Published online 20 October 2005
Article |
Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents
1College of Pharmacy, University of Arizona Tucson, AZ 85721, USA 2Department of Biochemistry and Molecular Biophysics, University of Arizona Tucson, AZ 85721, USA 3Department of Chemistry, University of Arizona Tucson, AZ 85721, USA 4Arizona Cancer Center 1515 N. Campbell Avenue, Tucson, AZ 85724, USA
*To whom correspondence should be addressed. Tel: +1 520 626 0323; Fax: +1 520 626 5623; Email: sun{at}pharmacy.arizona.edu
Received August 3, 2005. Revised October 4, 2005. Accepted October 4, 2005.
| ABSTRACT |
|---|
|
|
|---|
The proximal promoter region of the human vascular endothelial growth factor (VEGF) gene contains a polypurine/polypyrimidine tract that serves as a multiple binding site for Sp1 and Egr-1 transcription factors. This tract contains a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif for the formation of an intramolecular G-quadruplex. In this study, we observed the progressive unwinding of the oligomer duplex DNA containing this region into single-stranded forms in the presence of KCl and the G-quadruplex-interactive agents TMPyP4 and telomestatin, suggesting the dynamic nature of this tract under conditions which favor the formation of the G-quadruplex structures. Subsequent footprinting studies with DNase I and S1 nucleases using a supercoiled plasmid DNA containing the human VEGF promoter region also revealed a long protected region, including the guanine-rich sequences, in the presence of KCl and telomestatin. Significantly, a striking hypersensitivity to both nucleases was observed at the 3'-side residue of the predicted G-quadruplex-forming region in the presence of KCl and telomestatin, indicating altered conformation of the human VEGF proximal promoter region surrounding the guanine-rich sequence. In contrast, when specific point mutations were introduced into specific guanine residues within the G-quadruplex-forming region (Sp1 binding sites) to abolish G-quadruplex-forming ability, the reactivity of both nucleases toward the mutated human VEGF proximal promoter region was almost identical, even in the presence of telomestatin with KCl. This comparison of wild-type and mutant sequences strongly suggests that the formation of highly organized secondary structures such as G-quadruplexes within the G-rich region of the human VEGF promoter region is responsible for observed changes in the reactivity of both nucleases within the polypurine/polypyrimidine tract of the human VEGF gene. The formation of the G-quadruplex structures from this G-rich sequence in the human VEGF promoter is further confirmed by the CD experiments. Collectively, our results provide strong evidence that specific G-quadruplex structures can naturally be formed by the G-rich sequence within the polypurine/polypyrimidine tract of the human VEGF promoter region, raising the possibility that the transcriptional control of the VEGF gene can be modulated by G-quadruplex-interactive agents.
| INTRODUCTION |
|---|
|
|
|---|
The size of most primary solid tumors is known to be limited to within
12 mm in diameter because the cancer cells initially rely on pre-existing host blood vessels for a supply of oxygen and nutrients (1). However, starving tumor cells can become angiogenic by gaining the ability to direct the formation of new blood vessels for their survival (2,3). The angiogenic switch in cancer cells is often initiated by increased expression of vascular endothelial growth factor (VEGF), a pluripotent cytokine and angiogenic growth factor (4). VEGF consists of two identical subunits and binds to VEGF receptors on the surfaces of endothelial cells (4). The interaction of VEGF and its cognate receptors stimulates the proliferation, migration, survival and permeability of endothelial cells, resulting in the formation of new blood vessels (5). The formation of new blood vessels adjacent to primary tumor sites promotes the growth of cancer cells by providing oxygen and nutrients. In addition, newly formed blood vessels serve as escape routes for disseminating tumor cells, contributing to tumor metastasis even in locations distant from the primary tumor site (5). The expression of human VEGF, which is frequently elevated in many types of cancer, is mainly regulated at the transcriptional level (6,7). VEGF expression is induced by a variety of factors, including hypoxia, pH, activated oncogenes, inactivated tumor suppressor genes and growth factors (815). The molecular basis of VEGF gene expression has been extensively studied by characterizing the cis-acting elements and transcription factors involved in constitutive VEGF expression in human cancer cells (914). The human VEGF promoter region contains putative binding sites for several transcription factors, such as HIF-1, AP-1, AP-2, Egr-1, Sp1 and many others, suggesting that they may be involved in VEGF transcriptional regulation (13,14). Functional analysis of the human VEGF promoter using the full-length VEGF promoter reporter revealed that the proximal 36 bp region (85 to 50 relative to transcription initiation site) is essential for basal or inducible VEGF promoter activity in several human cancer cells (13,14). This region contains at least three Sp1 binding sites, each consisting of a polypurine/polypyrimidine tract (Figure 1). Although there are binding sites for other factors, such as two Egr-1 elements and one AP-2 element, all Sp1 binding sites were found to be functionally significant in constitutive VEGF promoter activity (13,14). Polypurine/polypyrimidine tracts are also found in the promoter region of other growth-related genes, including Hmga-2, EGF-R, c-Myc, I-R, AR, c-Src, c-Ki-Ras, TGF-ß, PDGF A-chain, insulin and muscle-specific protein (1625). These sequences have been proposed to be very dynamic in their conformation, easily adopting non-B-DNA conformations, such as melted DNA, hairpin structures, slipped helices, or others, under physiological conditions (1625). These sequences also provide landing sites for a transcription machinery complex to initiate transcriptional activation of these genes (26,27). In particular, the guanine-rich sequences found in the polypurine/polypyrimidine tracts are known to form G-quadruplex structures consisting of two or more G-tetrads in the presence of monovalent cations such as Na+ and K+ under physiological conditions as shown in Figure 2A (28,29). Recently, both NMR and X-ray crystallography studies have determined the structures of various forms of G-quadruplexes, and these studies have revealed that folding patterns of these G-quadruplexes depend on the precise arrangement and composition of G-repeats, as well as on the size of the intervening sequences (3036). Significantly, the polypurine tract of the VEGF promoter consists of five runs of at least three contiguous guanines (GR-I to GR-V in Figure 1) separated by one or more bases, conforming to the general motif capable of forming G-quadruplex structures. Therefore, we hypothesized that the polypurine/polypyrimidine tract of the VEGF promoter region is very dynamic in its structure and can easily adopt a non-B-DNA conformation under physiological conditions. Moreover, we predicted that the G-rich strand of this tract could form specific G-quadruplex structures in the presence of K+ or G-quadruplex-interactive agents.
|
|
To test our hypothesis, we initially used a DNA breathing assay with an oligomer duplex containing the polypurine/polypyrimidine tract in the VEGF promoter. We anticipated that the unwinding of this oligomer duplex could be facilitated in the presence of G-quadruplex-interactive agents by trapping out and stabilizing the G-quadruplex transiently formed by the G-rich strand of the polypurine/polypyrimidine tract. In addition, we used DNase I and S1 nuclease footprinting to study the structural transition within this tract of the VEGF promoter, since the activity of these enzymes is modulated by DNA conformation (1618).
In this article, we demonstrate that G-quadruplex-interactive agents promote the unwinding of the oligomer duplex containing the polypurine/polypyrimidine tract in the presence of K+. Footprinting experiments with DNase I and S1 nuclease using a supercoiled plasmid containing either the wild-type or mutant VEGF promoters revealed that the emergence of DNase I and S1 nuclease cleavage in the vicinity of the polypurine/polypyrimidine tract was dependent on both the capability of the wild-type sequence to form G-quadruplex structures and the presence of K+ and G-quadruplex-interactive compounds. Collectively, these results support the conclusion that G-quadruplex structures form within this polypurine/pyrimidine tract of the VEGF promoter.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Drugs, enzymes and oligonucleotide DNA
TMPyP4 was purchased from Midwest Chemicals, and telomestatin was kindly provided by Dr Kazuo Shin-ya (University of Tokyo, Japan). Both drug molecules were dissolved in dimethyl sulfoxide, unless otherwise specified. T4 nucleotide kinase and Taq DNA polymerase were purchased from Promega. PAGE-purified oligonucleotides were obtained from Sigma Genosys.
Polymerase stop assay
The primer DNA (P28) was 5' end-labeled using T4 polynucleotide kinase with [
-32P]ATP (3000 Ci/mmol, Perkin Elmer) for 1 h at 37°C and purified on a Bio-Spin 6 chromatography column (BioRad) after inactivation of the kinase by heating at 95°C for 3 min. Labeled primers were annealed to the template DNA and the primer-annealed template DNA was separated from excess labeled primer or remaining template DNA using non-denaturing 8% PAGE. The resulting primer-annealed template DNA was gel-purified and used as a substrate in a primer extension assay by Taq DNA polymerase, as described previously (37).
DNA breathing assay
We designed a 59 bp oligo duplex DNA (59WT) containing the Sp1 binding sites (101 to 43, relative to transcriptional start site) of the VEGF promoter region (see Figure 3A) in order to study the dynamic features of this promoter region. For the DNA breathing assay, the top strand of 59WT DNA was 5' end-labeled with 32P and incubated with increasing concentrations of TMPyP4 or telomestatin in 150 mM KCl/TE buffer for 10 h at 37°C. The reaction also contained an 8-fold molar excess of unlabeled top (G-rich) strand as a trap to prevent the released (labeled with 32P) top strands from reannealing, and the DNA was electrophoresed on an 8% native polyacrylamide gel to separate other species of DNA from the duplex form of DNA.
|
Plasmid DNA
For in vitro footprinting of the VEGF promoter region, we used the supercoiled form of the luciferase reporter plasmid pGL3-VEGFP, which was constructed by ligating an 837 bp VEGF promoter region (787 to +50 relative to the transcription initiation site) into the KpnI and NheI sites of pGL3-basic basic vector (Promega, Madison, WI), as described previously (14). This region of the VEGF promoter was found to support the transcription of luciferase expression in human cancer cell lines (14). A mutant reporter plasmid, pGL3-VEGFM17, was constructed by introducing point mutations into specific guanine residues within the Sp1 binding sites of the VEGF promoter regions of pGL3-VEGFP using a QuickChange mutagenesis kit (Stratagene) to destabilize or abolish the G-quadruplex-forming ability of this region.
In vitro footprinting of the VEGF promoter region with DNase I and S1 nuclease
A supercoiled form of each of the plasmids (pGL3-VEGFP and pGL3-VEGFM17) was incubated in the absence of any salt, or in the presence of 100 mM KCl with and without 1 µM telomestatin as a selective G-quadruplex-interactive agent at 37°C for 1 h and then treated with DNase I or S1 nuclease for 2 min. DNA was precipitated with ethanol and resuspended in double-distilled water after vacuum drying. To map DNase I and S1 nuclease cleavage sites on the plasmid DNA, linear amplification by PCR was performed using Thermo Sequenase Cycle Sequencing kit (USB) with 32P-labeled gene-specific primers d(CCCAGCGCCACGACCTCCGAGCTACC) and d(CTGTGAACCTTGGTGGGGGTCGAGC) to amplify the top and bottom strands of the plasmid DNA, respectively.
Circular dichroism spectroscopy
Circular dichroism (CD) spectra were recorded on a Jasco-810 spectropolarimeter (Jasco, Easton, MD), using a quartz cell of 1 mm optical path length, an instrument scanning speed of 100 nm/min, with a response time of 1 s and over a wavelength range of 200330 or 200600 nm for the titration experiments with drugs. All DNA samples were dissolved in TrisHCl buffer (20 mM, pH 7.6) to a strand concentration of 5 µM, and where appropriate, the samples also contained 100 mM KCl. The CD spectra herein are representations of four averaged scans taken at 25°C and are baseline corrected for signal contributions due to the buffer.
| RESULTS |
|---|
|
|
|---|
Transition of duplex to a non-B-DNA conformation within the polypurine/polypyrimidine tract of the VEGF promoter region in the presence of TMPyP4 and telomestatin
In order to test if the polypurine/polypyrimidine tract of the VEGF promoter region is structurally dynamic and can easily adopt a non-B-DNA conformation under physiological conditions, a DNA breathing assay was carried out with a 59 bp oligomer duplex (59WT) containing the polypurine/polypyrimidine tract (Figure 3A). It was anticipated that the unwinding of the 59WT would occur if WatsonCrick base pairs are destabilized by the formation of non-B-DNA structures in the Sp1 binding sites of the VEGF promoter region. In the DNA breathing assay, the oligomer duplex (59WT) labeled at the 5' end of the G-rich strand with 32P was incubated with increasing concentrations of the G-quadruplex-interactive agents TMPyP4 (38) or telomestatin (39) (Figure 3B) at 37°C in the presence of 150 mM KCl and then electrophoresed on an 8% native polyacrylamide gel to separate other species of DNA from the duplex form of DNA. G-quadruplex-interactive agents were included to determine if these agents promote the unwinding process by further stabilizing and trapping out the G-quadruplex structures formed by the G-rich strand. As shown in Figure 3C and D, the formation of a single-stranded DNA species was progressively increased as the concentrations of TMPyP4 and telomestatin were increased. TMPyP4 and telomestatin will prevent the conversion back to a B-DNA structure by trapping out and stabilizing the G-quadruplex structures formed in this region of the VEGF promoter. The results from the DNA unwinding study support the idea that the polypurine/polypyrimidine tract of the VEGF promoter region is very dynamic in its structure, and G-quadruplex structures can be formed by the G-rich strand of this tract under physiological conditions of potassium, pH and temperature with the addition of G-quadruplex-stabilizing agents.
In vitro footprinting of the wild-type VEGF promoter contained in a plasmid in the presence of K+ and G-quadruplex-interactive compounds
DNase I and S1 nucleases have been previously used as tools for studying structural transitions occurring in normal B-type DNA (1618). For example, while DNase I preferentially cleaves locally unwound or normal duplex regions over single-stranded regions, S1 nuclease preferentially cleaves single-stranded regions of DNA over duplex DNA (1624). However, both enzymes show the lowest cleavage activity toward highly organized secondary structures such as hairpins or G-quadruplex structures. For these reasons, the existence of a non-B-conformation can be implied from changes in the pattern of DNase I and S1 nuclease sensitivity of certain regions of DNA (1624).
DNase I cleavage
DNase I footprinting was used to determine the possible structural transition from B-DNA to non-B-type DNA structures in the promoter region of the VEGF gene. For the DNase I footprinting, the plasmid pGL3-VEGFP, which contains the VEGF promoter region from 787 to +50, was incubated either in the absence of salt or in the presence of 100 mM KCl, with and without 1 µM telomestatin as the selective G-quadruplex-interactive agent, at 37°C for 1 h and then treated with DNase I for 2 min. DNase I cleavage sites in the plasmids were then mapped using linear amplification by PCR with 32P-labeled gene-specific primers. The primer extension reaction carried out on the top strand of the plasmid revealed a long DNase I protected region located at approximately 53 to 123 bp, which includes the G-rich sequences, when the supercoiled pGL3-VEGFP plasmid was incubated with 100 mM KCl (Figure 4A and B; compare lanes 2 and 3 with lane 1). This result is in accord with a transition from B-DNA to a non-B-DNA structure in the VEGF promoter region, which is most probably a G-quadruplex and consequently resistant to DNase I digestion. Significantly, a striking DNase I hypersensitivity was found at a cytosine located at the 3'-side of the predicted G-quadruplex-forming region in the presence of KCl and telomestatin, which is most probably associated with the junction site between the G-quadruplex and the adjacent normal B-DNA (arrow A in Figure 4A and B). The primer extension reaction of the bottom strand of the plasmid revealed that the reactivity of DNase I on the C-rich region in the VEGF promoter was moderately reduced in the presence of KCl and KCl with telomestatin (Figure 4C; compare lanes 2 and 3 with lane 1). This result suggests that the C-rich sequence and the surrounding region of the VEGF promoter might exist in single-stranded form as a result of the transition of purine-rich strand in the B-type DNA structure to a G-quadruplex under these conditions.
|
S1 nuclease cleavage
Since reduced reactivity to DNase I can be caused by either the presence of a single-stranded region or a highly organized secondary structure, such as G-quadruplex structures within the polypurine/polypyrimidine tract of the VEGF promoter, an additional footprinting experiment using S1 nuclease was carried out to obtain further detailed information about the conformational transition occurring in this region. As shown in Figure 5A and B, the reactivity of S1 nuclease on the top strand of the polypurine/polypyrimidine tract of the VEGF promoter was markedly reduced in the presence of KCl with telomestatin. The reduced reactivity of the VEGF promoter region surrounding the G-quadruplex-forming region to both DNase I and S1 nuclease suggests the formation of highly organized secondary structures, such as G-quadruplex structures, rather than the formation of a single-stranded form in the G-rich region of the VEGF promoter in the presence of KCl with telomestatin. Significantly, the hypersensitivity site observed with S1 nuclease also corresponds to that obtained with DNase I in the presence of KCl with telomestatin. The presence of this common hypersensitivity site to both nucleases at the 3'-side of the G-quadruplex-forming region is a strong indicator of the enhanced exposure of this particular residue to both nucleases, suggesting the presence of a junction site between the B-type DNA structure and the G-quadruplex at this site in the promoter region of the VEGF gene. In contrast, the reactivity to S1 nuclease of the opposite strand of the same region was moderately enhanced, with the hypersensitive region extending upstream of the G-rich tract (see arrows in Figure 5C). These results suggest that the opposite strand of the G-rich sequence and the surrounding region of the VEGF promoter exists in a single-stranded form as a result of the transition of B-type DNA structure to the G-quadruplexes under the conditions that favor such transitions.
|
Comparison of the abilities of the G-rich strands of the wild-type versus mutant VEGF promoter sequences to form stable G-quadruplex structures
In order to demonstrate the G-quadruplex-forming ability of the G-rich strand of the polypurine/polypyrimidine tract in the presence of KCl, a DNA polymerase stop assay was used, as previously described (37). This assay provides a simple and rapid way to identify DNA secondary structures, such as G-quadruplexes, in vitro, based on the principle that DNA polymerase is incapable of traversing these structures (37,38). Thus, the DNA polymerase, traversing toward the 5' end of the template and unable to efficiently resolve quadruplex DNA, pauses or stops 3' to the first guanine involved in a stable G-quadruplex. When a DNA template (WT) containing the G-quadruplex-forming region [d(G4CG3C2G5CG4)] was annealed with 32P-labeled primers and incubated with Taq DNA polymerase, a potassium-dependent pause of the DNA polymerase extension was observed with this DNA template (Figure 6A). In contrast, in the absence of KCl, the DNA polymerase bypasses the G-repeat region. The KCl-dependent pausing is observed immediately 3' to the fourth guanine run (GR-IV), presumably through stabilization of the intramolecular G-quadruplex structure, confirming that this region is indeed capable of forming intramolecular G-quadruplex structures (Figure 6A). A potassium-dependent pausing of DNA polymerase extension was not observed in the mutant DNA template (MT), in which mutations were introduced into the G-quadruplex-forming region to abolish the formation of G-quadruplex structures (Figure 6B).
|
In vitro footprinting of the mutant VEGF promoter region with DNase I and S1 nuclease
The importance of the G-quadruplex-forming ability of the polypurine/polypyrimidine tract in causing the change in the reactivity of both nucleases in the presence of KCl and telomestatin was determined using the mutant reporter plasmid pGL3-VEGFM17. This plasmid contains the same point mutations in the specific guanine residues within the G-quadruplex-forming region of the VEGF promoter as those shown in Figure 6B to destabilize or abolish the G-quadruplex-forming ability of this region. For in vitro footprinting, the supercoiled form of the mutant plasmid pGL3-VEGFM17 was incubated under the same conditions and with the same enzymes used in the previous experiments shown in Figures 4 and 5. As shown in Figure 7, the reactivity of both nucleases toward the mutated VEGF proximal promoter region was little changed in the presence of telomestatin with KCl, and the hypersensitivity site was not observed with both nucleases in the presence of telomestatin with KCl. This result provides strong support for the idea that the formation of highly organized secondary structures, such as G-quadruplex structures, within the G-rich region of the VEGF promoter region is responsible for observed changes in the DNase I and S1 cleavage reactivity of the polypurine/polypyrimidine tract in the human VEGF promoter sequence.
|
CD spectra of the G-rich strand in the VEGF promoter reveals a parallel-stranded G-quadruplex
CD spectroscopy has been widely used to infer the presence of G-quadruplexes and is particularly useful for differentiating parallel and antiparallel G-quadruplexes (40,41). All guanosines in the structure of a parallel quadruplex have an anti-conformation of the glycosyl bonds, resulting in a positive band at
265 nm and a small negative band at
245 nm in CD spectrum (40,41). In contrast, the guanosines in an antiparallel quadruplex have alternating syn and anti glycosyl conformations along each strand, exhibiting a positive band at
295 nm that is associated with an antiparallel strand arrangement. The oligonucleotide used in CD studies was VEGF-PuT, d(T5G3CG3C2G5CG3T5), which contains a potential G-quadruplex forming region [d(G3CG3C2G5CG3)] of the G-rich strand in the VEGF promoter. As shown Figure 8, the CD spectra of this sequence displays the characteristic signature for the parallel-type of G-quadruplex in the presence of increasing concentration of KCl, exhibiting a positive band at
265 nm and a small negative band at
245 nm.
|
| DISCUSSION |
|---|
|
|
|---|
The proposed transition of B-DNA into non-B-DNA structures, such as melted DNA, hairpin structures, slipped helices or others, has been reported in a number of growth-related mammalian genes, including Hmga2, EGF-R, c-Myc, malic enzyme, I-R, AR, c-Src, c-Ki-Ras, TGF-ß, sMtCK,
7 integrin and PDGF A-chain (1625). Significantly, the polypurine/polypyrimidine tracts are often found in the proximal promoter region of these genes, implicating the importance of structural transitions in these DNA tracts in mediating transcriptional regulation of these genes (1624). In general, DNA unwinding at the proximal promoter region of both prokaryotic and eukaryotic genes is believed to enhance open promoter complex formation with transcriptional machineries leading to transcriptional activation of the genes (26,27). A polypurine/polypyrimidine tract was also found within the proximal promoter region of the VEGF gene, the gene product of which is an angiogenic growth factor. This tract is known to serve as a multiple binding site for Sp1 and Egr-1 transcription factors (13,14). The polypurine tract of the VEGF promoter region contains a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases. This guanine-rich sequence conforms to a general motif capable of forming an intramolecular G-quadruplex: GxNyGxNyGxNyGx, where x
3 and y
1 (28,29). Therefore, in this study, we were interested in addressing whether a conformational transition exists among B-type DNA, melted DNA and G-quadruplex structures within this tract in the VEGF promoter, and whether specific G-quadruplex structures can naturally form from the guanine-rich sequence of this tract in the presence of KCl and/or G-quadruplex-interactive agents. We anticipated that the results of this study would enhance our understanding of the role of DNA structure in transcriptional regulation of the VEGF gene. Furthermore, we wished to explore a new therapeutic strategy to treat tumor angiogenesis by repressing the transcriptional activation of a major angiogenic gene, VEGF, by modification or stabilization of non-canonical DNA structures such as G-quadruplexes with G-quadruplex-interactive drugs. In this report, the dynamic nature of a polypurine/polypyrimidine tract of the VEGF promoter region has been demonstrated through a DNA breathing assay using the oligomer duplex DNA containing this tract. Both TMPyP4 and telomestatin, which are two representative G-quadruplex-interactive agents, were found to promote the unwinding of this oligomer duplex in the presence of KCl (150 mM) under physiological conditions (see Figure 3). We propose that these agents can trap out and stabilize the G-quadruplex structures that are transiently formed from the unwound G-rich strand of the 59mer duplex, facilitating the unwinding of the oligomer duplex into single-stranded forms. The destabilization of the proximal region of the VEGF promoter may contribute to the transcriptional activation of the VEGF gene by providing the binding site for transcriptional machinery, including transcriptional factors (e.g. CNBP or hnRNP, which are single-stranded DNA-binding proteins) and RNA polymerase in the TATA-less promoter region (40). The results from our footprinting studies using DNase I and S1 nuclease also demonstrate that the VEGF promoter region including the guanine-rich sequences adapts an unusual DNA conformation. In general, locally unwound or normal duplex regions are preferentially cleaved by DNase I over single-stranded regions or highly organized secondary structures such as hairpins or G-quadruplex structures (1618). In contrast, S1 nuclease prefers to cleave single-stranded or locally unwound regions of duplex DNA over normal duplex and highly organized secondary structures. Therefore, the combined use of both nucleases in in vitro footprinting experiments is expected to reveal pertinent information about unusual structural features of defined elements within the global region of DNA duplex molecules. A summary of the results from the DNase I and S1 nuclease footprinting experiments is shown in Figure 9. The DNA cleavage results from our footprinting studies revealed a long protected region including the guanine-rich sequences by both nucleases in the presence of KCl and telomestatin, which are known to facilitate the transition of B-type DNA structures to G-quadruplexes. Significantly, a striking hypersensitivity to both nucleases was observed at the 3' side residue of the predicted G-quadruplex-forming region in the presence of KCl and telomestatin, indicating an altered conformation of the VEGF proximal promoter region surrounding the guanine-rich sequence. It is important to note that the identical changes in footprinting patterns by both nucleases in the presence of KCl are significantly enhanced by the presence of the G-quadruplex-interactive agent telomestatin, suggesting that telomestatin interacts with G-quadruplex structure(s) formed by the G-rich sequence within the polypurine/polypyrimidine region. Finally, since specific point mutations introduced into specific guanine residues within the G-quadruplex-forming region abolished G-quadruplex-forming ability, and correspondingly, the reactivity of both nucleases toward the mutated VEGF proximal promoter region was little changed, even in the presence of telomestatin with KCl, these results also provide solid evidence that the formation of G-quadruplex structures within the G-rich region of the VEGF promoter region is responsible for observed changes in the reactivity of both nucleases within the polypurine/polypyrimidine tract of the human VEGF gene.
|
The result from CD spectroscopy suggests that the secondary structures formed by the G-rich strand, d(G4CG3C2G5CG4), of the VEGF promoter could be the parallel type of intramolecular G-quadruplex. Our electrophoretic mobility shift assay indicated that this sequence predominantly formed an intramolecular G-quadruplex structure in the presence of KCl (D. Sun, unpublished data). The structure of G-quadruplexes formed by this oligonucleotide is predicted to be very similar to that found in the C-MYC G-quadruplex structures (34). In this mutant sequence derived from the NHEIII1 in the c-MYC promoter, the central run of guanines is substituted in the four thymines (34). This structure involves a core of three stacked G-tetrads formed by four G-stretches and three loops bridging three G-tetrad layers (34). The central loop contains six residues, while the two other loops contain only one residue.
Previous studies reported that certain types of G-rich sequences are capable of forming parallel or antiparallel G-quadruplex structures consisting of two or more G-tetrads in the presence of monovalent cations such as Na+ and K+. G-rich sequences capable of forming G-quadruplexes have been reported in telomeric sequences, immunoglobulin switch regions, the insulin gene, the control region of the retinoblastoma susceptibility gene, the promoter region of the c-Myc gene, fragile X syndrome triplet repeats, and HIV-1 RNA [(reviewed in (36)] and muscle-specific protein (25). Recently, the solution structure of the parallel G-quadruplex in the c-Myc promoter was determined (35). Direct evidence for the existence of G-quadruplexes in vivo is beginning to emerge, and the ability of these important sequences to form very stable G-quadruplex structures in vitro suggests that G-quadruplex DNA may play an important role in several biological events (34). For instance, a recent study provided compelling evidence that a specific G-quadruplex structure formed in the c-Myc promoter functions as a transcriptional repressor element, establishing the principle that c-Myc transcription could be controlled by ligand-mediated G-quadruplex stabilization (42). Analogous to the c-Myc gene, the transcription of the VEGF gene could be regulated by the G-quadruplex structures formed by the G-rich sequence within the polypurine/polypyrimidine tract of the promoter region. G-quadruplex structures could inhibit the interaction of transcriptional factors (e.g. Sp1) with their cognate sites if those sites overlap the G-quadruplex-forming region. Alternatively, the formation of G-quadruplex structures could induce DNA bending at the junction sites between G-quadruplex structures and normal B-DNA structures, potentially leading to the activation or repression of transcription. Future studies are directed toward addressing whether mutation of sequences of the polypurine/polypyrimidine tract could lead to transcriptional repression (or activation) of the VEGF promoter, and if the G-quadruplex-forming ability of this region correlates with the promoter activity of the VEGF genes.
In summary, our results provide strong evidence that specific G-quadruplex structures can naturally be formed by the G-rich sequence within the polypurine/polypyrimidine tract of the VEGF promoter region, raising the possibility that the transcription of this gene can be controlled by ligand-mediated G-quadruplex stabilization.
| ACKNOWLEDGEMENTS |
|---|
We thank Kazuo Shin-ya (University of Tokyo) for providing the telomestatin for this study. We are grateful to David Bishop for preparing, proofreading and editing the final version of the manuscript and figures. Research was supported by the National Institutes of Health (CA94166). Funding to pay the Open Access publication charges for this article were waived by Oxford University Press.
Conflict of interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Folkman, J. (1971) Tumor angiogenesis: therapeutic implications N. Engl. J. Med., 285, 11821186[Web of Science][Medline] .
- Folkman, J. (2002) Role of angiogenesis in tumor growth and metastasis Semin. Oncol., 29, 1518[Web of Science][Medline] .
- Giordano, F.J. and Johnson, R.S. (2001) Angiogenesis: the role of the microenvironment in flipping the switch Curr. Opin. Genet. Dev., 11, 3540[CrossRef][Web of Science][Medline] .
- Goodsell, D.S. (2003) The molecular perspective: VEGF and angiogenesis Stem Cells, 21, 118119
[Free Full Text] . - Jain, R.K. (2002) Tumor angiogenesis and accessibility: role of vascular endothelial growth factor Semin. Oncol., 29, 39[Web of Science][Medline] .
- Martiny-Baron, G. and Marme, D. (1995) VEGF-mediated tumour angiogenesis: a new target for cancer therapy Curr. Opin. Biotechnol., 6, 675680[CrossRef][Web of Science][Medline] .
- Bikfalvi, A. and Bicknell, R. (2002) Recent advances in angiogenesis, anti-angiogenesis and vascular targeting Trends Pharmacol. Sci., 23, 576582[CrossRef][Medline] .
- Schafer, G., Cramer, T., Suske, G., Kemmner, W., Wiedenmann, B., Hocker, M. (2003) Oxidative stress regulates vascular endothelial growth factor-A gene transcription through Sp1- and Sp3-dependent activation of two proximal GC-rich promoter elements J. Biol. Chem., 278, 81908198
[Abstract/Free Full Text] . - Maeno, T., Tanaka, T., Sando, Y., Suga, T., Maeno, Y., Nakagawa, J., Hosono, T., Sato, M., Akiyama, H., Kishi, S., et al. (2002) Stimulation of vascular endothelial growth factor gene transcription by all trans retinoic acid through Sp1 and Sp3 sites in human bronchioloalveolar carcinoma cells Am. J. Respir. Cell Mol. Biol., 26, 246253
[Abstract/Free Full Text] . - Pal, S., Datta, K., Mukhopadhyay, D. (2001) Central role of p53 on regulation of vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) expression in mammary carcinoma Cancer Res., 61, 69526957
[Abstract/Free Full Text] . - Pal, S., Datta, K., Khosravi-Far, R., Mukhopadhyay, D. (2001) Role of protein kinase C
in Ras-mediated transcriptional activation of vascular permeability factor/vascular endothelial growth factor expression J. Biol. Chem., 276, 23952403[Abstract/Free Full Text] . - Tanaka, T., Kanai, H., Sekiguchi, K., Aihara, Y., Yokoyama, T., Arai, M., Kanda, T., Nagai, R., Kurabayashi, M. (2000) Induction of VEGF gene transcription by IL-1ß is mediated through stress-activated MAP kinases and Sp1 sites in cardiac myocytes J. Mol. Cell. Cardiol., 32, 19551967[CrossRef][Web of Science][Medline] .
- Finkenzeller, G., Sparacio, A., Technau, A., Marme, D., Siemeister, G. (1997) Sp1 recognition sites in the proximal promoter of the human vascular endothelial growth factor gene are essential for platelet-derived growth factor-induced gene expression Oncogene, 15, 669676[CrossRef][Web of Science][Medline] .
- Shi, Q., Le, X., Abbruzzese, J.L., Peng, Z., Qian, C.N., Tang, H., Xiong, Q., Wang, B., Li, X.C., Xie, K. (2001) Constitutive Sp1 activity is essential for differential constitutive expression of vascular endothelial growth factor in human pancreatic adenocarcinoma Cancer Res., 61, 41434154
[Abstract/Free Full Text] . - Blancher, C., Moore, J.W., Talks, K.L., Houlbrook, S., Harris, A.L. (2000) Relationship of hypoxia-inducible factor (HIF)-1
and HIF-2
expression to vascular endothelial growth factor induction and hypoxia survival in human breast cancer cell lines Cancer Res., 60, 71067113[Abstract/Free Full Text] . - Rustighi, A., Tessari, M.A., Vascotto, F., Sgarra, R., Giancotti, V., Manfioletti, G. (2002) A polypyrimidine/polypurine tract within the Hmga2 minimal promoter: a common feature of many growth-related genes Biochemistry, 41, 12291240[CrossRef][Medline] .
- Johnson, A.C., Jinno, Y., Merlino, G.T. (1988) Modulation of epidermal growth factor receptor proto-oncogene transcription by a promoter site sensitive to S1 nuclease Mol. Cell. Biol., 8, 41744184
[Abstract/Free Full Text] . - Michelotti, G.A., Michelotti, E.F., Pullner, A., Duncan, R.C., Eick, D., Levens, D. (1996) Multiple single-stranded cis elements are associated with activated chromatin of the human c-myc gene in vivo Mol. Cell. Biol., 16, 26562669[Abstract] .
- Tewari, D.S., Cook, D.M., Taub, R. (1989) Characterization of the promoter region and 3' end of the human insulin receptor gene J. Biol. Chem., 264, 1623816245
[Abstract/Free Full Text] . - Chen, S., Supakar, P.C., Vellanoweth, R.L., Song, C.S., Chatterjee, B., Roy, A.K. (1997) Functional role of a conformationally flexible homopurine/homopyrimidine domain of the androgen receptor gene promoter interacting with Sp1 and a pyrimidine single strand DNA-binding protein Mol. Endocrinol., 11, 315
[Abstract/Free Full Text] . - Ritchie, S., Boyd, F.M., Wong, J., Bonham, K. (2000) Transcription of the human c-Src promoter is dependent on Sp1, a novel pyrimidine binding factor SPy, and can be inhibited by triplex-forming oligonucleotides J. Biol. Chem., 275, 847854
[Abstract/Free Full Text] . - Pestov, D.G., Dayn, A., Siyanova, E.U., George, D.L., Mirkin, S.M. (1991) H-DNA and Z-DNA in the mouse c-Ki-ras promoter Nucleic Acids Res., 19, 65276532
[Abstract/Free Full Text] . - Lafyatis, R., Denhez, F., Williams, T., Sporn, M., Roberts, A. (1991) Sequence specific protein binding to and activation of the TGF-ß3 promoter through a repeated TCCC motif Nucleic Acids Res., 19, 64196425
[Abstract/Free Full Text] . - Wang, Z., Lin, X.H., Qiu, Q.Q., Deuel, T.F. (1992) Modulation of transcription of the platelet-derived growth factor A-chain gene by a promoter region sensitive to S1 nuclease J. Biol. Chem., 267, 1702217031
[Abstract/Free Full Text] . - Yafe, A., Etzioni, S., Weisman-Shomer, P., Fry, M. (2005) Formation and properties of hairpin and tetraplex structures of guanine-rich regulatory sequences of muscle-specific genes Nucleic Acids Res., 33, 28872900
[Abstract/Free Full Text] . - Pan, G. and Greenblatt, J. (1994) Initiation of transcription by RNA polymerase II is limited by melting of the promoter DNA in the region immediately upstream of the initiation site J. Biol. Chem., 269, 3010130114
[Abstract/Free Full Text] . - Holstege, F.C.P., Tantin, D., Carey, M., van der Vliet, P.C., Timmers, H. (1995) The requirement for the basal transcription factor IIE is determined by the helical stability of promoter DNA EMBO J., 14, 810819[Web of Science][Medline] .
- Keniry, M.A. (2001) Quadruplex structures in nucleic acids Biopolymers, 56, 123146[CrossRef][Web of Science] .
- Simonsson, T. (2001) G-quadruplex DNA structuresvariations on a theme Biol. Chem., 382, 621628[CrossRef][Web of Science][Medline] .
- Chowdhury, S. and Bansal, M. (2000) Effect of coordinated ions on structure and flexibility of parallel G-quadruplexes: a molecular dynamics study J. Biomol. Struct. Dyn., 18, 1128[Web of Science][Medline] .
- Parkinson, G.N., Lee, M.P., Neidle, S. (2002) Crystal structure of parallel quadruplexes from human telomeric DNA Nature, 417, 876880[CrossRef][Medline] .
- Haider, S., Parkinson, G.N., Neidle, S. (2002) Crystal structure of the potassium form of an Oxytricha nova G-quadruplex J. Mol. Biol., 320, 189200[CrossRef][Web of Science][Medline] .
- Phan, A.T. and Patel, D.J. (2004) Two-repeat human telomeric d(TAGGGTTAGGGT) sequence forms interconverting parallel and antiparallel G-quadruplexes in solution: distinct topologies, thermodynamic properties, and folding/unfolding kinetics J. Am. Chem. Soc., 125, 1502115027 .
- Phan, A.T., Modi, Y.S., Patel, D.J. (2004) Propeller-type parallel-stranded G-quadruplexes in the human c-myc promoter J. Am. Chem. Soc., 126, 87108716[CrossRef][Web of Science][Medline] .
- Ambrus, A., Chen, D., Dai, J., Jones, R.A., Yang, D. (2005) Solution structure of the biologically relevant G-quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization Biochemistry, 44, 20482058[CrossRef][Medline] .
- Hurley, L.H. (2001) Secondary DNA structures as molecular targets for cancer therapeutics Biochem. Soc. Trans., 29, 692696[CrossRef][Web of Science][Medline] .
- Han, H., Hurley, L.H., Salazar, M. (1999) A DNA polymerase stop assay for G-quadruplex-interactive compounds Nucleic Acids Res., 27, 537542
[Abstract/Free Full Text] . - Han, H., Langley, D.R., Rangan, A., Hurley, L.H. (2001) Selective interactions of cationic porphyrins with G-quadruplex structures J. Am. Chem. Soc., 123, 89028913[CrossRef][Web of Science][Medline] .
- Kim, M.Y., Vankayalapati, H., Shin-ya, K., Wierzba, K., Hurley, L.H. (2002) Telomestatin, a potent telomerase inhibitor that interacts quite specifically with the human telomeric intramolecular G-quadruplex J. Am. Chem. Soc., 124, 20982099[CrossRef][Web of Science][Medline] .
- Gray, D.M., Gray, C.W., Mou, T.C., Wen, J.D. (2002) CD of single-stranded, double-stranded, and G-quartet nucleic acids in complexes with a single-stranded DNA-binding protein Enantiomer, 7, 4958[CrossRef][Web of Science][Medline] .
- Seenisamy, J., Rezler, E.M., Powell, T.J., Tye, D., Gokhale, V., Joshi, C.S., Siddiqui-Jain, A., Hurley, L.H. (2004) The dynamic character of the G-quadruplex element in the c-MYC promoter and modification by TMPyP4 J. Am. Chem. Soc., 126, 87028709[CrossRef][Web of Science][Medline] .
- Siddiqui-Jain, A., Grand, C.L., Bearss, D.J., Hurley, L.H. (2002) Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription Proc. Natl Acad. Sci. USA, 99, 1159311598
[Abstract/Free Full Text] .
This article has been cited by other articles:
![]() |
J. D. Schonhoft, R. Bajracharya, S. Dhakal, Z. Yu, H. Mao, and S. Basu Direct experimental evidence for quadruplex-quadruplex interaction within the human ILPR Nucleic Acids Res., June 1, 2009; 37(10): 3310 - 3320. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-l. Zhang, Y. Fu, L. Zheng, W. Li, H. Li, Q. Sun, Y. Xiao, and F. Geng Natural isoflavones regulate the quadruplex-duplex competition in human telomeric DNA Nucleic Acids Res., May 1, 2009; 37(8): 2471 - 2482. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kumar and S. Maiti A thermodynamic overview of naturally occurring intramolecular DNA quadruplexes Nucleic Acids Res., October 1, 2008; 36(17): 5610 - 5622. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Guo, V. Gokhale, L. H. Hurley, and D. Sun Intramolecularly folded G-quadruplex and i-motif structures in the proximal promoter of the vascular endothelial growth factor gene Nucleic Acids Res., August 1, 2008; 36(14): 4598 - 4608. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yafe, J. Shklover, P. Weisman-Shomer, E. Bengal, and M. Fry Differential binding of quadruplex structures of muscle-specific genes regulatory sequences by MyoD, MRF4 and myogenin Nucleic Acids Res., July 1, 2008; 36(12): 3916 - 3925. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cogoi, M. Paramasivam, B. Spolaore, and L. E. Xodo Structural polymorphism within a regulatory element of the human KRAS promoter: formation of G4-DNA recognized by nuclear proteins Nucleic Acids Res., June 1, 2008; 36(11): 3765 - 3780. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-C. Huang, C.-C. Chang, P.-J. Lou, I-C. Kuo, C.-W. Chien, C.-T. Chen, F.-Y. Shieh, T.-C. Chang, and J.-J. Lin G-Quadruplex Stabilizer 3,6-Bis(1-Methyl-4-Vinylpyridinium)Carbazole Diiodide Induces Accelerated Senescence and Inhibits Tumorigenic Properties in Cancer Cells Mol. Cancer Res., June 1, 2008; 6(6): 955 - 964. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sun and L. H Hurley Telomestatin as a Structural Probe for Targeting G-quadruplexes in Telomeric and Promoter Regions Am. Assoc. Cancer Res. Educ. Book, April 12, 2008; 2008(1): 315 - 318. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sun, W.-J. Liu, K. Guo, J. J. Rusche, S. Ebbinghaus, V. Gokhale, and L. H. Hurley The proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure that can be targeted by G-quadruplex-interactive agents Mol. Cancer Ther., April 1, 2008; 7(4): 880 - 889. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Eddy and N. Maizels Conserved elements with potential to form polymorphic G-quadruplex structures in the first intron of human genes Nucleic Acids Res., March 27, 2008; 36(4): 1321 - 1333. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Du, Y. Zhao, and N. Li Genome-wide analysis reveals regulatory role of G4 DNA in gene transcription Genome Res., February 1, 2008; 18(2): 233 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zhang, Y. Lin, and C.-T. Zhang Greglist: a database listing potential G-quadruplex regulated genes Nucleic Acids Res., January 11, 2008; 36(suppl_1): D372 - D376. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Patel, A. T. Phan, and V. Kuryavyi Human telomere, oncogenic promoter and 5'-UTR G-quadruplexes: diverse higher order DNA and RNA targets for cancer therapeutics Nucleic Acids Res., December 3, 2007; 35(22): 7429 - 7455. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Qin, E. M. Rezler, V. Gokhale, D. Sun, and L. H. Hurley Characterization of the G-quadruplexes in the duplex nuclease hypersensitive element of the PDGF-A promoter and modulation of PDGF-A promoter activity by TMPyP4 Nucleic Acids Res., December 3, 2007; 35(22): 7698 - 7713. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dai, M. Carver, C. Punchihewa, R. A. Jones, and D. Yang Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence Nucleic Acids Res., August 1, 2007; 35(15): 4927 - 4940. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Rachwal, I. S. Findlow, J. M. Werner, T. Brown, and K. R. Fox Intramolecular DNA quadruplexes with different arrangements of short and long loops Nucleic Acids Res., June 18, 2007; (2007) gkm316v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yao, Q. Wang, Y.-h. Hao, and Z. Tan An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules Nucleic Acids Res., May 14, 2007; 35(9): e68 - e68. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dai, C. Punchihewa, A. Ambrus, D. Chen, R. A. Jones, and D. Yang Structure of the intramolecular human telomeric G-quadruplex in potassium solution: a novel adenine triple formation Nucleic Acids Res., April 19, 2007; (2007) gkm009v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Huppert and S. Balasubramanian G-quadruplexes in promoters throughout the human genome Nucleic Acids Res., January 28, 2007; 35(2): 406 - 413. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Burge, G. N. Parkinson, P. Hazel, A. K. Todd, and S. Neidle Quadruplex DNA: sequence, topology and structure Nucleic Acids Res., November 14, 2006; 34(19): 5402 - 5415. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dai, D. Chen, R. A. Jones, L. H. Hurley, and D. Yang NMR solution structure of the major G-quadruplex structure formed in the human BCL2 promoter region Nucleic Acids Res., October 6, 2006; 34(18): 5133 - 5144. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Eddy and N. Maizels Gene function correlates with potential for G4 DNA formation in the human genome Nucleic Acids Res., September 1, 2006; 34(14): 3887 - 3896. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hazel, G. N Parkinson, and S. Neidle Predictive modelling of topology and loop variations in dimeric DNA quadruplex structures. Nucleic Acids Res., January 1, 2006; 34(7): 2117 - 2127. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cogoi and L. E. Xodo G-quadruplex formation within the promoter of the KRAS proto-oncogene and its effect on transcription. Nucleic Acids Res., January 1, 2006; 34(9): 2536 - 2549. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ambrus, D. Chen, J. Dai, T. Bialis, R. A. Jones, and D. Yang Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res., January 1, 2006; 34(9): 2723 - 2735. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












