Published online 27 October 2005
Article |
Depletion of TDP 43 overrides the need for exonic and intronic splicing enhancers in the human apoA-II gene
1International Centre for Genetic Engineering and Biotechnology Padriciano 99, I-34012 Trieste, Italy 2Department of Physiology and Pathology, University of Trieste Via A. Fleming 22, 34127 Trieste, Italy
*To whom correspondence should be addressed. Tel: +39 040 3757337; Fax: +39 040 3757361; Email: baralle{at}icgeb.org
Received August 2, 2005. Revised September 19, 2005. Accepted September 27, 2005.
| ABSTRACT |
|---|
|
|
|---|
Exon 3 of the human apolipoprotein A-II (apoA-II) gene is efficiently included in the mRNA although its acceptor site is significantly weak because of a peculiar (GU)16 tract instead of a canonical polypyrimidine tract within the intron 2/exon 3 junction. Our previous studies demonstrated that the SR proteins ASF/SF2 and SC35 bind specifically an exonic splicing enhancer (ESE) within exon 3 and promote exon 3 splicing. In the present study, we show that the ESE is necessary only in the proper context. In addition, we have characterized two novel sequences in the flanking introns that modulate apoA-II exon 3 splicing. There is a G-rich element in intron 2 that interacts with hnRNPH1 and inhibits exon 3 splicing. The second is a purine rich region in intron 3 that binds SRp40 and SRp55 and promotes exon 3 inclusion in mRNA. We have also found that the (GU) repeats in the apoA-II context bind the splicing factor TDP-43 and interfere with exon 3 definition. Significantly, blocking of TDP-43 expression by small interfering RNA overrides the need for all the other cis-acting elements making exon 3 inclusion constitutive even in the presence of disrupted exonic and intronic enhancers. Altogether, our results suggest that exonic and intronic enhancers have evolved to balance the negative effects of the two silencers located in intron 2 and hence rescue the constitutive exon 3 inclusion in apoA-II mRNA.
| INTRODUCTION |
|---|
|
|
|---|
The pre mRNA splicing process leading to the synthesis of mature mRNA takes place in the spliceosome, a complex of small ribonucleoprotein particles (snRNPs) and splicing factors and is finely modulated (1,2). Cis-acting elements that influence splice site selection include the 5' and 3' splice sites, the branch point sequence and the polypyrimidine tract. Beyond the above mentioned canonical cis-acting elements, accessory sequences, such as exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs), intronic splicing enhancers (ISEs) and intronic splicing silencers (ISSs) are also important for the definition of an exon (3,4).
Recently, we have demonstrated the existence of an ESE within the third exon of the apolipoprotein A-II (apoA-II) gene that specifically binds the SR proteins ASF/SF2 and SC35. The mutagenesis of this element prevented the binding of these trans-acting elements and caused in vivo skipping of exon 3 (5). Moreover, overexpression of ASF/SF2 and SC35 improved exon 3 inclusion, further supporting the positive involvement of these factors in exon 3 definition. Mechanistically, the recruitment of ASF/SF2 and SC35 might be acting as part of a scaffold to allow the recognition of the 3' splice site, whose polypyrimidine tract is weak because of the peculiar (GU)16 stretch adjacent to the intron/exon junction, which previous functional studies have indicated as a controller of exon 3 splicing (5). In this paper we show that the (GU)16 stretch in the apoA-II context also binds the TDP-43 protein, a splicing factor implicated in the CFTR exon 9 skipping through its interaction with the (GU) repeats located within the 3' splice site of CFTR intron 8 (6). Thus, we have revisited the function of the (GU) tract in apoA-II intron 2 by demonstration that its interaction with TDP-43 has an inhibitory role for the splicing of apoA-II exon 3, similarly to what was observed for the splicing of CFTR exon 9. Moreover, we have characterized a novel negative cis-acting element within apoA-II IVS2 and a positive cis-acting element in IVS3 involved in the control of the apoA-II exon 3 splicing. Interestingly, RNA interference against TDP-43 abolishes the effects of both exonic and intronic enhancer disruption. This result seems to indicate that ESEs and ISEs in the human apoAII gene have evolved to counteract the negative effect of TDP43 binding to the (GU) repeats.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Constructs
The wild-type and A97T sets of the pcDNApoIVS2 and pcDNApoIVS3 constructs were generated throughout overlap PCR method using apoA-II gene and apoA-II cDNA as templates. All pApo constructs carrying deletions or point mutations were generated by site-directed mutagenesis using standard PCR conditions. The identity of all constructs was checked by a CEQ2000 sequencer (Beckman Coulter, Fullerton, CA) according to the manufacturer's instructions. Constructs PTBApo-wt and PTBApo-A97T as well as PTBApo-wt-ISEmut and PTBApo-A97T-ISEmut were generated as follows: the apoA-II exon 3 plus portions of both flanking introns 2 (174 nt) and 3 (116 nt) were PCR-amplified from pApo-wt and pApo-A97T, respectively, and filled in with DNA polymerase (Klenow). The fragment was then inserted in a modified version of the
-globinfibronectin EDB minigene in which this alternatively spliced exon had been removed to generate a unique Nde I site which was subsequently filled in with DNA polymerase I (Klenow) treatment, making it suitable for the insertion of the exon and its flanking introns under study. Constructs carrying partial deletions of either intron 2 or intron 3 were prepared starting from templates pApo-wt and pApo-A97T. The deletions were performed by overlapping PCRs products obtained using suitable primers. Generation of constructs mg(GU)16 and mg
(GU) for in vitro experiments was carried out amplifying from pApo-wt and
(gu) plasmids (5) with the following couple of primers: SXhoI (5'-cccgctcgagcactgttaccaacatgaagct-3') and HindIII/SacII AS (5'-ttttccgcggaagcttctctgcgaattctaagcctaatctgccctaa-3'). Whereas generation of construct (GU)16-Ex3 was performed with the primers: ApoAII-TG/Exon35' (XhoI) (5'-cccgctcgagggacccagctgaaaagag-3') and ApoAII-Exon33' (SacII) (5'-ttttccgcggaagcttttggcctcggcctgaa-3').
Transfections
The DNA used for transient transfections was prepared with JetStar purification kit (Genomed, GmbH, Löhne, Germany) following the manufacturer's instructions. Then, 3 µg of DNA construct was transfected in 3 x 105 human hepatocarcinoma Hep3B cells using Qiagen Effectene transfection reagents. Total RNA was extracted using RNAwiz reagent (Ambion, Austin, TX) and retro-transcribed with poly(dT) primer. To amplify only the messenger derived from the transfections, PCRs were carried out with primers Ex11221 S (5'-accaaggacagagacgctggct-3') and Not/Cla rev (5'-tctggacactgcggccgcatcg-3') for constructs derived from pApo gene system and with primers
(5'-caacttcactcctaagccactg-3') and Bra (5'-gggtcaccaggaagttggttaaatca-3') for constructs derived from the
-globinfibronectin EDB minigene (PTB). The conditions used for the PCRs were the following: 94°C for 5 min for the initial denaturation, 94°C for 30 min, 60°C for 1 min, 72°C for 1.5 min for 35 cycles, and 72°C for 7 min for the final extension. The PCRs were optimized to be in the exponential phase of amplification. For the SR protein overexpression experiments, 2 µg of the constructs pApo-wt, pApo-ISE3m, pApoA97T or pApoA97T-ISE3m was cotransfected with 2 µg of SRp40 and SRp55 coding sequences cloned into pCG vector (a kind gift of Dr J. Caceres). The results of all the transfections are the representative of at least three independent experiments. In order to quantify the proportion of alternative splicing, the relative amount of exon 3 skipping was quantified by optical densitometry.
RNA electrophoretic mobility shift assay (EMSA) and UV-crosslinking of protein and RNA
In order to generate the two different versions of human apoA-II intron 3 ISE RNAs, EcoRISalI double digestion was carried out on the construct pApo-wt and pApo-wt-ISE mut and subsequently cloned in pBluescript (SK) plasmid digested with the same enzymes. Once linearized with EcoRI, the constructs were in vitro transcribed in the presence of [
-32 P]UTP for 60 min at 37°C and treated with DNase for the same period of time. For EMSA, the [
-32P]UTP-labeled RNA probes (46 fmol) were incubated with 5.2 mM HEPES, pH 7.9, 1 mM MgCl2, 0.8 mM magnesium acetate, 0.52 mM DTT, 3.8% glycerol, 0,75 mM ATP, 1 mM GTP, 0.5 µg/µl heparin and 30 µg of HeLa nuclear extract (4C Biotech, Seneffe, Belgium) in a final volume of 20 µl for 20 min at room temperature. Following the addition of 5 µl of 50% (v/v) glycerol and tracking dye, the complexes were resolved on a 4% polyacrylamide gel (ratio of 19:1 acrylamide/bisacrylamide) in 75 mM Trisglycine buffer (75 mM Tris and 75 mM glycine) at 1525 mA for 34 h at 4°C. The gels were dried and exposed to X-OMAT AR films for 13 h. The UV-crosslinking assay was performed by incubation of the [
-32P]UTP-labeled RNA probes (1 x 106 c.p.m./incubation) with 20 µg of HeLa nuclear extract in 20 µl of final volume at 30°C for 15 min. Final binding conditions were 20 mM HEPES, pH 7.9, 72 mM KCl, 1.5 mM MgCl2, 0.78 mM magnesium acetate, 0.52 mM DTT, 3.8% glycerol, 0.75 mM ATP, 1 mM GTP and heparin at a 5 µg/µl final concentration as a nonspecific competitor. In the competition experiments increasing amounts of cold RNA (the molar ratios of cold/labeled RNA were 3 and 6) was also added as a competitor 5 min before addition of the labeled RNAs. The samples were then transferred in the wells of an HLA plate (Intermed, Nunc, Roskilde, Denmark) and irradiated with UV light on ice (800 000 kJ for 5 min). Unbound RNA was then digested with 30 µg of RNase A and 6 U of RNase T1 (Sigma) by incubation at 37°C for 30 min. The samples were then analyzed by 10% SDSPAGE followed by autoradiography.
Crosslinking of RNA to adipic dehydrazide-agarose beads
Two synthetic RNA oligos IVS2-G123w, auaccuuuuuggggagggggcagagagc, and IVS2n-G123m, auaccuuuuugcggagcgcgcagagagc (Dharmacon, Chicago, IL), were generated and crosslinked to adipic dehydrazideagarose beads. Afterwards they were separately incubated with HeLa nuclear extract with the addition of heparin to a final concentration of 5 µg/µl. Proteins were separated on a 10% SDSPAGE gel and visualized by Coomassie brilliant blue staining or electroblotted onto a nitrocellulose membrane and probed with a rabbit polyclonal anti-hnRNPH antiserum. Immunoblottings were detected using the ECL chemiluminescence kit (Pierce, Rockford, IL).
Immunoprecipitation of SR proteins and TDP-43 following UV-crosslinking
The UV-crosslinking of labeled RNAs with commercial HeLa nuclear extract was performed as described above. After the 30 min incubation with RNase at 37°C, 150 µl of immunoprecipitation (IP) buffer (20 mM Tris, pH 8.0, 300 mM NaCl, 1 mM EDTA and 0.25% Nonidet P-40) was added to each sample together with 1 µg of monoclonal antibodies mouse anti-SR 1H4 (Zymed Laboratories Inc., San Francisco, CA) and incubated for 2 h at 4°C on a rotator wheel. Afterward, 30 µl of protein A7G-Plus-agarose (Santa Cruz Biotechnology, Santa Cruz, CA) was added to each sample and incubated overnight at 4°C. The beads were subjected to four washing cycles with 1.5 ml of IP buffer and loaded on a 10% SDSPAGE. The gels were run at a constant rate of 30 mA for 3.5 h, dried and exposed for 46 days with a Biomax Screen (Kodak, Rochester, NY). The [
-32P]UTP-labeled RNA probes mg(GU)16, mg
(GU) and (GU)16-Ex3 used for UV-cross linking/IP were treated as described above, with the only difference that 1 µg of polyclonal antiserum against TDP-43 was added. After a 2 h incubation, 30 µl of Protein A/G-Plus Agarose (Santa Cruz Biotechnologies) was added to each sample and the mixture was incubated at 4°C overnight. The beads were then subjected to four washing cycles with 1.5 ml of IP buffer and loaded onto an SDSPAGE. Gels were run at a constant 30 mA for
3.5 h, dried, and then exposed for 46 days with a BioMax Screen (Kodak). Three independent IP assays were carried out for each antibody.
RNA interference against TDP-43
Hep3B cells (2 x 105) were seeded 24 h before the first transfection with the small interfering RNA (siRNA) oligonucleotide specific for TDP-43 (Y. M. Ayala, personal communication). Oligofectamine (3 µl) (Invitrogen BV, Leek, The Netherlands) was combined with 13 µl of Optimem medium (Invitrogen) and incubated for 7 min at room temperature (RT) (reaction 1). Meanwhile, in a different tube, 2.5 µl of the TDP-43 siRNA was mixed with 180 µl of Optimem (reaction 2). After the incubation, both reactions were mixed and left for 20 min at RT. Afterwards, the mix was added to the cells and maintained in the incubator at 37°C and 6% of CO2 for 48 h. The cells were then washed with phosphate-buffered saline (PBS) and the transfection procedure was repeated with the difference that cells were maintained for only 24 h. Cells were washed with PBS and transfected with 0.5 µg of each minigene using Qiagen Effectene transfection reagents. RNA extraction and RTPCR analysis were performed using primers complementary to sequences in the flanking fibronectin exonic sequences. Cell lysates were collected and analyzed for hnRNP H1 endogenous protein expression by western analysis using anti-H1 rabbit serum.
| RESULTS |
|---|
|
|
|---|
An intronic splicing enhancer is present within apoA-II intron 3
Our previous studies have evidenced that (i) the 3' splice site of IVS2 is weak because of the (GU) tract adjacent to the acceptor site and (ii) a positive splicing cis-acting element (ESEwt) is placed within exon 3 and its alteration by point mutations (ESE-A97T) causes exon 3 skipping (5). In general, the interplay among different exonic and/or intronic sequences and the trans-acting factors can influence the recruitment of the constitutive splicing factors U2AF65 and U1 to the 3' and 5' splice site, respectively. We were interested to identify other apoA-II exon 3 splicing control elements eventually placed within its intronic flanking regions and to test these potential cis-acting elements in an heterologous system. For this purpose, the wild-type and A97T ApoA-II exon 3 (133 nt) with its flanking intronic regions (174 nt of intron 2 and 116 nt of intron 3) were cloned into the third intron of the pTB vector, which is an
-globin/fibronectin reporter minigene system used to study alternative splicing of several exons (7,8). (Figure 1A). The splicing profile from pTB minigenes overlapped those obtained with the pApo constructs (Figure 1B). In fact, pTBApo-wt and pTBApo-A97T constructs yielded 5 and 85% of exon 3 exclusion (Figure 1B, lanes 3 and 4), so mimicking substantially the splicing ratio from the corresponding variants in apoAII gene context (Figure 1B, lanes 1 and 2). These results indicate that the 423 nt genomic fragment of apoAII gene contains all the features important for efficient exon 3 inclusion in apoAII mRNA. Therefore, the pTB constructs can be used to the following mapping of potential intronic cis-acting elements that influence exon 3 splicing.
|
Initially, in order to verify the eventual presence of other apoA-II exon 3 splicing control elements, we screened its intronic flanking regions looking for possible cis-acting elements whose sequence might resemble previously described modulators of splicing. In order to look for other splicing control elements in IVS3, we created a deletion of 97 nt in intron 3 (from nt 1925 to 2022 in the apoA-II gene; GenBank accession number X04898.1) so obtaining the construct pApo-wt-
19252022 (Figure 1C). This 97 nt-deletion caused a 40% skipping of the exon 3 (Figure 1E, lane 3). This observation supports the existence of one or more elements within intron 3 that promote the inclusion of the apoA-II exon 3. We noticed the presence of three G runs in intron 3 just 10 bp downstream of the exon 3 donor splice site, namely I3G1 to I3G3, and a polypurine-rich sequence between nt 1935 and 1960 (Figure 1C). As these elements are close to the splice sites of exon 3, we have explored first the possible effects of G runs on the control of the apoA-II exon 3 splicing. To this aim, we first created mutants where the third, the first two and all the three G runs were disrupted by point mutations in intron 3. However, the transient transfection of this mutant did not show significant changes in the apoA-II exon 3 splicing pattern in comparison with the pApo-wt construct (Figure 1D). Thus, it is reasonable to exclude a role in the splicing of exon 3 for the G runs within intron 3. Conversely, the deletion of the purine-rich tract caused 25% apoA-II exon 3 skipping (Figure 1E, lane 4). In order to confirm the enhancing activity within nt 19411967, the continuity of the purine stretch was disrupted by site-directed mutagenesis in the apoA-II gene and in the pTBApo contexts. Thus, constructs pApo-ISE3m and pTBApo-ISE3m were generated (Figure 1A and C, respectively). Point mutations within the potential ISE placed in intron 3 caused 45% exon 3 skipping in the pApo context and 55% exon 3 skipping in the pTBApo context (Figure 1F, lanes 2 and 4, respectively). Thus, consistently with the data obtained by the deletion, the results of point mutations confirmed the positive role for the polypurine element (ISE3) independently from the context.
SRp40 and SRp55 overexpression enhances splicing of apoA-II exon 3
Once verified the presence of a putative intronic splicing enhancer within intron 3 (ISE3), we were interested in identifying trans-acting factors possibly binding this region. As a first approach, EMSA was carried out by using two in vitro transcribed RNAs carrying either the ISE3wt or the ISE3 disrupted by the point mutation (ISE3m) (Figure 2A). The analysis showed two bands of shifted material with the transcript carrying the ISE3wt (upper complex, Uc, and lower complex, Lc) and only one band with ISE3m RNA (Figure 2B, compare lanes 3 and 4). A possible explanation for the difference in the number and mobility of the RNAprotein complexes might be the assembly of different factor/s upon ISE3wt and ISE3m RNAs.
|
The purine-rich content of ISE3 was reminiscent of exonic enhancer sequences, in fact ESE finder prediction of putative SR protein binding sites (9) showed the presence within the ISE of a high score site for SRp40 (data not shown). Total UV-crosslinking profiles did not show additional differences (data not shown). Therefore, in order to test the possible recruitment of SR proteins by the ISE3wt and ISE3m transcripts, we carried out UV-crosslinking analysis followed by immunoprecipitation using the monoclonal antibody 1H4 (mAb1H4), that recognizes mainly the phosphorylated domain of SRp40, SRp55 and SRp75 (10). The results showed that the ISE3wt but not the ISE3m RNA was able to immunoprecipitate both SRp40 and SRp55 (Figure 2C). Afterward, to test functionally the putative positive effects of SRp40 and SRp55, two pTBApo constructs carrying both the ESE in exon 3 and the ISE3 mutated were generated. Then, plasmids capable to express these SR proteins were cotransfected first along with pApo-wt and pApo-ISE3m. Figure 2D shows that cotransfection of pApo-wt with both SRp40 and SRp55 promoted full exon 3 inclusion (upper panel, lanes 2 and 6) when compared with the cotransfections with the control vector (upper panel, lanes 1 and 5). However, the overexpression of SRp40 and SRp55 with the construct carrying the ISE3m point mutation showed no significant variation in exon 3 inclusion levels (upper panel, lanes 4 and 8). In order to highlight better the effects of SR proteins overexpression, we repeated the cotransfection experiments with pApo-A97T and pApoA97T-ISE3m constructs. Because of the disruption of the ESE within exon 3, the basal level of exon 3 exclusion is higher and the effects of SR proteins are more detectable. However, the positive effects of the overexpression of SRp40 and SRp55 should cause an increase of exon 3 inclusion because the ISE3 element is intact. Consistently with this prediction, the lower panel of Figure 2D shows that the cotransfection of pApoA97T with SRp40 (lane 2) and SRp55 (lane 6) promoted exon 3 inclusion. Conversely, no variation in the levels of exon 3 inclusion was observed when the construct carrying the mutated ISE was cotransfected (lanes 4 and 8). Altogether these results indicate that both SRp40 and SRp55 interact with the sequence named ISE3 and have a functionally positive effect on apoA-II exon 3 inclusion.
A G-rich element with context-dependent functions is localized within apoA-II intron 2 and binds hnRNP-H1
Analysis of the sequences upstream of the polypyrimidine tract (GU repeated sequence) of exon 3 showed a region between nt 1639 and 1666 composed of four G runs (namely I2G1, I2G2, I2G3 and I2G4) (Figure 3A). Therefore, to test if these elements could affect the splicing of apoA-II exon 3, site-directed mutagenesis was carried out in these elements by disrupting the single G runs using pApo A97T as template. Figure 3B shows that the disruption of single I2G1 or I2G2 run rescued >90% of exon 3 inclusion, whereas mutagenesis of G3 run rescued
60% of exon 3 inclusion (lanes 24, respectively). Conversely, the disruption of G4 as well as of T run immediately upstream of the G1 did not modify the splicing pattern of the pApo-A97T construct (lanes 5 and 6, respectively). Thus, these data suggest that G1, G2 and G3 runs have a negative effect on exon 3 inclusion in the apoA-II context. To confirm the role of these elements in apoA-II exon 3 splicing, we tested the effects of G runs mutagenesis also in the pTBApo context (Figure 3D). Surprisingly, the disruption of I2G1 and I2G2 runs caused >90% of exon 3 skipping (Figure 3D, lanes 2 and 3). However, the mutagenesis of I2G3 run did not show a significant variation of the pTBApowt splicing pattern (Figure 3D, lane 4). Therefore, the function of at least I2G1 and I2G2 runs in pTBApo do not mimic that in the pApo context. In fact, in the apoA-II gene context, they behave like an ISS, whereas in the pTBApo framework they behave like an ISE. This result underscores the importance of evaluating potential controlling regions in more than one minigene system. Nonetheless, in order to identify the trans-acting factors binding the G runs in the apoA-II intron 2 context, a pull-down assay was performed with synthetic RNA oligonucleotides containing either the I2G1 and I2G2 runs or the same sequence carrying point mutations within them (Figure 4A). This involved the crosslinking of transcribed IVS2-G12w and IVS2n-G12m RNAs to adipic acid dehydrazide agarose beads. Both beads preparations were separately incubated with HeLa nuclear extracts and the proteins bound were separated on an SDSPAGE gel and then analyzed by Coomassie blue staining. Figure 4B shows a prominent band of
58 kDa molecular weight that could be observed only with the IVS2-G12w RNA containing the intact G runs. Considering that hnRNP-H1 is a splicing factor able to bind G runs (11) a western blot analysis with a polyclonal antibody against this protein was carried out thus confirming that the 58 kDa protein band corresponds to hnRNP-H1 (Figure 4C).
|
|
TDP-43 binds to (GU)16 repeats in apoA-II intron 2 and represses exon 3 splicing
Our previous studies showed that, in the context of apoA-II, the (GU)16 repeats seem to be important for exon 3 splicing (5,12,13). However, we have also reported the identification of TDP-43 as a trans-acting factor able to interact with the (GU)m polymorphic repeat region upstream from the 3' splice site of the human CFTR exon 9 (6). In that report, it was demonstrated that TDP-43 has an inhibitory effect on exon 9 inclusion in the CFTR mRNA (6). This observation led us to investigate the possible role of this factor in the control of the apoA-II exon 3 splicing. In order to confirm the binding of TDP-43 to the (GU)16 tract of apoA-II intron 2, we prepared the construct mg(GU)16 that contains exon 2 and exon 3 sequences, the whole flanking intron 2 as well as the 5' splice site of intron 3 (Figure 5A). Moreover, two mutants where the whole GU repeated sequence was removed [mg
(GU)] or only a portion of IVS2 containing the GU tract with exon 3 and its 5' splice site [(GU)16-Ex3] were also prepared (Figure 5A). These constructs were in vitro transcribed in the presence of [
-32P]UTP and equal quantities of labeled transcripts were then used in a UV-crosslinking competition assay with HeLa nuclear extract. Figure 5B shows that, among the proteins that are crosslinked to the labeled mg(GU)16 RNA, the band with the apparent molecular weight of 50 kDa was competed away only when increasing amount of cold (GU)16-Ex3 RNA was added, but not when cold mg
(GU) was used as competitor (Figure 5B, compare lanes 1, 2 and 3 and 1, 4 and 5). Total competition was observed when the same mg(GU)16 unlabeled RNA was added as control (Figure 5B).
|
In order to demonstrate that TDP-43 was the 50 kDa protein binding the GU repeats, immunoprecipitation experiments following the UV-crosslinking with a polyclonal antiserum against TDP-43 was carried out. Constructs mg(GU)16 and mg
(GU) were in vitro transcribed in the presence of [
-32P]UTP and equal amounts of labeled transcripts were then used in a UV-crosslinking assay with HeLa nuclear extract (data not shown). The UV-crosslinked samples were subsequently immunoprecipitated with a polyclonal antiserum against TDP-43 (6). Figure 5C shows that TDP-43 can be specifically immunoprecipitated by the anti-TDP-43 antiserum following UV-crosslinking with nuclear extract of a mg(GU)16 RNA, but not from a mg
(GU) control RNA.
siRNA against TDP43 highlights the negative influence of this factor on apoA-II exon 3 splicing
In order to analyze the functional role that TDP-43 was playing in the apoA-II context, knock down of this protein was achieved through RNA-interference assay.
Double transfection of Hep3B cells at distance of 48 h with siRNA specific sequence for TDP-43 was carried out. After 24 h of the second transfection with the siRNA against TDP-43, constructs pApo-wt, pApo-A97T and pApo-ISE3m were transiently transfected in the TDP-43 knocked down Hep3B cells. Cell lysates were collected and analyzed for TDP-43 endogenous protein expression by western blot analysis using anti-TDP-43 rabbit serum. After normalization of total protein levels, we observed a strong reduction in the TDP-43 levels in Hep3B cells transfected with the TDP-43 siRNA, but not in untreated cells or in cells treated with a control siRNA (Figure 6A). Figure 6B shows the effects of TDP-43 silencing on splicing pattern analysis after RTPCR. An increase in exon 3 inclusion was detected in cell transfected with pApo-wt and, more importantly, total rescue of exon 3 inclusion was observed in cells transfected with pApo-A97T and pApo-ISE3m (Figure 6B, compare lanes 45 and 78, respectively).
|
These results further support the observation that the interaction of TDP-43 with GU repeats has a negative effect on splicing of adjacent apoA-II exon 3, similarly to what has been observed in the CFTR exon 9 context (14). Moreover, these experiments highlight how the suppression of TDP-43 expression overrides the effect of disrupting the positive splicing controlling elements such as the enhancers placed in exon and intron 3.
| DISCUSSION |
|---|
|
|
|---|
Previous studies by our group have shown that human apoA-II exon 3 contains at least one ESE that is important to balance the low strength of its 3' splice site (5). In this paper we considered that other elements, possibly located within flanking introns, might further contribute to the efficient splicing of exon 3.
A phylogenetic analysis of human apoA-II exon 3 and its flanking introns has evidenced that not only ESE sequence within exon 3 but also three other sequences are conserved in different species such as human, macaca, chimpanzee, mouse and rat with respect to the base composition and to the distance from the splice sites (Figure 7). The negative splicing element (GU) tract within intron 2 is conserved in chimpanzee (17 repeats) and Macaca fascicularia (7 repeats), whereas it is very short in rat (2 repeats) or absent in mouse. Interestingly, both the putative inhibitory G-rich element within intron 2 and the positive element within exon 3 are well conserved in all the species. Conversely, the ISE within intron 3 has a lower degree of homology in rodents (as compared with primate apoA-II genes). Therefore, these gene rearrangements might have placed negative cis-acting elements in proximity of the 3' splice junction of apoA-II intron 2 and may have activated an evolutionary selection of different mechanism of splicing in order to improve the constitutive inclusion of apoA-II exon 3.
|
There are several splicing control elements located within introns (1,15). They can be involved in recognition of the appropriate splice site or in the suppression or enhancement of certain splice site usage, particularly in alternative splicing cases.
Relatively little is known about the nature of the intronic splicing controlling elements. Generally, they do not obey defined consensus rules and are known to consist of diverse sequences (16) although some common intronic cis-acting elements have been observed, such as the GGG triplet (1719), purine-rich sequences (20,21) or polypyrimidine tracts commonly present in the 3' as well as 5' regions of introns (2224). It is known that the potential localization of intronic splicing cis-acting elements is extremely variable (20,25,26). We therefore considered the possible presence of splicing control elements in a range of 210 nt upstream of the exon 3 acceptor site and 116 nt downstream of the exon 3 donor site. The observation that the 26 nt-deletion of nt 19411967 in intron 3 causes exon 3 skipping strongly support the hypothesis that a sequence that positively controls the inclusion of exon 3 lies within that region. In a previous study, a purine-rich region (AGGAGAAGGGA) within the fibronectin EIIIB exon was found to interact with SRp40 (27). It was shown that this region is only partially responsible for stimulation of inclusion during SRp40 overexpression, and probably this protein acts at several different sites within the minigene. Interestingly, a sequence with a high degree of homology with the above described purine-rich region is present within the putative ISE3 within apoA-II intron 3 (AGAAGGGA). In addition, another study found that two GAR motifs are both required for stable interaction of SRp55 within the cardiac troponin T exon 5 (28). Moreover, it was noted that the binding of SRp55 to the target nucleotide sequence was efficient only when the whole cardiac troponin T exon 5 was present, suggesting that it can depend on RNA secondary structures. Indeed, in the apoA-II intron 3 context, the putative ISE-3 harbors a purine rich sequence. Therefore, the concomitant binding of SRp40 and SRp55 factors to the ISE3 region might occur, possibly by engaging other sequences outside the nt range 19411967 that spans the core of the ISE.
Previous studies on CFTR have shown that the interaction of SR proteins with intronic sequences inhibits the inclusion of the upstream proximal exon 9 in mRNA (7). However, there are other examples of ISEs that affect positively splicing of adjacent exons (29). The high contents of purines also might be indicative of a splicing control sequence since it seems to be the hallmark of these elements (3). In fact, we have demonstrated that the splicing factors SRp40 and SRp55 specifically bind the apoA-II transcript when ISE-3 is intact but not when it is mutagenized. Indeed, the positive involvement of SR proteins in apoA-II exon 3 splicing is supported by the fact that their overexpression improves exon 3 inclusion.
On the other side of exon 3, apoA-II intron 2 also seems to harbor different cis-acting elements involved in exon 3 splicing. Interestingly, we have identified a G-rich splicing control element whose activity is context-dependent: it has a silencer-like behavior within its natural apoA-II context, whereas it behaves like an enhancer-like element when placed in a heterologous context like that of fibronectin EDB. One possible explanation for this phenomenon is that the secondary structure of the G-rich region might change according to the context, so altering the accessibility of these sequences as demonstrated previously (3032). In this work, we have shown that hnRNPH1 is one of the factors that bind to the G runs within apoA-II intron 2. Recent studies on the distribution of G runs within introns have shown that they enhance usage of proximal splice sites (18,33,34). Furthermore, splicing of the c-src N1 exon was shown to be mediated by an ISE located downstream of the N1 5' splice site throughout interaction with hnRNP H (35). Conversely, other reports show that the G runs can have a silencer-like effect if placed within exons by binding to hnRNP H (19,3638). It is apparent that our findings highlighted a G run-based cis-acting element within apoA-II intron 2 whose peculiarity is given not only by inhibiting splicing of the proximal downstream exon, but also by the observation that its function can change according to the intronic context where it is localized (Figure 3B and D). In addition to a possible role of RNA structure, this context-dependent effect may also depend on interactions with the other splicing regulatory elements that are specific for the apoA-II gene. In addition, the enhancer/silencer activity might be affected by splicing events preceding the definition of apoA-II exon 3 or by the architecture of the transcriptional machinery (both constructs have different promoters) as demonstrated in other splicing models (39,40). Future studies will be aimed at characterizing the mechanisms of splicing control by G runs within IVS 2 and the role of hnRNP H1.
The other cis-acting element found close to the 3' splice site of intron 2 consists in the (GU)16 repeats that were previously shown to be functional as polypyrimidine tract (13). However, it is important the context where it is located: in fact, the replacement of the EDA exon polypyrimidine tract with the apoA-II (GT)16 tract resulted in 95% of EDA exon exclusion (5). Furthermore, previous experiments on the apoA-II model showed that either the deletion of (GU)16 tract or its replacement by (CA)16 promoted exon 3 skipping (5,12). In principle, it could not be excluded that the deletion might cause exon 3 exclusion through alteration of branch point 3' splice site spacing and that the replacement of (GU)16 by (CA)16 might interfere with the 3' splice site definition because of the binding to another factor, such as hnRNP L that was recently described as able to bind to (CA) repeats in the eNOS gene (41). We now have confirmed that the apoA-II (GU)16 repeats are bound specifically by TDP-43 protein, similarly to what happen in the CFTR intron 8 context (6). Considering that TDP-43 has a detrimental role for CFTR exon 9 splicing, we wondered if this factor might have a similar effect also in the apoA-II intron 2 context and that this effect was counteracted by the positive elements mapped above. Indeed, siRNA experiments to knock down TDP-43 in Hep3B cells have shown its inhibitory role also for apoA-II exon 3 splicing. This finding overlaps what was observed with CFTR exon 9, suggesting a general negative role of TDP-43 factors recruited by (GU) repeats placed at the 3' splice site. Moreover, the observation that the (GU) tract do not bind to U2AF65 (13) suggest that different mechanisms for 3' splice site recognition can exist. Altogether these observations further suggest that the 3' splice site definition of the apoA-II exon 3 might be supported by other strong cis-acting elements that can contrast the negative effects of TDP-43 binding in proximity of the 3' splice site of exon 3. The question arises if all these modulatory elements have evolved to counteract the negative influence of the weak 3' splice site or have additional role in apoA-II splicing. The negative effect of TDP-43 on exon 3 splicing is remarkably more evident when we transfected the constructs pApo-A97T and pApo-ISE3m in cells where the expression of that protein was blocked by siRNA: in fact, TDP-43 silencing was able to fully rescue the effects of both exonic and intronic enhancer mutations. This finding suggests that apoA-II exon 3 definition can tolerate the disruption of splicing enhancers on condition that the inhibitory effects of TDP-43 is relieved. It follows that exon 3 splicing results from the coordinate action of positive cis-acting elements that balance the negative influence on apoA-II exon 3 splicing derived from the elements located at the 3' end of intron 2. A large body of evidences indicates that U2AF35 is required for constitutive splicing and also works as a mediator of enhancer-dependent splicing (42). In vitro proteinRNA interaction studies with pre-mRNAs containing either a constitutive or regulated splicing enhancer have shown that U2AF35 directly mediates interactions between U2AF65 and proteins bound to the enhancers (43). On the basis of our data, in the apoA-II intron 2 context, without enhancers, U2AF65 should not work efficiently owing to the weakness of the polypyrimidine tract. We are temped to speculate that the interaction of TDP-43 with (GU) repeats and of hnRNPH1 to the G runs within intron 2 might interfere the function of U2AF65. Therefore, both the exonic and the intronic enhancers might have a pivotal role in definition of exon 3. However, the binding of ASF/SF2 and SC35 to the enhancer within exon 3 as well as the interaction of SRp40 and SRp55 to the sequence within intron 3 might be crucial to recruit the constitutive splicing factors U2AF35 and U2AF65 essential to define the 3' splice site of intron 2. In this way, a bridge-like structure among components bound to the 5' and 3' splice sites would be formed to define exon 3 independently of the polypyrimidine tract pathway.
| ACKNOWLEDGEMENTS |
|---|
This work was supported by grants from Telethon Onlus FoundationItaly (no. GGP02453) and F.I.R.B. (no. RBNE01W9PM) to F.E.B. Funding to pay the Open Access publication charges for this article was provided by ICGEB.
Conflict of interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Smith, C.W. and Valcarcel, J. (2000) Alternative pre-mRNA splicing: the logic of combinatorial control Trends Biochem. Sci., 25, 381388[CrossRef][ISI][Medline] .
- Black, D.L. (2003) Mechanisms of alternative pre-messenger RNA splicing Annu. Rev. Biochem., 72, 291336[CrossRef][ISI][Medline] .
- Blencowe, B.J. (2000) Exonic splicing enhancers: mechanism of action, diversity and role in human genetic diseases Trends Biochem. Sci., 25, 106110[CrossRef][ISI][Medline] .
- Hovhannisyan, R.H. and Carstens, R.P. (2005) A novel intronic cis element, ISE/ISS-3, regulates rat fibroblast growth factor receptor 2 splicing through activation of an upstream exon and repression of a downstream exon containing a noncanonical branch point sequence Mol. Cell. Biol., 25, 250263
[Abstract/Free Full Text] . - Arrisi-Mercado, P., Romano, M., Muro, A.F., Baralle, F.E. (2004) An exonic splicing enhancer offsets the atypical GU-rich 3' splice site of human apolipoprotein A-II exon 3 J. Biol. Chem., 279, 3933139339
[Abstract/Free Full Text] . - Buratti, E., Dork, T., Zuccato, E., Pagani, F., Romano, M., Baralle, F.E. (2001) Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping EMBO J., 20, 17741784[CrossRef][ISI][Medline] .
- Pagani, F., Buratti, E., Stuani, C., Romano, M., Zuccato, E., Niksic, M., Giglio, L., Faraguna, D., Baralle, F.E. (2000) Splicing factors induce CFTR exon 9 skipping through a non-evolutionary conserved intronic element J. Biol. Chem., 275, 2104121047
[Abstract/Free Full Text] . - Buratti, E., Dork, T., Zuccato, E., Pagani, F., Romano, M., Baralle, F.E. (2001) Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping EMBO J., 20, 17741784[CrossRef][ISI][Medline] .
- Cartegni, L., Wang, J., Zhu, Z., Zhang, M.Q., Krainer, A.R. (2003) ESEfinder: a web resource to identify exonic splicing enhancers Nucleic Acids Res., 31, 35683571
[Abstract/Free Full Text] . - Neugebauer, K.M. and Roth, M.B. (1997) Distribution of pre-mRNA splicing factors at sites of RNA polymerase ImI transcription Genes Dev., 11, 11481159
[Abstract/Free Full Text] . - Matunis, M.J., Xing, J., Dreyfuss, G. (1994) The hnRNP F protein: unique primary structure, nucleic acid-binding properties, and subcellular localization Nucleic Acids Res., 22, 10591067
[Abstract/Free Full Text] . - Shelley, C.S. and Baralle, F.E. (1987) Deletion analysis of a unique 3' splice site indicates that alternating guanine and thymine residues represent an efficient splicing signal Nucleic Acids Res., 15, 37873799
[Abstract/Free Full Text] . - Coolidge, C.J., Seely, R.J., Patton, J.G. (1997) Functional analysis of the polypyrimidine tract in pre-mRNA splicing Nucleic Acids Res., 25, 888896
[Abstract/Free Full Text] . - Buratti, E. and Baralle, F.E. (2001) Characterization and functional implications of the RNA binding properties of nuclear factor TDP-43, a novel splicing regulator of CFTR exon 9 J. Biol. Chem., 276, 3633736343
[Abstract/Free Full Text] . - Ladd, A.N. and Cooper, T.A. (2002) Finding signals that regulate alternative splicing in the post-genomic era Genome Biol., 3, reviews0008 .
- Fairbrother, W.G. and Chasin, L.A. (2000) Human genomic sequences that inhibit splicing Mol. Cell. Biol., 20, 68166825
[Abstract/Free Full Text] . - Carlo, T., Sterner, D.A., Berget, S.M. (1996) An intron splicing enhancer containing a G-rich repeat facilitates inclusion of a vertebrate micro-exon RNA, 2, 342353[Abstract] .
- McCullough, A.J. and Berget, S.M. (1997) G triplets located throughout a class of small vertebrate introns enforce intron borders and regulate splice site selection Mol. Cell. Biol., 17, 45624571[Abstract] .
- Romano, M., Marcucci, R., Buratti, E., Ayala, Y.M., Sebastio, G., Baralle, F.E. (2002) Regulation of 3' splice site selection in the 844ins68 polymorphism of the cystathionine b-synthase gene J. Biol. Chem., 12, 12 .
- McCullough, A.J. and Schuler, M.A. (1997) Intronic and exonic sequences modulate 5' splice site selection in plant nuclei Nucleic Acids Res., 25, 10711077
[Abstract/Free Full Text] . - Hastings, M.L., Wilson, C.M., Munroe, S.H. (2001) A purine-rich intronic element enhances alternative splicing of thyroid hormone receptor mRNA RNA, 7, 859874[Abstract] .
- Pagani, F., Buratti, E., Stuani, C., Bendix, R., Dork, T., Baralle, F.E. (2002) A new type of mutation causes a splicing defect in ATM Nature Genet., 30, 426429[CrossRef][ISI][Medline] .
- Zuccato, E., Buratti, E., Stuani, C., Baralle, F.E., Pagani, F. (2004) An intronic polypyrimidine-rich element downstream of the donor site modulates cystic fibrosis transmembrane conductance regulator exon 9 alternative splicing J. Biol. Chem., 279, 1698016988
[Abstract/Free Full Text] . - Hastings, M.L. and Krainer, A.R. (2001) Functions of SR proteins in the U12-dependent AT-AC pre-mRNA splicing pathway RNA, 7, 471482[Abstract] .
- Zheng, Z.M., Quintero, J., Reid, E.S., Gocke, C., Baker, C.C. (2000) Optimization of a weak 3' splice site counteracts the function of a bovine papillomavirus type 1 exonic splicing suppressor in vitro and in vivo J. Virol., 74, 59025910
[Abstract/Free Full Text] . - Rowen, L., Young, J., Birditt, B., Kaur, A., Madan, A., Philipps, D.L., Qin, S., Minx, P., Wilson, R.K., Hood, L., et al. (2002) Analysis of the human neurexin genes: alternative splicing and the generation of protein diversity Genomics, 79, 587597[CrossRef][ISI][Medline] .
- Du, K., Peng, Y., Greenbaum, L.E., Haber, B.A., Taub, R. (1997) HRS/SRp40-mediated inclusion of the fibronectin EIIIB exon, a possible cause of increased EIIIB expression in proliferating liver Mol. Cell. Biol., 17, 40964104[Abstract] .
- Nagel, R.J., Lancaster, A.M., Zahler, A.M. (1998) Specific binding of an exonic splicing enhancer by the pre-mRNA splicing factor SRp55 RNA, 4, 1123[Abstract] .
- Gallego, M.E., Gattoni, R., Stevenin, J., Marie, J., Expert-Bezancon, A. (1997) The SR splicing factors ASF/SF2 and SC35 have antagonistic effects on intronic enhancer-dependent splicing of the beta-tropomyosin alternative exon 6A EMBO J., 16, 17721784[CrossRef][ISI][Medline] .
- Buratti, E. and Baralle, F.E. (2004) Influence of RNA secondary structure on the pre-mRNA splicing process Mol. Cell. Biol., 24, 1050510514
[Free Full Text] . - Buratti, E., Muro, A.F., Giombi, M., Gherbassi, D., Iaconcig, A., Baralle, F.E. (2004) RNA folding affects the recruitment of SR proteins by mouse and human polypurinic enhancer elements in the fibronectin EDA exon Mol. Cell. Biol., 24, 13871400
[Abstract/Free Full Text] . - Muro, A.F., Caputi, M., Pariyarath, R., Pagani, F., Buratti, E., Baralle, F.E. (1999) Regulation of fibronectin EDA exon alternative splicing: possible role of RNA secondary structure for enhancer display Mol. Cell. Biol., 19, 26572671
[Abstract/Free Full Text] . - Sirand-Pugnet, P., Durosay, P., Brody, E., Marie, J. (1995) An intronic (A/U)GGG repeat enhances the splicing of an alternative intron of the chicken beta-tropomyosin pre-mRNA Nucleic Acids Res., 23, 35013507
[Abstract/Free Full Text] . - McCullough, A.J. and Berget, S.M. (2000) An intronic splicing enhancer binds U1 snRNPs to enhance splicing and select 5' splice sites Mol. Cell. Biol., 20, 92259235
[Abstract/Free Full Text] . - Chou, M.Y., Rooke, N., Turck, C.W., Black, D.L. (1999) hnRNP H is a component of a splicing enhancer complex that activates a c-src alternative exon in neuronal cells Mol. Cell. Biol., 19, 6977
[Abstract/Free Full Text] . - Chen, C.D., Kobayashi, R., Helfman, D.M. (1999) Binding of hnRNP H to an exonic splicing silencer is involved in the regulation of alternative splicing of the rat beta-tropomyosin gene Genes Dev., 13, 593606
[Abstract/Free Full Text] . - Jacquenet, S., Mereau, A., Bilodeau, P.S., Damier, L., Stoltzfus, C.M., Branlant, C. (2001) A second exon splicing silencer within human immunodeficiency virus type 1 tat exon 2 represses splicing of Tat mRNA and binds protein hnRNP H J. Biol. Chem., 276, 4046440475
[Abstract/Free Full Text] . - Pagani, F., Buratti, E., Stuani, C., Baralle, F.E. (2003) Missense, nonsense, and neutral mutations define juxtaposed regulatory elements of splicing in cystic fibrosis transmembrane regulator exon 9 J. Biol. Chem., 278, 2658026588
[Abstract/Free Full Text] . - Cramer, P., Pesce, C.G., Baralle, F.E., Kornblihtt, A.R. (1997) Functional association between promoter structure and transcript alternative splicing Proc. Natl Acad. Sci. USA, 94, 1145611460
[Abstract/Free Full Text] . - Pagani, F., Stuani, C., Zuccato, E., Kornblihtt, A.R., Baralle, F.E. (2003) Promoter architecture modulates CFTR exon 9 skipping J. Biol. Chem., 278, 15111517
[Abstract/Free Full Text] . - Hui, J., Stangl, K., Lane, W.S., Bindereif, A. (2003) HnRNP L stimulates splicing of the eNOS gene by binding to variable-length CA repeats Nature Struct. Biol., 10, 3337[CrossRef][ISI][Medline] .
- Graveley, B.R., Hertel, K.J., Maniatis, T. (2001) The role of U2AF35 and U2AF65 in enhancer-dependent splicing RNA, 7, 806818[Abstract] .
- Zuo, P. and Maniatis, T. (1996) The splicing factor U2AF35 mediates critical protein-protein interactions in constitutive and enhancer-dependent splicing Genes Dev., 10, 13561368
[Abstract/Free Full Text] .
This article has been cited by other articles:
![]() |
A. S. Chen-Plotkin, F. Geser, J. B. Plotkin, C. M. Clark, L. K. Kwong, W. Yuan, M. Grossman, V. M. Van Deerlin, J. Q. Trojanowski, and V. M.-Y. Lee Variations in the progranulin gene affect global gene expression in frontotemporal lobar degeneration Hum. Mol. Genet., May 15, 2008; 17(10): 1349 - 1362. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. R. A. Mackenzie, D. Foti, J. Woulfe, and T. A. Hurwitz Atypical frontotemporal lobar degeneration with ubiquitin-positive, TDP-43-negative neuronal inclusions Brain, May 1, 2008; 131(5): 1282 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. M. Ayala, T. Misteli, and F. E. Baralle TDP-43 regulates retinoblastoma protein phosphorylation through the repression of cyclin-dependent kinase 6 expression PNAS, March 11, 2008; 105(10): 3785 - 3789. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Neumann, L. K. Kwong, D. M. Sampathu, J. Q. Trojanowski, and V. M.-Y. Lee TDP-43 Proteinopathy in Frontotemporal Lobar Degeneration and Amyotrophic Lateral Sclerosis: Protein Misfolding Diseases Without Amyloidosis Arch Neurol, October 1, 2007; 64(10): 1388 - 1394. [Abstract] [Full Text] [PDF] |
||||
|
|

gcttatg, in pApo-








