stopped by adding 2.5 ml iodine reagent. The absorbance at 490 nm was measured directly and designated as A. Three control experiments (a, b and c) were performed simultaneously, which gave rise to absorbance Aa, Ab and Ac, respectively. The reaction conditions were (a) the phosphate buffer (1.25 ml) plus the Amp solution (0.25 ml), (b) the sample cell extract (20 µl) plus the phosphate buffer (1.5 ml) without Amp, and (c) phosphate buffer alone (1.5 ml). The ß-lactamase activity was defined as {Delta}A490 = AaAs + AbAc.

Analysis of divalent metal ion dependence
The substrate cleavage rate for C-Dz482 in the presence of several divalent metal ions was measured under single-turnover conditions. The reactions were performed at 37°C in a buffer containing 50 mM Tris–HCl (pH 7.6), 10 mM divalent metal ion and 0.01% SDS and were started by mixing 100 nM DNAzyme with 10 nM 32P-labeled RNA substrate. An aliquot was taken from each reaction liquid after 10 min incubation and quenched with 100 mM of EDTA and 9 M urea. The resulting products were separated by 16% denaturing PAGE, visualized by autoradiograph and quantified using a Bio-Rad PhosphorImager.

The dependence of substrate cleavage rate (kcat) on Mg2+ concentration was determined under the multiple-turnover conditions in the presence of 2 nM C-Dz482 and 200 nM 32P-labeled RNA substrate S482. Mg2+ concentrations were varied from 10 to 300 mM. Aliquots were taken from the reaction mixture at various times and quenched by 100 mM EDTA and 9 M urea for analyses. Reaction conditions and process were the same as described above. Since the C-Dz482 was over-saturated by the RNA substrate in this experiment, the maximum initial velocity (Vmax) could be determined and, thus, kcat was worked out according to the equation kcat = Vmax/[E].


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Design of circular DNAzymes
Table 1 and Figure 1 show the schematic structures and sequences of the circular DNAzymes designed in this study. The length of the antisense arm of the circular DNAzymes was designed a little longer than the commonly used 7–10 nt (3,4,1421). This is intended to enhance the binding affinity of DNAzymes to their RNA substrates. For assays of DNAzyme activity in bacteria, TEM spectrum ß-lactamase mRNAs were selected as the target sequence of our circular DNAzymes (Fig. 1). To verify the specificity of the DNAzymes, two mutant forms of C-Dz482, namely, C-Dz482m1 and C-Dz482m2, were constructed by single base substitution at the antisense arm (A12) and the catalytic core (C15), respectively (Table 1). For control purpose, we additionally synthesized two linear 10–23 DNAzymes, namely L-Dz7 and L-Dz482, with antisense arms and catalytic cores identical to those of the corresponding circular DNAzymes.

In vitro activity of the circular DNAzymes
The in vitro activities of the circular DNAzymes and the linear DNAzymes (controls) were examined using synthetic RNA substrates under multiple turnover conditions. The results are shown in Table 2. The catalytic efficiencies (kcat/KM) for C-Dz7 and C-Dz482 were 7.82 x 106 and 1.36 x 107 M–1· min–1, respectively. These values are about one-quarter to one-third of those obtained with corresponding linear DNAzymes (L-Dz7 and L-Dz482). This indicates that the circular DNAzymes retain significant catalytic activity after cloning into the single-stranded M13mp18 vector. The relatively lower catalytic efficiency may be due to suppression within the circular DNA. Indeed, when the circular DNAzymes were subjected to denaturation by heating at 95°C for 5 min, their activities were markedly increased. As shown in Table 2, heat treatment of C-Dz482 resulted in over an 8-fold increase in its catalytic efficiency.


View this table:
[in this window]
[in a new window]
 
Table 2. Kinetic parameters of the circular and linear DNAzymesa
 
To confirm the roles of the antisense arms and the catalytic core in determining the specificity of the circular DNAzymes, two mutant DNAzymes, C-Dz482m1 and C-Dz482m2, were tested for their cleavage activity toward the RNA substrates. As expected, neither mutant showed significant activity in vitro. This indicates that the circular DNAzymes possess high in vitro substrate specificity as observed with the linear 10–23 DNAzymes (4).

Replication and activity of the circular DNAzymes in bacteria
To test the replication of the circular DNAzyme in bacteria, we transformed the C-Dz482 into Ampr strains TEM-1 and TEM-3 by electroporation. The recombinant DNAs were extracted from the transformed bacterial cells and verified by sequencing. The results demonstrated that the circular DNAzymes indeed replicated in bacteria as recombinant DNAs carried by the M13mp18 vector. As shown in Figure 2, replication of the circular DNAzymes was seen after 6 h of incubation and reached a plateau at 12–24 h.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 2. Replication of circular DNAzyme C-Dz482 in Ampr bacteria. The DNAzymes were extracted from 3 ml cultures of the TEM-1 and TEM-3 and then resolved on 0.7% agarose gels. DNA bands were visualized by staining with ethidium bromide. Control (Ctrl) denotes a C-Dz482 preparation whose identity was verified by DNA sequencing.

 
Our circular DNAzymes were designed to cleave the ß-lactamase mRNA and thus may serve as ß-lactamase inhibitors (22). In principle, inhibition of ß-lactamase expression by DNAzymes should render Ampr bacteria to lose Ampicillin resistance and fail to grow in the presence of Ampicillin. To evaluate the activity of the circular DNAzymes in bacteria, Ampr bacteria were transfected by electroporation with either the plain M13mp18 vector or the circular DNAzymes and their mutants, and the growth rates of the transformed bacteria were analyzed (23,24). Similar transformation efficiencies of about 3~6 x 107 plaques/µg DNAzyme were obtained for all transformation experiments performed to ensure phase synchronization. The data shown in Figure 3A demonstrate a marked growth inhibition of the bacteria by expression of circular DNAzymes but not by the plain vector and inactive mutant DNAzymes. At the 9 h time point when all the bacteria were at logarithmic growth phase, OD600 differences ({Delta}OD = ODCtrl – ODC-Dz) of 0.37 and 0.57 were observed with C-Dz7 and C-Dz482, respectively, which corresponds to respective growth inhibition rates ({Delta}OD/ODctrl) of 46% and 71% (Fig. 3B). Incidentally, the ß-lactamase activities observed with C-Dz7- and C-Dz482-treated TEM-1 bacteria were about 53% and 67% less than that obtained with the plain vector-treated cells, respectively. These results demonstrate a correlation between the retarded cell growth and the decreased ß-lactamase activity caused by the circular DNAzymes. Importantly, the two mutant DNAzymes, C-Dz482m1 and C-Dz482m2, neither inhibited cell growth nor reduced ß-lactamase activity. This indicates that the catalytic activity of the circular DNAzymes rather than antisense DNA binding or DNA transfection is responsible for cell growth inhibition. Data in Figure 3A and B also demonstrate that C-Dz482 had no effect on TEM-1 bacteria growing in the absence of ampicillin. This provides evidence that the circular DNAzymes inhibit bacterial growth by suppressing ampicillin resistance. Note that in the absence of ampicillin, the bacterial cells expressed a much lower ß-lactamase activity (see ‘-Amp’ bars in Fig. 3B). This is determined by the nature of the cells and is not related to expression of the circular DNAzymes. We also analyzed the effects of the added Mg2+ on the inhibitory function of the circular DNAzymes. As shown by the ‘-Mg2+’ bars in Figure 3B, in the absence of added Mg2+, although at a reduced level, C-Dz482 still caused a significant growth inhibition of TEM-1 cells and a marked suppression of ß-lactamase activity. Apparently, the circular DNAzyme remains functional in the bacterial cells without the addition of extra Mg2+ to the medium. Presumably, the bacterial cells possess a strong ability to retain a sufficient intracellular Mg2+ concentration to keep the circular DNAzymes functional.




View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Activities of the circular DNAzymes in TEM-1 bacteria. (A) Growth curves of TEM-1 cells transfected with vector control (M13mp18), active and inactive mutant circular DNAzymes as indicated. (B) Growth rates (measured as OD600) and ß-lactamase activities (shown as {Delta}A490) of cultured TEM-1 cells 9 h after the electroporation of the indicated plasmid DNAs. ‘-Amp’ and ‘-Mg2+’ denote that cells were cultured in the absence of ampicillin and with the addition of Mg2+, respectively. Data represent mean ± SD (n = 4).

 
Dependence of DNAzyme activity on divalent metal ions
Divalent metal ions are known to play a critical role in promoting association of DNAzymes with their substrates and subsequent cleavage (3,4,25). To examine the dependence of circular DNAzyme on divalent metal ions, we tested several common metal ions. Data shown in Figure 4A demonstrate that C-Dz482 displayed a strong metal ion dependency. In the absence of metal ions, C-Dz482 displayed essentially no activity. Addition of Zn2+, Co2+ and Ba2+ did not cause any increase in activity, indicating that these metal ions are not co-factors of circular DNAzyme. In contrast, Mn2+, Pb2+, Mg2+ and Ca2+ markedly stimulated its activity with Mn2+ being the strongest activator. We further determined the dose–response of C-Dz482 to Mg2+. As shown in Figure 4B, the kcat values of C-Dz482 increased with increases in Mg2+ concentration. This metal ion dependency of circular DNAzymes is similar to that observed with linear DNAzymes (1,4).



View larger version (50K):
[in this window]
[in a new window]
 
Figure 4. Dependence of the substrate cleavage rate on divalent metal ions. (A) DNAzyme activity assays were carried out with 100 nM C-Dz482 and 10 nM 32P-labeled RNA substrate in the absence (control) or presence of 10 mM divalent metal ions as indicated. (B) kcat values of C-Dz482 were determined in the presence of indicated concentration of Mg2+. See Materials and Methods for details.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A novel replicating circular DNAzyme was constructed by cloning the 10–23 DNAzyme into M13mp18 vector. The DNAzyme was not only capable of replication in bacteria, but also showed high activities in vitro and in bacterial cells. Our study thus provides a general strategy to replicate DNAzymes in bacteria by using single-stranded DNA vectors. This also provides a highly efficient way to amplify a large amount of DNAzymes. To our knowledge, this is the first example where a single-strand vector has been used as a carrier to replicate DNAzymes.

The circular DNAzymes showed high activities both in vitro and in TEM-1 bacteria (Table 2 and Fig. 3), suggesting that the activation center (antisense arms and the catalytic core) of the circular DNAzymes may predispose the surface to favor substrate binding. Bai and colleagues demonstrated that liquid plasmid DNA exists in an unfolded state and forms a ring structure between 30 and 40°C when imaged under an atomic force microscope (26,27). Apparently, some of the circular DNAzymes were in an unfolded state, since we observed that in vitro activity of the circular DNAzyme was lower than that of the linear DNAzyme (Table 2). This implies that the activity centers of some of the circular DNAzyme molecules may likely be entrapped inside the super coil of the phage DNA vector, making a proportion of circular DNAzymes inactive. The in vitro denaturation experiments seem to support this, since the denaturation increased the in vitro activity of the circular DNAzymes significantly (Table 2). The circular DNAzyme molecule was in an unfolded state after denaturation, releasing the extra secondary structure in favor of the substrate binding.

Similar to that of the linear DNAzymes, the catalysis of the circular DNAzymes requires divalent metal ions including Mn2+, Pb2+, Mg2+ and Ca2+ as cofactors. Furthermore, detailed kinetic studies with Mg2+ showed that the dependence of kcat on Mg2+ concentrations is similar to that of the linear DNAzymes (Fig. 4) (1,4). Metal ions may play an important role in enzymatic reaction in three aspects: First, they may aid the stabilization of the transition state and assist the circular DNAzyme folded into its catalytic conformation (4,28); second, they may directly participate in the processes of the substrate cleavage reaction (3,4); third, they may increase the substrate association rate because of the counterion-condensation model for nucleic acid helix formation (29,30). In all, the similarity between circular and linear DNAzymes in the divalent metal ion requirement and dependency suggests similar reaction mechanisms. The circular DNAzyme-catalyzed reactions may follow the mechanism hypothesized for the hammerhead ribozyme which also requires divalent metal ions (31,32).

In conclusion, we report herein a feasible single strand expression system of phage for DNAzymes. The expressed DNAzymes displayed cleavage activities both in vitro and in bacteria. Although we designed the recognizing sequence of DNAzyme specifically against the ß-lactamase mRNA and demonstrated inhibitory effects on bacterial growth, we cannot at present rule out the possibility of nonspecific effects contributing to the results. This point warrants further study to improve this expression system in the future.


    ACKNOWLEDGEMENTS
 
We thank Zhizhuang Joe Zhao (Department of Medicine, Vanderbilt University, Nashville, TN) and Roberta Verley (Department of Biology, Northern Michigan University, Marquette, MI) for critical reading of this manuscript. This work was supported by grants from the National Natural Science Foundation of China (General Program No. 30171118).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Santoro,S.W. and Joyce,G.F. (1997) A general purpose RNA cleaving DNAzyme. Proc. Natl Acad. Sci. USA, 94, 4262–4266.[Abstract/Free Full Text]

  2. Breaker,R.R. (2000) Making catalytic DNAs. Science, 290, 2095–2096.[Free Full Text]

  3. Sun,L.-Q., Cairns,M.J., Saravolac,E.G., Baker,A. and Gerlach,W.L. (2000) Catalytic nucleic acids: from lab to applications. Pharmacol. Rev., 52, 325–347.[Abstract/Free Full Text]

  4. Santoro,S.W. and Joyce,G.F. (1998) Mechanism and utility of an RNA-cleaving DNA enzyme. Biochemistry, 37, 13330–13342.[CrossRef][Medline]

  5. Khachigian,L.M. (2002) DNAzymes: cutting a path to a new class of therapeutics. Curr. Opin. Mol. Ther., 4, 119–121.[ISI][Medline]

  6. Finkel,E. (1999) DNA cuts its teeth—as an enzyme. Science, 286, 2441–2442.[Free Full Text]

  7. Kurreck,J., Birgit,B., Jahnel,R. and Erdmann,V.A. (2002) Comparative study of DNA enzyme and ribozymes against the same full-length messenger RNA of the vanilloid receptor subtype I. J. Biol. Chem., 277, 7099–7107.[Abstract/Free Full Text]

  8. Kong,X.-D., Zhu,S.-Z., Gou,X.-J., Wang,X.-P., Zhang,H.-Y. and Zhang,J. (2002) A circular RNA–DNA enzyme obtained by in vitro selection. Biochem. Biophys. Res. Commun., 292, 1111–1115.[CrossRef][ISI][Medline]

  9. Dass,C.R., Saravolac,E.G., Li,Y. and Sun,L.-Q. (2002) Cellular uptake, distribution and stability of 10–23 deoxyribozymes. Antisense Nucleic Acid Drug Dev., 12, 289–299.[CrossRef][ISI][Medline]

  10. Emilsson,G.M. and Breaker,R.R. (2002) Deoxyribozymes: New activities and new applications. Cell. Mol. Life Sci., 59, 596–607.[CrossRef][ISI][Medline]

  11. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning. 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, pp. 4.21–4.43.

  12. Sun,L.-Q., Cairns,M.J., Gerlach,W.L., Witherington,C., Wang,L. and King,A. (1999) Suppression of smooth muscle cell proliferation by a c-myc RNA-cleaving deoxyribozyme. J. Biol. Chem., 274, 17236–17241.[Abstract/Free Full Text]

  13. Imanaka,T., Tanaka,T., Tsunekawa,H. and Aiba,S. (1981) Cloning of the genes for penicillinase, penP and penI, of Bacillus licheniformis in some vector plasmids and their expression in Escherichia coli, Bacillus subtilis and Bacillus licheniformis. J. Bacteriol., 147, 776–786.[Abstract/Free Full Text]

  14. Goila,R. and Banerjea,A.C. (2001) Inhibition of hepatitis B virus X gene expression by novel DNA enzymes. Biochem. J., 353, 701–708.[CrossRef][ISI][Medline]

  15. Sioud,M. and Leirdal,M. (2000) Design of nuclease resistant protein kinase alpha DNA enzymes with potential therapeutic application. J. Mol. Biol., 296, 937–947.[CrossRef][ISI][Medline]

  16. Liu,C., Cheng,R., Sun,L.-Q. and Tien,P. (2001) Suppression of platelet-type 12-lipoxygenase activity in human erythroleukemia cells by an RNA-cleaving DNAzyme. Biochem. Biophys. Res. Commun., 284, 1077–1082.[CrossRef][ISI][Medline]

  17. Cairns,M.J., King,A. and Sun,L.-Q. (2000) Nucleic acid mutation analysis using catalytic DNA. Nucleic Acids Res., 28, E9.

  18. Ota,N., Warashina,M., Hirano,K., Hatanaka,K. and Taira,K. (1998) Effects of helical structures formed by the binding arms of DNAzymes and their substrates on catalytic activity. Nucleic Acids Res., 26, 3385–3391.[Abstract/Free Full Text]

  19. Khachigian,L.M. (2000) Catalytic DNAs as potential therapeutic agents and sequence-specific molecular tools to dissect biological function. J. Clin. Invest., 106, 1189–1195.[ISI][Medline]

  20. Ferrari,D. and Peracchi,A. (2002) A continuous kinetic assay for RNA-cleaving deoxyribozymes, exploiting ethidium bromide as an extrinsic fluorescent probe. Nucleic Acids Res., 30, E112.

  21. Cairns,M.J., Hopkins,T.M., Witherington,C., Wang,L. and Sun,L.-Q. (1999) Target site selection for an RNA-cleaving catalytic DNA. Nat. Biotechnol., 17, 480–486.[CrossRef][ISI][Medline]

  22. Sandanayaka,V.P. and Prashad,A.S. (2002) Resistance to beta-lactam antibiotics: structure and mechanism based design of beta-lactamase inhibitors. Curr. Med. Chem., 9, 1145–1165.[ISI][Medline]

  23. Good,L., Awasthi,S.K., Dryselius,R., Larsson,O. and Nielsen,P.E. (2001) Bactericidal antisense effects of peptide-PNA conjugates. Nat. Biotechnol., 19, 360–364.[CrossRef][ISI][Medline]

  24. Good,L. and Nielsen,P.E. (1998) Inhibition of translation and bacterial growth by peptide nucleic acid targeted to ribosomal RNA. Proc. Natl Acad. Sci. USA, 95, 2073–2076.[Abstract/Free Full Text]

  25. Sen,D. and Geyer,C.R. (1998) DNA enzymes. Curr. Opin. Chem. Biol., 2, 680–687.[CrossRef][ISI][Medline]

  26. Wang,X.W., Bai,C.-L., Tian,F. and Shang,G.Y. (1996) Plasmid DNA structures in different ranges of temperature studied by atomic force microscopy. Acta Biophys. Sin., 12, 554–557.

  27. Feng,X.Z., Lin,Z., Wang,S. and Bai,C.-L. (1999) The investigation of the various structures of DNA molecules. (3) The coil globe transition of {lambda}-DNA induced by the cation surfactant. Sci. China C Life Sci., 29, 39–44.

  28. Geyer,C.R. and Sen,D. (1998) Lanthanide probes for a phosphodiester-cleaving, lead-dependent, DNAzyme. J. Mol. Biol., 275, 483–489.[CrossRef][ISI][Medline]

  29. McConnell,T.S., Herschlag,D. and Cech,T.R. (1997) Effects of divalent metal ions on individual steps of the Tetrahymena ribozyme reaction. Biochemistry, 36, 8293–8303.[CrossRef][Medline]

  30. Manning,G.S. (1978) The molecular theory of polyelectrolyte solutions with applications to the electrostatic properties of polynucleotides. Rev. Biophys., 11, 179–246.

  31. Warashina,M., Takagi,Y., Stec,W.J. and Taira,K. (2000) Differences among mechanisms of ribozyme-catalyzed reactions. Curr. Opin. Biotechnol., 11, 354–362.[CrossRef][ISI][Medline]

  32. Zhou,D.M. and Taira,K. (1998) The hydrolysis of RNA: From theoretical calculations to the hammerhead ribozyme-mediated cleavage of RNA. Chem. Rev., 98, 991–1026.[CrossRef][ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
S. K. Silverman
In vitro selection, characterization, and application of deoxyribozymes that cleave RNA
Nucleic Acids Res., November 11, 2005; 33(19): 6151 - 6163.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (212K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Chen, F.
Right arrow Articles by Zhang, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, F.
Right arrow Articles by Zhang, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?