Published online 10 November 2005
Article |
Silencing of retrotransposons in Dictyostelium by DNA methylation and RNAi
Abt. Genetik, Universität Kassel Heinrich-Plett-Str. 40, 34132 Kassel, Germany 1Department of Cell and Molecular Biology, Biomedical Center, Uppsala University Box 596, S-751 24 Uppsala, Sweden 2Arbeitsgruppe Epigenetik, Deutsches Krebsforschungszentrum Im Neuenheimer Feld 280, 69120 Heidelberg, Germany 3Institut fuer Biochemie I, Medizinische Einrichtungen der Universitaet zu Koeln Joseph-Stelzmann-Str. 52, 50931 Koeln, Germany 4Department of Genetics, Dartmouth Medical School Hanover, NH 03755, USA 5Department of Molecular Biology, Biomedical Center, Swedish University of Agricultural Sciences Box 590, S-75124 Uppsala, Sweden
*To whom correspondence should be addressed. Tel: +49 561 8044805; Fax: +49 561 8044800; Email: nellen{at}uni-kassel.de
Received September 13, 2005. Revised October 8, 2005. Accepted October 18, 2005.
| ABSTRACT |
|---|
|
|
|---|
We have identified a DNA methyltransferase of the Dnmt2 family in Dictyostelium that was denominated DnmA. Expression of the dnmA gene is downregulated during the developmental cycle. Overall DNA methylation in Dictyostelium is
0.2% of the cytosine residues, which indicates its restriction to a limited set of genomic loci. Bisulfite sequencing of specific sites revealed that DnmA is responsible for methylation of mostly asymmetric C-residues in the retrotransposons DIRS-1 and Skipper. Disruption of the gene resulted in a loss of methylation and in increased transcription and mobilization of Skipper. Skipper transcription was also upregulated in strains that had genes encoding components of the RNA interference pathway disrupted. In contrast, DIRS-1 expression was not affected by a loss of DnmA but was strongly increased in strains that had the RNA-directed RNA polymerase gene rrpC disrupted. A large number of siRNAs were found that corresponded to the DIRS-1 sequence, suggesting concerted regulation of DIRS-1 expression by RNAi and DNA modification. No siRNAs corresponding to the standard Skipper element were found. The data show that DNA methylation plays a crucial role in epigenetic gene silencing in Dictyostelium but that different, partially overlapping mechanisms control transposon silencing. | INTRODUCTION |
|---|
|
|
|---|
DNA methylation plays a crucial role in epigenetic gene regulation in many organisms (1). In most eukaryotes, cytosines in the symmetric CpG or CpNpG context are methylated (2) and methylation is propagated by maintenance methyltransferases (3,4) on the newly synthesized DNA strand shortly after replication. In addition, other methyltransferases may place new marks on DNA by de novo methylation (58), including the modification of asymmetric sites (9). Methylated cytosines may recruit specific chromatin components and initiate heterochromatin formation by histone deacetylation and methylation (1012). On the other hand, modified histones may recruit DNA methyltransferases and mediate C-methylation (13,14). Though DNA methylation is found in organisms as diverse as animals, plants and fungi, it appears to be absent in Schizosaccharomyces pombe (15,16), Caenorhabditis elegans and other organisms where epigenetic silencing is mediated by histone modification alone.
It was first detected in tobacco that RNA can direct the methylation of homologous sequences in the genome (17,18). In plants and yeast (10) silencing of chromatin was found to be mediated by small RNAs that originate from the RNA interference pathway. RdDM (RNA-directed DNA methylation) is thus another branch of regulation by small RNAs. Recently, several models have been presented as to how the RNA guides for DNA modification may be generated and which components of the cellular machinery are involved (1921). Targets for epigenetic chromatin silencing are frequently transposons and retrotransposons that are a source for naturally occurring siRNAs (22,23). Transposons are reactivated (22) and may be mobilized when components of the RNAi pathway are disrupted (24).
The presence of a functional RNAi machinery (25), the cloning of numerous siRNA-like molecules from Dictyostelium containing sequences of retrotransposons (F. Söderbom and V. Ambros, manuscript in preparation) and the suggestion that pericentric heterochromatin contained clustered retrotransposons (26) raised the question whether RNA-mediated DNA modification may be involved in epigenetic gene regulation in Dictyostelium. Similar to the situation in Drosophila, previous work had suggested that Dictyostelium DNA was not methylated (27). The discovery of a methyltransferase gene of the Dnmt2 family in the Drosophila genome and the subsequent detection of low levels of cytosine methylation (12) prompted us to reinvestigate this issue in Dictyostelium. In the recently completed genome of the social amoeba (26), we found a Dnmt2-like gene that had also been independently detected by Ponger et al. (28).
Our data show that Dictyostelium contains a functional DNA methyltransferase enzyme that methylates specific C-residues in the retrotransposons DIRS-1 and Skipper. Skipper silencing depends on both DNA methylation and a functional RNAi machinery.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Strains
All experiments were carried out with Ax2, strain 214 and derivatives. The following transgenic strains were used: dnmA (25), rrpA (25), rrpB (25), rrpC (25), hcpA (M. Kaller, U. Euteneuer and W. Nellen, manuscript submitted), helF (B. Popova, M. Kuhlmann and W. Nellen, submitted) drnA (B. Popova, B.E. Borisova, M. Kuhlmann, C. Hammann and W. Nellen), actin 15::dnmA-myc and actin 15::dnmA-gfp.
Growth and development of Dictyostelium cultures
Dictyostelium Ax2 cells and transformants were grown in association with Klebsiella aerogenes on SM agar plates, in suspension culture or plates in HL5 medium. Dictyostelium cells were developed in phosphate buffer suspension culture as described previously (29).
For growth and development cycles, cells were plated out on SM agar in association with K.aerogenes and allowed to grow and develop. Spores were harvested after 7 days and used to inoculate a fresh plate.
Generation of the dnmA knock-out strain
For amplification of the genomic 5' and 3' parts of the dnmA gene the following primer sets were used. 5' part: forward, (Eco31I) GGTCTCATGGAACAATTGAGAGTATTAGAA and reverse, (BamHI)GATCCGCTTAACCAAATTGTTGTGGTG; 3' part: forward, (Eco31I) GGTCTCGATTTTCAGTTACAATGAATTGGT and reverse, (BamHI) 5' GGATCCTTTTGTATTGCAAAAAGAAATGG. The PCR products of 782 bp (5' part) and 1100 bp (3' part) were inserted into the plasmid pGEM T-easy. The plasmid was digested at the central BamHI site to introduce the 1343 bp BSR cassette (30). The resulting plasmid was cut with Eco31I and the
3200 bp dnmA fragment with the inserted BSR cassette was isolated. The fragment was introduced into Dictyostelium cells by electroporation as described previously (31,32).
Clonal isolates were obtained by plating
500 cells on an SM plate with K.aerogenes. Cells were picked from clones into Costar plates containing HL5 medium with the appropriate selective drug. After several days, cells were transferred to suspension culture.
DnmA expression constructs
The coding sequence of the dnmA gene was amplified by PCR using the primers forward: ATTGAATTCAAAATGGAACAATTGAGAGTATTAG and reverse: AGGAAGCTTATTGGATCCTTTTTTTCCTTCTTTTTCCTTTTG.
The product was cloned via EcoRI and BamHI into pDd-GFP to generate a C-terminal GFP fusion. For expression of the Myc-tagged protein, the same PCR product was cloned via EcoRI and HindIII into pDEX_RH. Two complementary oligonucleotides encoding the Myc-tag were inserted into the BamHI and HindIII sites to obtain a C-terminal Myc fusion.
RNA isolation and northern blotting
Total cellular RNA was prepared as detailed in (33). For northern blots, 20 µg of total cellular RNA were separated on a 1.8% agarose gel containing 20 mM guanidiniumthiocyanate and blotted to a nylon membrane (porablot Nyamp, Macherey & Nagel). Pre-hybridization and hybridization were carried out as described previously (34). Radioactively labelled PCR fragments were generated by incorporation of [
-32P]dATP with Klenow-fragmentexo (MBI, Fermentas) as described previously (35).
PCR-primers for fragment amplification used for random-prime Klenow-labelling. DnmA 801 bp (+183 bp intron): Forward, TTAATGAGTCCACCATGTCAAC; reverse, CCTGTACCTTCAATAAATTTTCC; DIRS-1-RT-LTR 726 bp: forward, GTATGCCCTGTTCGCCACCTTGC; reverse, AACATTTATTTATTTGAATTTCCC; Skipper GAG 400 bp: forward, TGAAGCTAAAACCATTGACGC; reverse, CTAATTGAACTTCAGCAGTACC; eriA 660 bp: forward, GGATCCGATGTCCACAACAACAACATC; reverse, GGATCCTTTACTGATTTCATTGTTGAAAC.
RTPCR
RNA was isolated from wild-type cells and mutants and treated with RNase free DNase (MBI, Fermentas). Equal amounts of total RNA were used for reverse transcription with oligo(dT) primers. PCRs for dnmA were carried out on cDNA using the following primers: forward, TTAATGAGTCCACCATGTCAAC; reverse, CCTGTACCTTCAATAAATTTTCC.
For the thioredoxin control: forward, GAACGAGCTCCATGGCCAATAGAGTAATTCATG; reverse, CGCGGATCCTTATTTGTTTGCTTCTAGAGTACTTC.
Small RNA libraries
Sequences for siRNAs were retrieved from two small RNA libraries (
1825 nt long) that were constructed according to Lee and Ambros (36) and Lau et al. (37). Details on these libraries will be published elsewhere (F. Söderbom and V. Ambros, manuscript in preparation).
DNA isolation and Southern blotting
A total of 1 x 108 Dictyostelium cells were harvested from HL5 medium, washed in ice-cold phosphate buffer (100 mM, pH 6.7) and collected at 540 g for 10 min at 4°C. The cell pellet was lysed in 50 ml nuclear-lysis-buffer (50 mM HEPES, pH 7.5, 40 mM MgCl2, 20 mM KCl, 5% saccarose and 1% NP-40). Nuclei were lysed in 5 ml of 0.7% SDS and 100 µl (25 mg/ml) proteinase K for 60 min at 65°C. The lysate was extracted twice with phenol/chloroform and the genomic DNA was precipitated with 1/10 volume of 3 M sodium acetate and 2.5 vol of ethanol. The pellet was washed twice with 70% ethanol, air-dried and dissolved in an appropriate volume of ultra-pure water.
Aliquots containing 10 µg of DNA were digested with the restriction enzymes indicated, separated on 1% agarose gels, blotted to nylon membrane and hybridized with PCR fragments labelled with [
-32P]dATP by random priming. Primers for PCR amplification are listed as control primers in bisulfite sequencing and in northern blotting.
Calculation of retrotransposon copy numbers
Total nuclear DNA was digested with SacI, and
10 µg were loaded on a 1% agarose gel containing ethidium bromide. After electrophoresis, the gel was photographed with an EASY documentation system, blotted on nylon membrane and hybridized with a [32P]labelled random primed probe of the DIRS-1 right LTR and part of the RT sequence. After exposure to a phosphoimager screen and scanning of the autoradiogramm, the blot was stripped and hybridized with a [32P]labelled random primed probe of the Skipper gag sequence. The blot was exposed, scanned and rehybridized with a [32P]labelled random primed probe of the single copy eriA gene, encoding a homologue of the C.elegans ERI-1 gene (38). Using the TINA program, pixels were counted for ethidium bromide staining (two defined sections of the stained gel) and PSL (photo-stimulated light units) for the major bands of the retrotransposons and for the single copy gene fragment. Counts for the quantitation standards were averaged for each lane; PSL of the main DIRS-1 and Skipper bands were divided by the averaged quantitation standard and set to 1 for fresh wild-type cells. The results did not change significantly when only the eriA or only the ethidium staining were used for quantitation.
Bisulfite sequencing
Bisulfite sequencing was essentially carried out according to (39). Briefly, 5 µg of genomic, RNase-treated DNA were denatured with 1/10 vol of 3 M NaOH for 20 min at RT and 3 min at 100°C in a total volume of 60 µl. Aliquots containing 600 µl of freshly prepared bisulfite solution (3.1 M Na2S2O5, 5 mM hydroquinone, pH 5) were added and the samples were overlayed with mineral oil. Reactions were carried out for 3 h at 55°C; they were then briefly heated (1 min) to 95°C and incubated for an additional 1216 h at 55°C. DNA was purified with Geneclean® or glass milk and dissolved in 100 µl H2O. Desulfonation was carried out for 20 min at 37°C by addition of 11 µl of 3 M NaOH. The converted DNA was precipitated with 35 µl ammoniumacetate and 3 vol of 100% ethanol, washed with 70% ethanol and dissolved in 20 µl H2O; 24 µl were used for PCRs with control primers (complementary to non-converted DNA) and bisulfite primers (complementary to converted DNA).
Primers for DIRS-1 LTR PCR. Control PCR: forward, ATCAAATTGTTTTAGTTTTTAGTG; reverse, AACATTTATTTATTTGAATTTCCC. Bisulfite PCR: forward, ATCAAATTATTTTAATTTTTAATA; reverse, AATATTTATTTATTTGAATTTTTT.
Primers for Skipper RT. Control PCR: forward, CTGTTACCTTAGTGAAGATGGG; reverse, GGGCATCTATTGTCTTATGACATGG. Bisulfite PCR: forward, AAATCTTACATATATTATCAATAAA; reverse, AATAATTGAGTAGTATGTTGGGT.
Primers for Skipper LTR: Control PCR: forward, GTTAGAGACTCAAAACTAAATTA; reverse, TGTAAAAGTCACTCACACTAATC. Bisulfite PCR: forward, ACTCAAAACTAAATTAATTTAAAATTAA; reverse, ATGAAGGATAGAAAGAGTGAAAGAT.
PCRs were carried out on bisulfite treated and on untreated DNA with both sets of primers. Experiments were continued when only the appropriate primers yielded products on the different DNA samples. PCR products from cloned DIRS-1 LTR and Skipper RT fragments were also subjected to bisulfite sequencing to confirm that all cytosine residues could be converted.
In some experiments, DNA for the retrotransposon fragments was enriched by restriction digestion, gel electrophoresis and preparation of the appropriate size fragment for bisulfite treatment. The results were, however, not significantly improved in comparison with those obtained from bisulfite treatment of total DNA. PCR fragments were purified by MicroSpinTMS-400HR columns before sequencing (MWG Biotech).
Fluorescence microscopy
Cells were fixed at 20°C, with methanol for 20 min, washed three times in 1x PBS and stained with DAPI (1 mg/ml, diluted 1:15,000 in 1x PBS).
Cells expressing the DnmA-c-Myc fusion protein were blocked with PBG buffer (1x PBS containing 3% BSA and 0.045% cold water fish gelatin; Sigma) for 1 h at 37°C. Primary mAb 9E10 (directed against the c-Myc epitope) was added in a 1:50 dilution for 3 hours. Cells were washed three times with 1x PBS, then the secondary TRITC coupled polyclonal antibody (Dianova, Hamburg) was added at a 1:1000 dilution in PBG for 1 h.
Microscopic analysis was carried out with a Leica DM IRB inverted fluorescence microscope. For image acquisition a Leica DC 350F digital camera and IM50 software were used. Images were processed in Adobe Photoshop.
Capillary electrophoresis
For DNA methylation analysis, genomic DNA was isolated from wild-type (Ax2) and dnmA knock-out cells. DNA samples were hydrolysed, derivatized and analysed by capillary electrophoresis as described previously (40).
Microarray
RNA from Ax2 and the mutant cells was isolated with the Qiagen RNA kit. Aliquots containing 20 µg each were precipitated together with the appropriate spike mixture (controls). The RTPCR for labelling reactions was carried out with oligo(dT) primers. cDNA was labeled with a Cy3 or Cy5 labelling kit (FairPlayR Stratagene). Dye-coupled cDNA was purified and ethanol precipitated.
Corning ultra GAPS arrays containing probes for 450 defined genes, 5400 non-redundant expressed sequence tags (ESTs), and positive and negative controls were pre-hybridized and subsequently hybridized with the dye coupled cDNA preparations (41). After washing, arrays were scanned by Scan-ArrayR 4000XL and analysed by Scan Array Express Version 2.1 (Perkin Elmer Life Sciences, Wellesley, USA). Furthermore, the R project for Statistical Computing (http://www.r-project.org) and Significance Analysis of Microarrays (SAM) Version 1.21 (http://www-stat.stanford.edu/~tibs/SAM/) were used.
Southwestern blots
DNA was isolated from wild-type cells and from the dnmA gene disruption mutant, digested with various restriction enzymes and separated on a 1% agarose gel. The gel was blotted and the a nylon membrane was incubated with an antibody directed against 5-methyl cytosine (Eurogentec, Seraing, Belgium) at 4°C overnight. Further processing was carried out as described previously for western blotting (42) using an alkaline phosphatase coupled secondary antibody. Similar experiments were carried out using slot-blotting instead of Southern blotting. Purified DNA was denatured in 0.4 M NaOH, 10 mM EDTA, heated to 100°C for 10 min., neutralized by addition of an equal volume of 2 M ammoniumacetate, pH 7 and applied to a 6x SSC saturated nitrocellulose membrane in a slot-blot-apparatus. After washing with 2x SSC, DNA was UV-crosslinked to the filter, incubated with the anti 5-methyl cytosine antibody and processed as described above.
Accession numbers
dnmA: DictyBase DDB0231095, NCBI: XM_631863
[GenBank]
eriA: DictyBase DDB0231961; hcpA: DictyBase DDB0220646; rrpC: DictyBase DDB0216193; rrpA: DictyBase DDB0191515; rrpB: DictyBase DDB0220017.
| RESULTS |
|---|
|
|
|---|
Dictyostelium contains an expressed DNA methyl transferase of the Dnmt2 type
Global analysis of genomic DNA from Dictyostelium by capillary electrophoresis revealed a faint signal corresponding to
0.2% cytosine methylation (Figure 3B). This indicated that the Dictyostelium genome contains a DNA methyltransferase gene that catalyses DNA methylation in a restricted sequence context. Accordingly, we detected in the Dictyostelium genome database a single gene with high similarity to human Dnmt2 (Figure 1) and denominated it dnmA. The predicted gene product of 379 amino acids and 44.1 kDa displayed 41% identity with the human enzyme. All 10 characteristic motifs of DNA methyltransferases (43) could be identified. Additional genes with similarity to DNA methyltransferases of the Dnmt1 or Dnmt3a/b type were not detected by blast searches in the Dictyostelium genome.
|
|
RTPCR showed that dnmA RNA expression was high in vegetative cells and decreased during development (Figure 2A). N-terminal fusions with GFP or a c-Myc-tag were predominantly found in the nucleus (Figure 2B), thus confirming the in silico predicted nuclear localization by PSORTII (44) and LOCtree (45).
|
We generated a knock-out strain of the dnmA gene by homologous recombination. The gene disruption was confirmed by PCR, Southern blot (data not shown) and RTPCR (Figure 3A). No obvious phenotypic alterations were observed during growth or in development.
The transposons DIRS-1 and Skipper are methylated by DnmA at specific, mostly asymmetric C-residues
By using global methods for DNA methylation analysis, such as capillary electrophoresis and Southwestern blots with an antibody directed against 5-methyl cytosine, we were unable to obtain conclusive evidence for a loss of DNA methylation in the mutant strain, presumably, because both methods were operating close to their detection limit (Figure 3B and data not shown). For this reason, we focused our experiments on gene-specific methylation analysis. Based on observations in plants that RNAi could mediate transcriptional silencing by DNA methylation (46), we first investigated one of the discoidin gene loci after silencing by an RNAi construct (25). Bilsulfite sequencing revealed complete conversion of C-residues and no evidence for DNA methylation (data not shown). This was not unexpected since RNAi-mediated DNA methylation is predominantly found in promoter regions (18). The RNAi construct was, however, directed against the coding sequence. Attempts to achieve silencing with a hairpin construct in order to generate siRNAs directed against the promoter region failed (data not shown).
In order to identify specific targets for DNA methylation, we analysed RNA derived from the dnmA knock out and from wild-type cells by microarray. Setting a threshold of at least 2-fold difference, 7 genes were found to be overexpressed in the KO strain and 12 were underexpressed. Among the upregulated genes, the ESTs SLD246 and SLE355 contained sequences encoding the gag and RT genes, respectively, of the retrotransposon Skipper (47). We concentrated initially on the analysis of Skipper, as this was of special interest since transposable elements are frequently targets for methylation (22). Interestingly, the ESTs SSL485 containing non-coding Skipper sequences and SLC703 at the very end of the RT/integrase sequence were not overexpressed in the mutant. Skipper has 20 copies in the Dictyostelium genome and consists of direct long terminal repeats and three open reading frames (ORFs) encoding GAG (matrix protein), PRO (protease) and RT (reverse transcriptase), POL (polymerase) and IN (invertase) (47). Skipper is expressed at very low levels during growth and development. Bisufite sequencing of a 294 bp region in the RT gene bottom strand showed that 12 out of 21 C-residues were methylated. Methylation was mostly at asymmetric sites and could not be correlated with any obvious sequence context (Figure 4A). By bisulfite sequencing of the RT fragment derived from the dnmA knock-out strain no methylated C-residues (with the exception of two that are likely to be artifacts, see below) could be detected. This indicated that methylation within this sequence depended on DnmA.
|
Bisulfite sequencing of 214 bp of the Skipper LTR bottom strand revealed no methylation of the 12 C-residues within this sequence (Figure 4B).
We then analysed the retrotransposon DIRS-1 that was not covered by the microarray. DIRS-1 occurs in 40 complete and
200 incomplete copies in the genome. It consists of inverted long terminal repeats and three overlapping open reading frames encoding protein1, reverse transcriptase and a recombinase. In addition, a heat-shock-induced transcript in antisense orientation termed E1 is derived from the right LTR of the locus. Transcription of DIRS-1 is developmentally regulated and expression increases substantially after the onset of starvation (4850).
We sequenced 128 bp of the right LTR (bottom strand) and found that 7 out of 23 C-residues in this region were consistently methylated (Figure 4C). Similar to the results from Skipper, methylation sites were mostly asymmetric and no obvious sequence context could be correlated with methylation.
Using DNA derived from the knock-out strain, no DNA methylation (with the exception of four that are likely to be artifacts, see below) could be detected, thus indicating that DnmA was responsible for all C modification of DIRS-1, as we had seen for Skipper.
Overall, eight non-converted C-residues were found by bisulfite sequencing in the dnmA mutant strain (two in Skipper RT, two in Skipper LTR and four in DIRS-1 LTR). This is a very small proportion of the unambiguously sequenced C-residues and we assume that this is due to an incomplete bisulfite reaction, or to PCR or sequencing errors. Importantly, most of these cytosine residues were never found to be methylated in the wild type and thus likely represent an in vitro artifact. However, we cannot exclude that an additional minor, non-conventional methyltransferase is active in the knock-out strain.
Expression of Skipper and DIRS-1 in dnmA knock-out cells and other mutants
Skipper as well as DIRS-1 are barely expressed in cells growing in axenic suspension culture. We were interested to see whether the loss of C-methylation had an influence on the abundance of transcripts from both transposons as suggested for Skipper by the microarray. We examined RNA in the mutant and in the wild type after multiple passages through the differentiation cycle, assuming that transposon mobilization may be activated during development. Cells were grown on a lawn of K.aerogenes until they had developed mature fruiting bodies; spores were harvested and used to inoculate a new plate to begin the next cycle. After 0 and 16 cycles, spores were transferred to axenic medium and cells were grown up to prepare RNA. After 16 cycles, mutant cells were severely compromised in growth on axenic medium in one experiment (generation time of
25 h) but not in a second experiment over 16 cycles. This could be due to retrotransposon activation that may affect growth in one but not the other population. Wild-type cells displayed the normal generation time of 8 h over at least 20 passages in two independent experiments. Northern blot analysis revealed that DIRS-1 expression during growth was unaffected in the mutant while Skipper expression was significantly upregulated and further increased after 16 rounds of development (Figure 5A). Interestingly, Skipper expression was also stronger in wild-type cells after 16 rounds of growth and development even though no significant effect on the doubling time was detected. This suggested that the frequently observed genome instability of laboratory strains after prolonged growth could be due to transposon activation.
|
In S.pombe siRNAs are involved in chromatin remodelling (10,51) and in plants(18), de novo DNA methylation is mediated by small RNAs (18). We therefore examined if Skipper and DIRS-1 expression was impaired in mutants affecting the RNAi pathway. As shown in Figure 5B, Skipper expression was not only upregulated in the dnmA knock-out but also in strains where one of the three RdRP genes (25) was disrupted. A minor degree of overexpression was also observed in dicer A (drnA) and the heterochromatin protein gene hcpA (M. Kaller, U. Euteneuer and W. Nellen, manuscript submitted) knock-outs. In contrast, DIRS-1 expression was only affected in the rrpC mutant. The data showed that components of the RNAi pathway are involved in suppression of both retrotransposons but that DIRS-1 and Skipper are regulated by distinct mechanisms.
siRNAs cover the entire DIRS-1 sequence
The observation that components of the RNAi pathway were involved in the silencing of the retrotransposons prompted us to search for siRNAs complementary to Skipper and DIRS-1. Out of more than 9000 small RNAs represented in two small RNA libraries,
600 were complementary to either the bottom or the top strand of DIRS-1 (Figure 6, for details see Supplementary Figure 1S). Even though the libraries are probably not complete, DIRS-1 siRNAs are clearly overrepresented because the retrotransposon contributes
3.2% to the total Dictyostelium genome (26) but more than 7.2% of the siRNAs contain DIRS-1 sequences. In contrast,
1% of the genome are Skipper sequences but no siRNAs corresponding to the complete element were found.
|
Mobilization of Skipper
To examine whether the increase of Skipper transcription had an effect on retrotransposon mobility, DNA was isolated from cell populations grown continuously over 0 and 16 passages of the life cycle. DNA was digested with SacI that generates a close to full-length fragment of 7 kb for Skipper and more than 4.5 kb for DIRS-1 from all complete copies. Southern analysis was carried out using specific Skipper and DIRS-1 fragments as probes. Hybridization signals were adjusted by comparison with ethidium bromide staining in two regions of the gel and by hybridization to a single copy gene (eriA) on the same filter. The relative copy number was calculated for both transposable elements. Figure 7A shows the Southern blot for wild-type and dnmA cells after 0 and 16 cycles of growth and development, and Figure 7B shows the change in relative copy number of the retrotransposons. No difference was detected for DIRS-1 while Skipper had already increased by 40% in mutant cells after selection of the transformants. A further increase was observed after 16 passages of growth and development to a total of 70% above the wild-type value. Wild-type cells were largely unaffected by multiple growth and development cycles and no increase of copy number was observed for either transposon.
|
| DISCUSSION |
|---|
|
|
|---|
Until now, Dictyostelium DNA was considered not to be modified by cytosine methylation (27). With the completion of the genome sequencing project (26), a gene, dnmA, highly homologous to the methyltransferases of the Dnmt2 family, was detected. We show here that the dnmA gene product is responsible for methylation of C-residues in the retrotransposons Skipper and DIRS-1. As might be expected, a disruption of the methyltransferase gene results in transcriptional activation of Skipper and, probably as a consequence, in mobilization of the retrotransposon. Surprisingly, DIRS-1 expression is not affected by a loss of DNA methylation. We assume that the different organization and the different strategies of transposition of the elements may cause this discrepancy: While DIRS-1 has inverted terminal repeats that contain methylated C-residues, Skipper has direct terminal repeats that are not methylated. Furthermore, there are many incomplete copies of DIRS-1 in the genome and the element frequently transposes into its own copies while Skipper has almost exclusively complete and separate copies in the genome. DIRS-1 appears to constitute centromeres in Dictyostelium and is also clustered in the vicinity of the telomeres while Skipper is more spread out over the genome (50). Though these characteristics argue for mechanistic differences in transposition, they cannot functionally explain the susceptibility of Skipper but not DIRS-1 expression to DNA methylation. It is noteworthy that the promoter for Skipper transcription is probably located in the LTR and promoter methylation usually causes transcriptional silencing. In the case of Skipper, however, coding sequences rather than the LTR are methylated. We therefore propose that DNA methylation causes chromatin remodelling over the entire retroelement and thus blocks accessibility for the transcription machinery. The component(s) mediating chromatin remodelling remain elusive since a search for methyl-C binding proteins in the Dictyostelium database did not reveal any candidate gene containing significant similarity to methyl binding domains. This may not be surprising since conventional MBDs bind to the symmetric CpG motif in a certain sequence context (52) and most methylated C-residues are in a non-symmetric context in Dictyostelium. In contrast, Drosophila contains a putative methyl-C binding protein MBD2/3 that associates with specific regions in the DNA (53) but it has not been shown to bind to the methylated, asymmetric C-residues.
In yeast, siRNAs are required to recruit heterochromatin components to specific sites in the genome (10) and in plants DNA methylation is targeted by small RNAs (18). We therefore investigated whether siRNAs complementary to retrotransposon sequences could be found. Again, completely different results were obtained for the two retroelements: while no siRNAs corresponding to the complete Skipper element could be detected, more than 600 different molecules were found for DIRS-1. Since siRNAs covered essentially the entire DIRS-1 sequence, all methylation sites in the short segment that we sequenced by the bisulfite method had a corresponding siRNA. However, not all siRNAs covered C-residues that were methylated. Since methylation sites are mostly asymmetric, cytosine modification has to occur de novo as would be predicted for a Dnmt2-like enzyme (54). Our observations strongly suggest that siRNAs are involved in DNA methylation. However, their role in the regulation of DNA methylation cannot be determined at this point. In fact, it has been shown in Neurospora that de novo DNA methylation is independent of RNAi (55).
With the detection of siRNAs for DIRS-1, it was obvious to examine if components of the RNAi machinery were involved in silencing of the retrotransposons. The results were unexpected since Skipper silencing was strongly dependent on functional RdRPs and the dicer A gene even though no siRNAs had been found. In contrast, DIRS-1 expression was induced only when the RdRPC gene (rrpC) was knocked out. In a previous study (25), we had shown that rrpC was not required for post-transcriptional gene silencing by RNAi. However, rrpC is necessary for PTGS mediated by antisense RNA, indicating differences between gene silencing by single stranded (antisense) and double-stranded (RNAi) RNA molecules (H. Martens and W. Nellen, unpublished data). It is tempting to correlate this with the fact that the antisense transcript E1 is transcribed from the right DIRS-1 LTR. The observation that a knock out of the Dictyostelium Dicer homologue drnA had no effect on DIRS-1 expression could be explained by the activity of the second Dicer gene drnB. However, since Skipper was clearly upregulated in a drnA knock-out strain, this provides evidence that the two dicer genes are not completely redundant.
In a transposition active transcript of DIRS-1, the inverted repeats can form a double strand of more than 300 bp and the formation of a 1.7 kb double strand with the antisense transcript E1 (49,56) is feasible. However, siRNAs are also found in regions that do not form putative double strands. They may therefore originate from RdRP copies of the primary transcript and would thus constitute secondary siRNAs (57). Alternatively, an antisense strand could be generated by an RNA polymerase IV-like activity that has recently been detected in Arabidopsis (19,21). However, a polymerase IV-like enzyme has not yet been identified in Dictyostelium. Though we do not know whether the abundant siRNAs that we found for DIRS-1 are functionally involved in silencing, it is still surprising that most knock outs of RNAi components (except for rrpC) did not show an effect on DIRS-1 activity. Possibly, DNA methylation followed by chromatin remodelling as proposed above and antisense regulation provide redundant pathways for DIRS-1 silencing and both alone are sufficient. In contrast, Skipper, responded to the gene knock outs as if it was silenced by the RNAi machinery. Though no Skipper siRNAs were found, they could still be generated but escape detection due to rapid turnover or low abundance.
Various mechanisms to silence transposons and retrotransposons in one organism have been observed (19,22). In Arabidopsis, different classes of transposable elements are regulated by different, though overlapping mechanisms that require DNA methylation, histone modification and the RNAi system. Remarkably, different components contribute to various degrees to silencing of specific transposable elements. In addition, transcriptional and post-transcriptional mechanisms contribute simultaneously to the silencing machinery.
In an independent approach, Shaulsky and co-workers detected low levels of DnmA dependent DNA methylation in Dictyostelium (M. Katoh, T. Curk, Q. Xu, B. Zupan, A. Kuspa, G. Shaulsky, in press). Using methylation sensitive restriction enzymes, they identified methylated CpG sites in DIRS-1 and in the guaB gene.
Taken together, our data establish Dictyostelium as a model system to study mechanisms of epigenetic gene regulation by DNA methylation and RNA interference. Both mechanisms appear to overlap in function to silence the retrotransposons DIRS-1 and Skipper but further experiments are required to elucidate how the two pathways interact.
| SUPPLEMENTARY DATA |
|---|
|
|
|---|
Supplementary Data are available at NAR Online.
| ACKNOWLEDGEMENTS |
|---|
The authors thank Michael Wassenegger (Centrum Grüne Gentechnik, Neustadt) for providing DNA from tobacco infected with PSTVd. Harald Rühling (Cell Biology, University Kassel) is acknowledged for support with microscopy. The authors thank Gad Shaulsky for communicating data prior to publication. This work was supported by grants of the Deutsche Forschungsgemeinschaft [SPP 1129, Ne285/8 and by the EU (STREP Fosrak)]. B.E.B. was in part supported by a stipend from the Otto-Braun-Fonds. Funding to pay the Open Access publication charges for this article was provided by the Deutsche Forschungsgemeinschaft.
Conflict of interest statement. None declared.
| Footnotes |
|---|
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors
| REFERENCES |
|---|
|
|
|---|
- Bird, A. (2002) DNA methylation patterns and epigenetic memory Genes Dev., 16, 621
[Free Full Text] . - Li, E. (2002) Chromatin modification and epigenetic reprogramming in mammalian development Nature Rev. Genet., 3, 662673[CrossRef][Web of Science][Medline] .
- Bestor, T.H. and Ingram, V.M. (1983) Two DNA methyltransferases from murine erythroleukemia cells: purification, sequence specificity, and mode of interaction with DNA Proc. Natl Acad. Sci. USA, 80, 55595563
[Abstract/Free Full Text] . - Gruenbaum, Y., Cedar, H., Razin, A. (1982) Substrate and sequence specificity of a eukaryotic DNA methylase Nature, 295, 620622[CrossRef][Medline] .
- Hsieh, C.L. (1999) In vivo activity of murine de novo methyltransferases, Dnmt3a and Dnmt3b Mol. Cell. Biol., 19, 82118218
[Abstract/Free Full Text] . - Lyko, F., Ramsahoye, B.H., Kashevsky, H., Tudor, M., Mastrangelo, M.A., Orr-Weaver, T.L., Jaenisch, R. (1999) Mammalian (cytosine-5) methyltransferases cause genomic DNA methylation and lethality in Drosophila Nature Genet., 23, 363366[CrossRef][Web of Science][Medline] .
- Okano, M., Xie, S., Li, E. (1998) Dnmt2 is not required for de novo and maintenance methylation of viral DNA in embryonic stem cells Nucleic Acids Res., 26, 25362540
[Abstract/Free Full Text] . - Okano, M., Bell, D.W., Haber, D.A., Li, E. (1999) DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development Cell, 99, 247257[CrossRef][Web of Science][Medline] .
- Ramsahoye, B.H., Biniszkiewicz, D., Lyko, F., Clark, V., Bird, A.P., Jaenisch, R. (2000) Non-CpG methylation is prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a Proc. Natl Acad. Sci. USA, 97, 52375242
[Abstract/Free Full Text] . - Verdel, A., Jia, S., Gerber, S., Sugiyama, T., Gygi, S., Grewal, S.I. (2004) RNAi-mediated targeting of heterochromatin by the RITS complex Science, 28, 127132 .
- Burgers, W.A., Fuks, F., Kouzarides, T. (2002) DNA methyltransferases get connected to chromatin Trends Genet., 18, 275277[CrossRef][Web of Science][Medline] .
- Lyko, F., Ramsahoye, B.H., Jaenisch, R. (2000) DNA methylation in Drosophila melanogaster Nature, 408, 538540[CrossRef][Medline] .
- Tamaru, H. and Selker, E.U. (2001) A histone H3 methyltransferase controls DNA methylation in Neurospora crassa Nature, 414, 277283[CrossRef][Medline] .
- Matzke, M.A. and Birchler, J.A. (2005) RNAi-mediated pathways in the nucleus Nature Rev. Genet., 6, 2435[CrossRef][Web of Science][Medline] .
- Hall, I.M., Shankaranarayana, G.D., Noma, K., Ayoub, N., Cohen, A., Grewal, S.I. (2002) Establishment and maintenance of a heterochromatin domain Science, 297, 22322237
[Abstract/Free Full Text] . - Volpe, T.A., Kidner, C., Hall, I.M., Teng, G., Grewal, S.I., Martienssen, R.A. (2002) Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi Science, 297, 18331837
[Abstract/Free Full Text] . - Wassenegger, M., Heimes, S., Riedel, L., Sanger, H.L. (1994) RNA-directed de novo methylation of genomic sequences in plants Cell, 76, 567576[CrossRef][Web of Science][Medline] .
- Mette, M.F., Aufsatz, W., van der Winden, J., Matzke, M.A., Matzke, A.J. (2000) Transcriptional silencing and promoter methylation triggered by double-stranded RNA EMBO J., 19, 51945201[CrossRef][Web of Science][Medline] .
- Kanno, T., Huettel, B., Mette, M.F., Aufsatz, W., Jaligot, E., Daxinger, L., Kreil, D.P., Matzke, M., Matzke, A.J. (2005) Atypical RNA polymerase subunits required for RNA-directed DNA methylation Nature Genet., 37, 761765[CrossRef][Web of Science][Medline] .
- Vaucheret, H. (2005) RNA polymerase IV and transcriptional silencing Nature Genet., 37, 659660[CrossRef][Web of Science][Medline] .
- Herr, A.J., Jensen, M.B., Dalmay, T., Baulcombe, D.C. (2005) RNA polymerase IV directs silencing of endogenous DNA Science, 308, 118120
[Abstract/Free Full Text] . - Lippman, Z., May, B., Yordan, C., Singer, T., Martienssen, R. (2003) Distinct mechanisms determine transposon inheritance and methylation via small interfering RNA and histone modification PLoS Biol., 1, E67[Medline] .
- Vastenhouw, N.L. and Plasterk, R.H. (2004) RNAi protects the Caenorhabditis elegans germline against transposition Trends Genet., 20, 314319[CrossRef][Web of Science][Medline] .
- Vastenhouw, N.L., Fischer, S.E., Robert, V.J., Thijssen, K.L., Fraser, A.G., Kamath, R.S., Ahringer, J., Plasterk, R.H. (2003) A genome-wide screen identifies 27 genes involved in transposon silencing in C.elegans Curr. Biol., 13, 13111316[CrossRef][Web of Science][Medline] .
- Martens, H., Novotny, J., Oberstrass, J., Steck, T.L., Postlethwait, P., Nellen, W. (2002) RNAi in Dictyostelium: the role of RNA-directed RNA polymerases and double-stranded RNase Mol. Biol. Cell, 13, 445453
[Abstract/Free Full Text] . - Eichinger, L., Pachebat, J.A., Glockner, G., Rajandream, M.A., Sucgang, R., Berriman, M., Song, J., Olsen, R., Szafranski, K., Xu, Q., et al. (2005) The genome of the social amoeba Dictyostelium discoideum Nature, 435, 4357[CrossRef][Medline] .
- Smith, S.S. and Ratner, D.I. (1991) Lack of 5-methylcytosine in Dictyostelium discoideum DNA Biochem. J., 277, 273275[Medline] .
- Ponger, L. and Li, W.H. (2005) Evolutionary diversification of DNA methyltransferases in eukaryotic genomes Mol. Biol. Evol., 22, 11191128
[Abstract/Free Full Text] . - Sussman, M. (1987) Cultivation and synchronous morphogenesis of Dictyostelium under controlled experimental conditions Methods Cell. Biol., 28, 929[Web of Science][Medline] .
- Sutoh, K. (1993) A transformation vector for Dictyostelium discoideum with a new selectable marker bsr Plasmid, 30, 150154[CrossRef][Web of Science][Medline] .
- Nellen, W., Datta, S., Reymond, C., Sivertsen, A., Mann, S., Crowley, T., Firtel, R.A. (1987) Molecular biology in Dictyostelium: tools and applications Methods Cell. Biol., 28, 67100[Web of Science][Medline] .
- Howard, P.K., Ahern, K.G., Firtel, R.A. (1988) Establishment of a transient expression system for Dictyostelium discoideum Nucleic Acids Res., 16, 26132623
[Abstract/Free Full Text] . - Maniak, M., Saur, U., Nellen, W. (1989) A colony-blot technique for the detection of specific transcripts in eukaryotes Anal. Biochem., 176, 7881[CrossRef][Web of Science][Medline] .
- Crowley, T.E., Nellen, W., Gomer, R.H., Firtel, R.A. (1985) Phenocopy of discoidin I-minus mutants by antisense transformation in Dictyostelium Cell, 43, 633641[CrossRef][Web of Science][Medline] .
- Feinberg, A.P. and Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity Anal. Biochem., 132, 613[CrossRef][Web of Science][Medline] .
- Lee, R.C. and Ambros, V. (2001) An extensive class of small RNAs in Caenorhabditis elegans Science, 294, 862864
[Abstract/Free Full Text] . - Lau, N.C., Lim, L.P., Weinstein, E.G., Bartel, D.P. (2001) An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans Science, 294, 858862
[Abstract/Free Full Text] . - Kennedy, S., Wang, D., Ruvkun, G. (2004) A conserved siRNA-degrading RNase negatively regulates RNA interference in C.elegans Nature, 427, 645649[CrossRef][Medline] .
- Curradi, M., Izzo, A., Badaracco, G., Landsberger, N. (2002) Molecular mechanisms of gene silencing mediated by DNA methylation Mol. Cell. Biol., 22, 31573173
[Abstract/Free Full Text] . - Stach, D., Schmitz, O.J., Stilgenbauer, S., Benner, A., Dohner, H., Wiessler, M., Lyko, F. (2003) Capillary electrophoretic analysis of genomic DNA methylation levels Nucleic Acids Res., 31, E2[Medline] .
- Farbrother, P., Wagner, C., Na, J., Tunggal, B., Morio, T., Urushihara, H., Tanaka, Y., Schleicher, M., Steinert, M., Eichinger, L. (2005) Dictyostelium transcriptional host cell response upon infection with Legionella Cell. Microbiol., in press .
- Wetterauer, B., Jacobsen, G., Morandini, P., MacWilliams, H. (1993) Mutants of Dictyostelium discoideum with defects in the regulation of discoidin I expression Dev. Biol., 159, 184195[CrossRef][Web of Science][Medline] .
- Dong, A., Yoder, J.A., Zhang, X., Zhou, L., Bestor, T.H., Cheng, X. (2001) Structure of human DNMT2, an enigmatic DNA methyltransferase homolog that displays denaturant-resistant binding to DNA Nucleic Acids Res., 29, 439448
[Abstract/Free Full Text] . - Reinhardt, A. and Hubbard, T. (1998) Using neural networks for prediction of the subcellular location of proteins Nucleic Acids Res., 26, 22302236
[Abstract/Free Full Text] . - Nair, R. and Rost, B. (2005) Mimicking cellular sorting improves prediction of subcellular localization J. Mol. Biol., 348, 85100[CrossRef][Web of Science][Medline] .
- Sijen, T., Vijn, I., Rebocho, A., van Blokland, R., Roelofs, D., Mol, J.N., Kooter, J.M. (2001) Transcriptional and posttranscriptional gene silencing are mechanistically related Curr. Biol., 11, 436440[CrossRef][Web of Science][Medline] .
- Leng, P., Klatte, D.H., Schumann, G., Boeke, J.D., Steck, T.L. (1998) Skipper, an LTR retrotransposon of Dictyostelium Nucleic Acids Res., 26, 20082015
[Abstract/Free Full Text] . - Zuker, C., Cappello, J., Lodish, H.F., George, P., Chung, S. (1984) Dictyostelium transposable element DIRS-1 has 350-base-pair inverted terminal repeats that contain a heat shock promoter Proc. Natl Acad. Sci. USA, 81, 26602664
[Abstract/Free Full Text] . - Rosen, E., Sivertsen, A., Firtel, R.A. (1983) An unusual transposon encoding heat shock inducible and developmentally regulated transcripts in Dictyostelium Cell, 35, 243251[CrossRef][Web of Science][Medline] .
- Glockner, G., Szafranski, K., Winckler, T., Dingermann, T., Quail, M.A., Cox, E., Eichinger, L., Noegel, A.A., Rosenthal, A. (2001) The complex repeats of Dictyostelium discoideum Genome Res., 11, 585594
[Abstract/Free Full Text] . - Noma, K., Sugiyama, T., Cam, H., Verdel, A., Zofall, M., Jia, S., Moazed, D., Grewal, S.I. (2004) RITS acts in cis to promote RNA interference-mediated transcriptional and post-transcriptional silencing Nature Genet., 36, 11741180[CrossRef][Web of Science][Medline] .
- Klose, R.J., Sarraf, S.A., Schmiedeberg, L., McDermott, S.M., Stancheva, I., Bird, A.P. (2005) DNA binding selectivity of MeCP2 due to a requirement for A/T sequences adjacent to methyl-CpG Mol. Cell., 19, 667678[CrossRef][Web of Science][Medline] .
- Marhold, J., Zbylut, M., Lankenau, D.H., Li, M., Gerlich, D., Ballestar, E., Mechler, B.M., Lyko, F. (2002) Stage-specific chromosomal association of Drosophila dMBD2/3 during genome activation Chromosoma, 111, 1321[CrossRef][Web of Science][Medline] .
- Mund, C., Musch, T., Strodicke, M., Assmann, B., Li, E., Lyko, F. (2004) Comparative analysis of DNA methylation patterns in transgenic Drosophila overexpressing mouse DNA methyltransferases Biochem. J., 378, 763768[CrossRef][Web of Science][Medline] .
- Freitag, M., Lee, D.W., Kothe, G.O., Pratt, R.J., Aramayo, R., Selker, E.U. (2004) DNA methylation is independent of RNA interference in Neurospora Science, 304, 19391939
[Free Full Text] . - Cappello, J., Zuker, C., Lodish, H.F. (1984) Repetitive Dictyostelium heat-shock promotor functions in Saccharomyces cerevisiae Mol. Cell. Biol., 4, 591598
[Abstract/Free Full Text] . - Sijen, T., Fleenor, J., Simmer, F., Thijssen, K.L., Parrish, S., Timmons, L., Plasterk, R.H., Fire, A. (2001) On the role of RNA amplification in dsRNA-triggered gene silencing Cell, 107, 465476[CrossRef][Web of Science][Medline]
.
This article has been cited by other articles:
![]() |
G. Glockner and A. J. Heidel Centromere sequence and dynamics in Dictyostelium discoideum Nucleic Acids Res., April 1, 2009; 37(6): 1809 - 1816. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. P. Jurkowski, M. Meusburger, S. Phalke, M. Helm, W. Nellen, G. Reuter, and A. Jeltsch Human DNMT2 methylates tRNAAsp molecules using a DNA methyltransferase-like catalytic mechanism RNA, August 1, 2008; 14(8): 1663 - 1670. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Larsson, A. Hinas, D. H. Ardell, L. A. Kirsebom, A. Virtanen, and F. Soderbom De novo search for non-coding RNA genes in the AT-rich genome of Dictyostelium discoideum: Performance of Markov-dependent genome feature scoring Genome Res., June 1, 2008; 18(6): 888 - 899. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gissot, S.-W. Choi, R. F. Thompson, J. M. Greally, and K. Kim Toxoplasma gondii and Cryptosporidium parvum Lack Detectable DNA Cytosine Methylation Eukaryot. Cell, March 1, 2008; 7(3): 537 - 540. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Garrison, S. R. Yant, J. G. Mikkelsen, and M. A. Kay Postintegrative Gene Silencing within the Sleeping Beauty Transposition System Mol. Cell. Biol., December 15, 2007; 27(24): 8824 - 8833. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hinas, J. Reimegard, E. G. H. Wagner, W. Nellen, V. R. Ambros, and F. Soderbom The small RNA repertoire of Dictyostelium discoideum and its regulation by components of the RNAi pathway Nucleic Acids Res., November 29, 2007; 35(20): 6714 - 6726. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Diaz-Castillo and K. G. Golic Evolution of Gene Sequence in Response to Chromosomal Location Genetics, September 1, 2007; 177(1): 359 - 374. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shimada and T. Kawata Evidence that Noncoding RNA dutA Is a Multicopy Suppressor of Dictyostelium discoideum STAT Protein Dd-STATa Eukaryot. Cell, June 1, 2007; 6(6): 1030 - 1040. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. LEE, C. M. HAMMELL, and V. AMBROS Interacting endogenous and exogenous RNAi pathways in Caenorhabditis elegans RNA, April 1, 2006; 12(4): 589 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kaller, U. Euteneuer, and W. Nellen Differential Effects of Heterochromatin Protein 1 Isoforms on Mitotic Chromosome Distribution and Growth in Dictyostelium discoideum Eukaryot. Cell, March 1, 2006; 5(3): 530 - 543. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Popova, M. Kuhlmann, A. Hinas, F. Soderbom, and W. Nellen HelF, a putative RNA helicase acts as a nuclear suppressor of RNAi but not antisense mediated gene silencing Nucleic Acids Res., February 2, 2006; 34(3): 773 - 784. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||














