Skip Navigation

Nucleic Acids Research 2005 33(4):1290-1297; doi:10.1093/nar/gki200
This Article
Right arrow Abstract Freely available
Right arrow Print PDF (251K) Freely available
Right arrow Screen PDF (211K) Freely available
Right arrow Supplementary Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (230)
Citing Articles
Right arrowScopus Links
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Cheng, A. M.
Right arrow Articles by Ford, L. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, A. M.
Right arrow Articles by Ford, L. P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published online 1 March 2005

© The Author 2005. Published by Oxford University Press. All rights reserved
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions{at}oupjournals.org


Article

Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis

Angie M. Cheng, Mike W. Byrom, Jeffrey Shelton and Lance P. Ford*

Ambion, Inc. 2130 Woodward Street, Austin, TX 78744-1832, USA

*To whom correspondence should be addressed. Tel: +1 512 651 0200; Fax: +1 512 651 0201; Email: lford{at}ambion.com

Received November 9, 2004. Revised February 2, 2005. Accepted February 10, 2005.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Of the over 200 identified mammalian microRNAs (miRNAs), only a few have known biological activity. To gain a better understanding of the role that miRNAs play in specific cellular pathways, we utilized antisense molecules to inhibit miRNA activity. We used miRNA inhibitors targeting miR-23, 21, 15a, 16 and 19a to test efficacy of antisense molecules in reducing miRNA activity on reporter genes bearing miRNA-binding sites. The miRNA inhibitors de-repressed reporter gene activity when a miRNA-binding site was cloned into its 3'-untranslated region. We employed a library of miRNA inhibitors to screen for miRNA involved in cell growth and apoptosis. In HeLa cells, we found that inhibition of miR-95, 124, 125, 133, 134, 144, 150, 152, 187, 190, 191, 192, 193, 204, 211, 218, 220, 296 and 299 caused a decrease in cell growth and that inhibition of miR-21 and miR-24 had a profound increase in cell growth. On the other hand, inhibition of miR-7, 19a, 23, 24, 134, 140, 150, 192 and 193 down-regulated cell growth, and miR-107, 132, 155, 181, 191, 194, 203, 215 and 301 increased cell growth in lung carcinoma cells, A549. We also identified miRNA that when inhibited increased the level of apoptosis (miR-1d, 7, 148, 204, 210, 216 and 296) and one miRNA that decreased apoptosis (miR-214) in HeLa cells. From these screens, we conclude that miRNA-mediated regulation has a complexity of cellular outcomes and that miRNAs can be mediators of regulation of cell growth and apoptosis pathways.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Cellular microRNAs (miRNAs) are a class of 17–24 base single-stranded RNA molecules that are expressed in cells from plants to animals (1). MiRNAs are expressed as long precursor RNAs that get processed by a cellular nuclease, Drosha, before being transported by an Exportin-5-dependent mechanism into the cytoplasm (2). Once in the cytoplasm miRNAs are cleaved further by the enzyme DICER (3,4) and the resulting 17–24 nt miRNAs associate with a cellular complex that is at least similar to the RNA-induced silencing complex that participates in RNA interference (5). The complex-bound single-stranded miRNA guides the complex to mRNAs with sequences that are at least partially complementary to the miRNA. The translation of the bound mRNA is inhibited by a mechanism that is not fully understood (6).

MiRNAs are a very prevalent class of cellular RNAs, but because they have only recently been identified, very few miRNAs have known cellular functions. Currently, the best understood miRNA, lin-4, was first identified in Caenorhabditis elegans [reviewed in (7,8)]. Research revealed that lin-4 accumulates during the first and second larval stages and triggers passage to the third larval stage by repressing the translation of at least two genes, lin-14 and lin-28 (9). The activity of lin-4 depends on the partial homology of the miRNA to specific regions of the 3'-untranslated regions (3'-UTRs) of the lin-14 and lin-28 mRNAs (9,10). A second miRNA, let-7 accumulates during C.elegans larval development and triggers passage from late larval to adult cell fates (11,12). A few other miRNAs, such as bantam and miR-14, have at least partial defined roles in cells (13,14). Currently, only a few mammalian miRNAs have been shown to have a defined role in a biological process while associations have implicated others. In one example, the mammalian miRNA, miR-181, was found to be specifically expressed and dynamically regulated in hematopoietic cells, and its expression in hematopoietic stem/progenitor cells increased the fraction of B-cells in both tissue culture and adult mice (15).

Four reports have correlated aberrant miRNA expression with cancer, cancer-associated genomic regions and fragile sites in chromosomes. First, loss at 13q14 constitutes the most frequent chromosomal abnormality in chronic lymphocytic leukemia (CLL), suggesting the involvement of one or more tumor suppressor genes at this locus. Although several groups had performed detailed genetic analyses, including extensive loss of heterozygosity, mutation and expression studies, no consistent involvement of any of the genes with open reading frames located in the deleted region was demonstrated. Interestingly, the genes for miR-15 and miR-16 are located at this locus and appear to be deleted in the majority of B-CLL cases (16). Second, studies of miRNA expression in colonic adenocarcinoma and normal mucosa were used to identify potential links between miRNA expression/maturation and cancer (17). Out of 28 miRNAs identified in human colorectal mucosa, two (miR-143 and miR-145) proved to be significantly down-regulated in 12 adenocarcinoma samples compared with matched, normal tissues. Third, the human BIC RNA is elevated in children with Lymphoma. Metzler and co-workers (18) indicate that the BIC gene encodes miR-155. Using PCR, they demonstrate that the expression of the precursor of miR-155 is found in children with Burkitt Lymphoma, but not patients with pediatric leukemia. Fourth, in a recent study, the chromosomal locations of 186 miRNA genes were mapped and compared with the location of non-random genetic alterations (19). Over 52% of the miRNA genes analyzed are in cancer-associated genomic regions or in fragile sites. This study also found that several miRNAs located in deleted regions are expressed at low levels in cancer samples.

As stated above, miRNA bind to mRNA targets and inhibit translation by a currently unknown mechanism. While several publications predict target genes for Drosophila and human miRNA (19,20), only a few have been confirmed using reporter genes. In the most comprehensive study to date, Lewis et al. (19) predicted mRNA targets for human miRNA and used a reporter construct with the 3'-UTRs of 16 target genes to confirm target sites for 8 miRNAs. The system of transfecting miRNA or miRNA expression vectors and reporter constructs with predicted miRNA-binding sites offers the most straightforward method for confirming target sites; however, it does not demonstrate biological significance. In light of the need to identify miRNA targets and their corresponding function, miRNA inhibitors and miRNA expression systems will also be valuable (15,2123). MiRNA inhibitors have also recently been proven to be valuable in understanding miRNA function (2224). Not only were the miRNA inhibitors shown to be active in human cells, but the let-7 antisense molecules were injected into C.elegans and found to induce a let-7 loss-of-function phenotype (24), validating the use of these molecules for miRNA inhibition.

We used a library of miRNA inhibitors in functional screening assays to identify miRNAs that affect cell proliferation and apoptosis. Before screening, we validated the efficacy of the miRNA inhibitors using a luciferase reporter bearing miRNA target sequences cloned into its 3'-UTR. In each case, the miRNA inhibitors inhibited the repression of the endogenous miRNA on the reporter gene. Screening our library of miRNA inhibitors targeting over 90 human miRNAs resulted in several interesting observations. First, the hits identified for cell growth were not the same between different cell lines. Second, both increases and decreases in cell number and apoptosis were identified. Our results indicate that miRNA-mediated gene regulatory pathways are complex and have roles in important biological processes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Reporter vectors and DNA constructs
To generate reporter vectors bearing miRNA-binding sites, we generated direct match miRNA target sites and cloned these inserts into the multiple cloning sites in the luciferase reporter vector described in Figure 1A. The sense and antisense strands of the oligonucleotides were annealed by adding 2 µg of each oligonucleotide to 46 µl of annealing solution (100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4 and 2 mM Magnesium acetate) and incubated at 90°C for 5 min and then at 37°C for 1 h. The annealed oligonucleotides were digested with HindIII and SpeI and used to ligate into HindIII and SpeI of pmir-Report luciferase (Ambion, Inc.). The oligonucleotides used in these studies were mir 21, 5'-AATGCACTAGTTCAACATCAGTCTGATAAGCTAGCTCAGCAAGCTTAATGC and 5'-GCATTAAGCTTGCTGAGCTAGCTTATCAGACTGATGTTGAACTAGTGCATT; mir 19a, 5'-AATGCACTAGTTCAGTTTTGCATAGATTTGCACAGCTCAGCAAGCTTAATGC and 5'-GCATTAAGCTTGCTGAGCTGTGCAAATCTATGCAAAACTGAACTAGTGCATT; mir 23, 5'-AATGCACTAGTGGAAATCCCTGGCAATGTGATGCTCAGCAAGCTTAATGC and 5'-GCATTAAGCTTGCTGAGCATCACATTGCCAGGGATTTCCACTAGT GCATT; mir15, 5'-AATGCACTAGTCACAAACCATTATGTGCTGCTAGCTCAGCAAGCTTAATGC and 5'-GCATTAAGCTTGCTGAGCTAGCAGCACATAATGGTTTGTGACTAGTGCATT; and mir 16, 5'-AATGCACTAGTCGCCAATATTTACGTGCTGCTAGCTCAGCAAGCTTAATGC and 5'-GCATTAAGCTTGCTGAGCTAGCAGCACGTAAATATTGGCGACTAGTGCATT. A BlpI site (underlined) was added into each insert to test for positive clones.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1 (A) MiRNA reporter vectors used to analyze miRNA activity. The restriction sites for cloning the miRNA-binding sites are located in the 3'-UTR of the luciferase gene in the pmir-Report luciferase vector. Once cloned the miRNA-binding site vector is co-transfected with the pmir-Report ß-gal vector as a control for transfection efficiency and a miRNA inhibitor molecule that is specific to the binding site or is mutated as compared with the binding site. (B) Enhanced expression of miRNA-regulated reporter by miRNA inhibitors. HeLa cells were plated at 50 000 cells/well in 24-well plates. Cells were transfected using lipofectamine 2000 in duplicate with pmir-REPORT ß-gal, a luciferase reporter construct that contained one target site for either miR-23, miR-21, miR-15a, miR-16 or miR-19a and either inhibitors for these miRNA or a negative control (NC). HeLa cells were also transfected with a control luciferase reporter vector lacking a miRNA-binding site without an inhibitor to demonstrate the level of activity that can be achieved for an unmodified pmir-REPORT luciferase. Twenty-four hours post-transfection cells were assayed for luciferase and ß-gal expression, and ß-gal is used to normalize for differences in transfection efficiency.

 
Sequence of miRNA inhibitors
The sequences of the inhibitors used in our studies are listed in the Supplementary Material and are the exact antisense copy of the mature miRNA sequence that can be found in the miRNA Registry (25), where all the nucleotides in the inhibitors contain 2'-OMe modifications at every base and a 3' C3 containing amino linker.

Transfections
All transfections were carried out in triplicate. To transfect, we diluted 5 pmol inhibitor into 10 µl Opti-Mem into each well. We next diluted 0.3 µl NeoFx (Ambion, Inc.) into 10 µl Opti-MEM for each sample, incubated for 10 min at room temperature and added 10 µl of diluted transfection mixture to wells that already contain the inhibitors and incubate for another 10 min at room temperature. We next added 100 µl of diluted cell suspension mixture containing 8000 cells on top of the complex. After 24 h, the medium was changed and the samples were assayed after 72 h.

To transfect the miRNA inhibitors with reporter vectors, we pre-plated 50–60 K HeLa cells 24 h prior to transfection in 24-well tissue culture plates. The next day ~200 ng of each vector (control and experimental vector) and 10–30 pmol inhibitor were diluted into 50 µl Opti-MEM into round-bottom polystyrene tubes. Next, 3 µl of lipofectamine 2000 was diluted into 50 µl Opti-MEM and incubated at room temperature for 5 min. The diluted DNA/inhibitor was next added into the transfection agent complex and incubated at room temperature for 20 min. The growth medium was changed and 100 µl of the complex was added to the cells. Twenty-four hours following transfection reporter activity was measured.

Analysis of cell growth
To determine the number of HeLa cells remaining following transfection with the miRNA inhibitors, we fixed cells with 4% paraformaldehyde for 5 min 72 h post-transfection, permeablized with 0.1% Triton X-100 for 5 min and stained with propidium iodide. The cells were next counted using the Acumen Explorer (TTP LabTech). The relative number of cells was normalized against a negative control inhibitor, gapas, used in these experiments. To determine the number of A549 cells remaining following transfection with the miRNA inhibitors, we stained the cells using ViaCount Flex Reagent and analyzed for cell number using the Guava PCA-96 (Personal Cell Analysis). The relative cell numbers obtained from the Guava instrument were also graphed and normalized against a negative control miRNA inhibitor gapas as described above. The negative control inhibitor used in these experiments is the same sequence as a section of the GAPDH mRNA and functionality inhibits GAPDH siRNA activity (data not shown).

Caspase activity assay
The level of apoptosis in the transfected cells was determined by measuring the induction of caspase-3 activity as follows. First, the cells were washed once with phosphate-buffered saline, lysed by adding 40 µl of cold lysis buffer (50 mM HEPES, pH 7.2, 40 mM NaCl, 0.5% NP-40 and 0.5 mM EDTA) to the wells and incubated for 20 min at 4°C. Half the sample was used for analysis of caspase activity and the other half was used for analysis of esterase activity that is described below. To the half that was used for analysis of caspase-3, 160 µl of buffer (50 mM HEPES, pH 7.4, 0.1% CHAPS, 0.1 mM EDTA and 10% sucrose) +5 mM DTT containing 20 µM DEVDafc (fluorogenic substrate N-acetyl-asp-glu-val-asp-afc) substrate was added and fluorescence was measured at 400 nm/500 nm excitation/emission.

To normalize the caspase results, half of the samples were also analyzed for esterase activity. First, the fluorescein diacetate (FDA) substrate (0.4 mg/ml FDA in acetonitrile) was diluted 1:19 into dilution buffer (40 mM Tris–HCl, pH 7.5, 20 mM NaCl, 0.5% NP-40, 0.02 mg/ml final concentration). Samples were incubated for 10 min on ice, and 160 µl of diluted FDA substrate was added to each well. Fluorescence was measured for 30 min using excitation of 488 nm and emission of 529 nm.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Confirmation of miRNA inhibitor activity
To confirm the activity of miRNA inhibitors, we constructed reporter vectors that contained miRNA-binding sites for miR-23, miR-21, miR-15a, miR-16 and miR-19a. These binding sites were made by hybridizing oligonucleotides bearing the miRNA-binding sites and cloning them into the HindIII and SpeI sites of the pmir-REPORT luciferase vector (Figure 1A). This places the miRNA-binding site directly into the 3'-UTR of the luciferase gene. We tested the activity of the miRNA inhibitors by transfecting the luciferase reporter vector bearing the miRNA-binding site with the miRNA inhibitor and the pmir-Report ß-gal vector (Figure 1A) as a control for transfection efficiency. In addition, we transfected the luciferase vectors bearing the miRNA-binding sites and ß-gal vectors with a negative control inhibitor that does not target any cellular miRNA (gapas). Following transfection into HeLa cells, both luciferase and ß-gal activity were measured and the relative level of luciferase was normalized against the ß-gal readings to control for transfection variation. In each case, the miRNA inhibitors were effective at inhibiting the ability of the endogenous miRNA to inhibit the expression of the reporter gene containing the miRNA-binding site (Figure 1B). This indicates that the miRNA inhibitors are effective at inhibiting miRNA function. The extent of the induction of luciferase activity is different for several inhibitors. We have found that many of these miRNAs are expressed at varying levels in HeLa cells and this could be what is accounting for the differential effects between inhibitors and reporter vectors (Supplementary Figure 2).

Identification of miRNA involved in cell growth
After validating the miRNA inhibitors, we produced a library of over 90 miRNA inhibitors and screened for miRNAs that were important for growth in the cervical cancer-derived cell line, HeLa. In each well of a 96-well plate, an miRNA inhibitor targeting a different miRNA was transfected as described in Materials and Methods. The cells were analyzed 72 h post-transfection for cell number and the numbers obtained were normalized to the negative control gapas inhibitor. We identified a hit as anything that was 30% greater or less than gapas. Each transfection was performed in triplicate, and the standard deviations are represented on the graph shown in Figure 2. Inhibitors that had error bars that were inside the cutoff were not included as hits. Using these criteria, we identified 19 miRNA that inhibited cell growth following inhibition in HeLa cells (miR-95, 124, 125, 133, 134, 144, 150, 152, 187, 190, 191, 192, 193, 204, 211, 218, 220, 296 and 299) and 2 miRNA that had profound increases in cell growth (miR-21 and miR-24).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2 Identification of miRNAs that alter cell proliferation in HeLa cells. In 96-well plates, 8000 HeLa cells were reverse transfected with miRNA inhibitors (5 pmol) in triplicates using Ambion siPORT Neo-FX. Seventy-two hours post-transfection, cells were fixed with 4% paraformaldehyde, permeablized with 0.1% TritonX-100 and stained with propidium iodide to look at total cell number. The plates were scanned using the TTP LabTech Acumen Explorer.

 
In order to analyze whether the same miRNAs are involved in cell growth in different cell lines, we transfected the library of miRNA inhibitors into the lung carcinoma cell line, A549. Following transfection and analysis of cell number, we used the same criteria for a hit that was used above (30% above and below the gapas control transfection). As shown in Figure 3, 9 miRNAs inhibitors that down-regulated cell growth include miR-7, 19a, 23, 24, 134, 140, 150, 192 and 193 miRNAs, and 9 miRNA inhibitors that were found to increase cell growth include miR-107, 132, 155, 181a, 191, 194, 203, 215 and 301. Among these 18 miRNAs, miR-24, 134, 150, 191, 192 and 193 were also identified in the HeLa screen, miR-24, inhibitors down-regulated growth in A549 but increased cell growth in HeLa, while the other miRNAs decreased cell growth in both A549 and HeLa cells. These data demonstrate the complexity of the regulatory role miRNA play in cell growth regulation between cells and is discussed in further detail below.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 3 Screen for miRNA involved in cell viability in A549 cells. In 96-well plates, 8000 HeLa cells were reverse transfected with miRNA inhibitors (5 pmol) in triplicates using Ambion siPORT Neo-FX. Seventy-two hours post-transfection, cells were trypsinized and transferred to a non-tissue culture plate, so that cells would not adhere. Cells were stained using ViaCount Flex Reagent and analyzed for total cell number using the Guava PCA-96 (Personal Cell Analysis).

 
Identification of miRNA involved in apoptosis
We next screened for miRNAs that were involved in apoptosis in HeLa cells to identify correlations between hits that were found to reduce/increase cell number with miRNAs that reduced/increased relative amounts of apoptosis. To perform this experiment, we transfected HeLa cells with the library of miRNA inhibitors and analyzed the effects the inhibitors had on the activation of caspase-3 activity. Activation is one marker often used for analyzing the induction of apoptosis. The amount of caspase activation was compared relative with that observed with the negative control inhibitor molecule (gapas). Any miRNA that changed caspase-3 activity greater than or less than 30% compared with gapas was considered a hit. In Figure 4, we found 7 miRNA that increased the level of apoptosis (miR-1d, 7, 148, 204, 210, 216 and 296) and one miRNA that decreased apoptosis (miR-214). This data suggest that specific miRNAs are involved in the cell death response.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 4 Effects of miRNA inhibitors on caspase activity in HeLa. In 96-well plates, 8000 HeLa cells were reverse transfected with miRNA inhibitors (5 pmol) in triplicates using Ambion siPORT Neo-FX. Seventy-two hours post-transfection, cells were analyzed for caspase and esterase activity as described in the Materials and Methods. Esterase activity was used to normalize for differences in cell number that may exist owing to the miRNA inhibitor causing defects in cell growth.

 
In order to analyze interactions between miRNA that influenced cell death in HeLa cells with those that influenced apoptosis, we graphed the miRNA as a function of cell number compared with caspase-3 activity. This representation of the data quickly points out the hits that cause increases/decreases in cell growth and increases/decreases in caspase activity (Figure 5). In particular, miR-218 was found to inhibit cell growth and induce apoptosis. Thus, for miR-218, growth inhibition may be due to the induction of apoptosis. While for miR-190, cell growth inhibition did not coincide with the induction of apoptosis, suggesting that it may be inhibiting cell growth through cell cycle arrest. These data further point out the complexity of the regulatory circuitry of miRNA on biological processes.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 5 Effects of miRNA inhibitors on caspase activity compared with cell growth in HeLa cells. We graphed the data that were generated from Figures 2 and 4 together to compare hits that affected cell proliferation with those that affected apoptosis.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Reporter genes have been useful to confirm predicted miRNA-binding sites (19,20) making them a useful tool for the initial analysis of potential miRNA-binding sites. However, without evidence to demonstrate that the endogenous miRNA is changing the expression of the endogenous gene, it is difficult to know whether these results are biologically relevant. This will require that the antibody against the predicted products is available and this is not always the case. Since predicted miRNA targets are a good roadmap for possible targets, but will not always be correct, we used miRNA-binding sites that contain direct matches to the endogenous miRNA to ensure that the miRNA will function on the reporter gene (21,24,26). Since it has been shown that a miRNA can act like a siRNA and cleave the miRNA and target it for degradation, we believe this is an effective approach to have taken to verify activity of the miRNA inhibitors (27).

We synthesized over 90 miRNA inhibitors and used these to screen for miRNAs that were involved in cell growth and apoptosis processes that are among the widely studied gene cell pathways and that have direct relevance to cancer and development. In each assay, the relative cutoff for a hit was made at 30% above and below the level observed for the negative control inhibitor gapas. We could have been less stringent and pulled out additional hits; however, making this cutoff stringent allowed for the identification of only major differences in the biological activity of particular miRNA. We also did not include hits that had standard deviations that fell within the cutoff for a hit thus dropping out additional hits. Although we are not counting many miRNAs as hits due to our stringent cutoff does not mean they are not biologically relevant. It is important to mention that the miRNAs that were hits in our screens caused a phenotype by being inhibited. The miRNA may be mediating this effect through increasing protein expression of their targets that then leads to changes in growth or apoptosis. Thus, it is the gain of protein activity rather than the loss of protein activity that is the possible mechanism involved. Knowing the targets of the miRNA will yield important information about the mechanism of regulation of these processes and how they may be able to be fine-tuned with the help of miRNAs.

We first screened for miRNAs that influenced cell growth in two different types of cancer-derived cell lines, HeLa and A549 cells. From these experiments, we identified a complexity of activity for miRNAs in these different cell lines. For example, in HeLa, we found that inhibition of miR-95, 124, 125, 133, 134, 144, 150, 152, 187, 190, 191, 192, 193, 204, 211, 218, 220, 296 and 299 caused a decrease in cell growth and that inhibition of miR-21 and miR-24 had a profound increase in cell growth. The miR-21 and 24 gene deletions have been shown to be associated with chromosomal deletion sites in cancers. Since the inhibition of these genes was found to increase cell growth, it suggests that the expression of these two miRNA may be an important growth regulator in cells (19). On the other hand, miR-7, 19a, 23, 24, 134, 140, 150, 192 and 193 down-regulated cell-growth and miR-107, 132, 155, 181, 191, 194, 203, 215 and 301 increased cell growth when inhibited in A549 cells. Common miRNAs that decreased cell growth include miR-134, 192 and 193. There were no common miRNAs that increased cell growth. MiR-24 increased cell growth in HeLa but was found to decrease cell growth in A549, while miR-191 increased cell growth in A549 and decreased in HeLa. These differences observed between the same miRNA in different cell lines suggest that the targets of the miRNA may be different, the targets of the miRNA have different activities, the miRNAs are differentially expressed or due to differential transfection efficiency in the two cells types. We have ruled out different levels of transfection efficiency between the two cells lines and have identified significant differences in expression profiles between A549 and HeLa cells. Given this, one reason for observing the different hits is due to different levels of expression (Supplementary Figure 2). In addition, since no common miRNAs were found to increase cell growth between the two cell lines, another reason for observing different effects could still be due to miRNA target differences. It should also be noted that these are primary hits and require substantial downstream validation to sort out false-positive hits that may have occurred.

We also used screening to identify miRNAs involved in induction or inhibition of steady state levels of apoptosis in HeLa cells. For these studies, we identified miR-1d, 7, 148, 204, 210, 218, 296 and 381 as hits that increased the level of apoptosis and miR-214 that decreased apoptosis. In another case, miR-218 caused a decrease in cell growth in HeLa but its inhibition increased the level of apoptosis, suggesting that inhibition of miR-218 may be inhibiting cell growth by inducing apoptosis. In other sets of hits, apoptosis was found unchanged while cell growth either increased or decreased. The majority of those that did have an effect on cell growth but not apoptosis caused inhibition of growth, while only a few hits in general caused increase in growth.

The availability of libraries of miRNA inhibitors as well as methods for high-throughput delivery will make it possible to identify miRNAs involved in any cellular process for which there is a quantitative phenotypic assay. This will ultimately lead not only to a greater understanding of the regulatory mechanisms used to control cell processes but might also reveal key pathways that might be exploited for disease detection, prevention or treatment.


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at NAR Online.


    ACKNOWLEDGEMENTS
 
The authors thank Dave Brown and Manu Labourier for critical reading of the manuscript and Joe Krebs for the help with the Caspase and esterase assays. Funding to pay the Open Access publication charges for this article was provided by Ambion, Inc.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Bartel, D.P. (2004) MiRNAs: genomics, biogenesis, mechanism, and function Cell, 116, 281–297[CrossRef][Web of Science][Medline] .

  2. Yi, R., Qin, Y., Macara, I.G., Cullen, B.R. (2003) Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs Genes Dev., 17, 3011–3016[Abstract/Free Full Text] .

  3. Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim, S., Kim, V.N. (2003) The nuclear RNase III Drosha initiates miRNA processing Nature, 425, 415–419[CrossRef][Medline] .

  4. Lee, Y., Jeon, K., Lee, J.T., Kim, S., Kim, V.N. (2002) MiRNA maturation: stepwise processing and subcellular localization EMBO J., 21, 4663–4670[CrossRef][Web of Science][Medline] .

  5. Hutvagner, G. and Zamore, P.D. (2002) A miRNA in a multiple-turnover RNAi enzyme complex Science, 297, 2056–2060[Abstract/Free Full Text] .

  6. Doench, J.G. and Sharp, P.A. (2004) Specificity of microRNA target selection in translational repression Genes Dev., 18, 504–511[Abstract/Free Full Text] .

  7. Pasquinelli, A.E. and Ruvkun, G. (2002) Control of developmental timing by miRNAs and their targets Annu. Rev. Cell Dev. Biol., 18, 495–513[CrossRef][Web of Science][Medline] .

  8. Ambros, V. (2001) miRNAs: tiny regulators with great potential Cell, 107, 823–826[CrossRef][Web of Science][Medline] .

  9. Lee, R.C., Feinbaum, R.L., Ambros, V. (1993) The C.elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14 Cell, 75, 843–854[CrossRef][Web of Science][Medline] .

  10. Wightman, B., Ha, I., Ruvkun, G. (1993) Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C.elegans Cell, 75, 855–862[CrossRef][Web of Science][Medline] .

  11. Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettinger, J.C., Rougvie, A.E., Horvitz, H.R., Ruvkun, G. (2000) The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans Nature, 403, 901–906[CrossRef][Medline] .

  12. Slack, F.J., Basson, M., Liu, Z., Ambros, V., Horvitz, H.R., Ruvkun, G. (2000) The lin-41 RBCC gene acts in the C.elegans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor, Mol Cell, 4, 659–669 .

  13. Brennecke, J., Hipfner, D.R., Stark, A., Russell, R.B., Cohen, S.M. (2003) bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila Cell, 113, 25–36[CrossRef][Web of Science][Medline] .

  14. Xu, P., Vernooy, S.Y., Guo, M., Hay, B.A. (2003) The Drosophila MiRNA Mir-14 suppresses cell death and is required for normal fat metabolism Curr. Biol., 13, 790–795[CrossRef][Web of Science][Medline] .

  15. Chen, C.Z., Li, L., Lodish, H.F., Bartel, D.P. (2004) MiRNAs modulate hematopoietic lineage differentiation Science, 303, 83–86[Abstract/Free Full Text] .

  16. Calin, G.A., Dumitru, C.D., Shimizu, M., Bichi, R., Zupo, S., Noch, E., Aldler, H., Rattan, S., Keating, M., Rai, K., et al. (2002) Frequent deletions and down-regulation of miRNA genes miR-15 and miR-16 at 13q14 in chronic lymphocytic leukemia Proc. Natl Acad. Sci. USA, 99, 15524–15529[Abstract/Free Full Text] .

  17. Michael, M.Z., O'Connor, S.M., van Holst Pellekaan, N.G., Young, G.P., James, R.J. (2003) Reduced accumulation of specific miRNAs in colorectal neoplasia Mol. Cancer Res., 1, 882–891[Abstract/Free Full Text] .

  18. Metzler, M., Wilda, M., Busch, K., Viehmann, S., Borkhardt, A. (2004) High expression of precursor miRNA-155/BIC RNA in children with Burkitt lymphoma Genes Chromosomes Cancer, 2, 167–169 .

  19. Lewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., Burge, C.B. (2003) Prediction of mammalian miRNA targets Cell, 115, 787–798[CrossRef][Web of Science][Medline] .

  20. Enright, A., John, B., Gaul, U., Tuschl, T., Sander, C., Marks, D. (2003) MicroRNA targets in Drosophila Genome Biol., 5, R1[CrossRef][Medline] .

  21. Zeng, Y., Wagner, E.J., Cullen, B.R. (2002) Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells Mol. Cell, 9, 1327–1333[CrossRef][Web of Science][Medline] .

  22. Boutla, A., Delidakis, C., Tabler, M. (2003) Developmental defects by antisense-mediated inactivation of micro-RNAs 2 and 13 in Drosophila and the identification of putative target genes Nucleic Acids Res., 31, 4973–4980[Abstract/Free Full Text] .

  23. Meister, G., Landthaler, M., Dorsett, Y., Tuschl, T. (2004) Sequence-specific inhibition of miRNA- and siRNA-induced RNA silencing RNA, 10, 544–550[Abstract/Free Full Text] .

  24. Hutvagner, G., Simard, M.J., Mello, C.C., Zamore, P.D. (2004) Sequence-specific inhibition of small RNA function PLoS Biol., 4, E98 .

  25. Griffiths-Jones, S. (2004) The miRNA Registry Nucleic Acids Res., 32, D109–D111[Abstract/Free Full Text] .

  26. Zeng, Y., Yi, R., Cullen, B.R. (2003) MiRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms Proc. Natl Acad. Sci. USA, 100, 9779–9784[Abstract/Free Full Text] .

  27. Yekta, S., Shih, I.H., Bartel, D.P. (2004) MicroRNA-directed cleavage of HOXB8 mRNA Science, 304, 594–596[Abstract/Free Full Text] .


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. C.Y. Lin, K. L. Weeks, X.-M. Gao, R. B.H. Williams, B. C. Bernardo, H. Kiriazis, V. B. Matthews, E. A. Woodcock, R. D. Bouwman, J. P. Mollica, et al.
PI3K(p110{alpha}) Protects Against Myocardial Infarction-Induced Heart Failure: Identification of PI3K-Regulated miRNA and mRNA
Arterioscler Thromb Vasc Biol, April 1, 2010; 30(4): 724 - 732.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. Qin, X. Wang, Y. Wang, Z. Tang, Q. Cui, J. Xi, Y.-S. J. Li, S. Chien, and N. Wang
MicroRNA-19a mediates the suppressive effect of laminar flow on cyclin D1 expression in human umbilical vein endothelial cells
PNAS, February 16, 2010; 107(7): 3240 - 3244.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Takagi, M. Nakajima, K. Kida, Y. Yamaura, T. Fukami, and T. Yokoi
MicroRNAs Regulate Human Hepatocyte Nuclear Factor 4{alpha}, Modulating the Expression of Metabolic Enzymes and Cell Cycle
J. Biol. Chem., February 12, 2010; 285(7): 4415 - 4422.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. E. Wojcik, S. Rossi, M. Shimizu, M. S. Nicoloso, A. Cimmino, H. Alder, V. Herlea, L. Z. Rassenti, K. R. Rai, T. J. Kipps, et al.
Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer
Carcinogenesis, February 1, 2010; 31(2): 208 - 215.
[Abstract] [Full Text] [PDF]


Home page
Cancer Prevention ResearchHome page
A. Izzotti, G. A. Calin, V. E. Steele, C. Cartiglia, M. Longobardi, C. M. Croce, and S. De Flora
Chemoprevention of Cigarette Smoke-Induced Alterations of MicroRNA Expression in Rat Lungs
Cancer Prevention Research, January 1, 2010; 3(1): 62 - 72.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Fasanaro, S. Greco, M. Lorenzi, M. Pescatori, M. Brioschi, R. Kulshreshtha, C. Banfi, A. Stubbs, G. A. Calin, M. Ivan, et al.
An Integrated Approach for Experimental Target Identification of Hypoxia-induced miR-210
J. Biol. Chem., December 11, 2009; 284(50): 35134 - 35143.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
L. Elia, R. Contu, M. Quintavalle, F. Varrone, C. Chimenti, M. A. Russo, V. Cimino, L. De Marinis, A. Frustaci, D. Catalucci, et al.
Reciprocal Regulation of MicroRNA-1 and Insulin-Like Growth Factor-1 Signal Transduction Cascade in Cardiac and Skeletal Muscle in Physiological and Pathological Conditions
Circulation, December 8, 2009; 120(23): 2377 - 2385.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
L. A. Davidson, N. Wang, M. S. Shah, J. R. Lupton, I. Ivanov, and R. S. Chapkin
n-3 Polyunsaturated fatty acids modulate carcinogen-directed non-coding microRNA signatures in rat colon
Carcinogenesis, December 1, 2009; 30(12): 2077 - 2084.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Won Kim, H. K. Haider, S. Jiang, and M. Ashraf
Ischemic Preconditioning Augments Survival of Stem Cells via miR-210 Expression by Targeting Caspase-8-associated Protein 2
J. Biol. Chem., November 27, 2009; 284(48): 33161 - 33168.
[Abstract] [Full Text] [PDF]


Home page
Brief Funct Genomic ProteomicHome page
A. R. R. Forrest, R. F. Abdelhamid, and P. Carninci
Annotating non-coding transcription using functional genomics strategies
Briefings in Functional Genomics, November 1, 2009; 8(6): 437 - 443.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
O. Saydam, Y. Shen, T. Wurdinger, O. Senol, E. Boke, M. F. James, B. A. Tannous, A. O. Stemmer-Rachamimov, M. Yi, R. M. Stephens, et al.
Downregulated MicroRNA-200a in Meningiomas Promotes Tumor Growth by Reducing E-Cadherin and Activating the Wnt/{beta}-Catenin Signaling Pathway
Mol. Cell. Biol., November 1, 2009; 29(21): 5923 - 5940.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Y. W. Bourguignon, C. C. Spevak, G. Wong, W. Xia, and E. Gilad
Hyaluronan-CD44 Interaction with Protein Kinase C{epsilon} Promotes Oncogenic Signaling by the Stem Cell Marker Nanog and the Production of MicroRNA-21, Leading to Down-regulation of the Tumor Suppressor Protein PDCD4, Anti-apoptosis, and Chemotherapy Resistance in Breast Tumor Cells
J. Biol. Chem., September 25, 2009; 284(39): 26533 - 26546.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. R. Epis, K. M. Giles, A. Barker, T. S. Kendrick, and P. J. Leedman
miR-331-3p Regulates ERBB-2 Expression and Androgen Receptor Signaling in Prostate Cancer
J. Biol. Chem., September 11, 2009; 284(37): 24696 - 24704.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
Z. Tombol, P. M Szabo, V. Molnar, Z. Wiener, G. Tolgyesi, J. Horanyi, P. Riesz, P. Reismann, A. Patocs, I. Liko, et al.
Integrative molecular bioinformatics study of human adrenocortical tumors: microRNA, tissue-specific target prediction, and pathway analysis
Endocr. Relat. Cancer, September 1, 2009; 16(3): 895 - 906.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Junn, K.-W. Lee, B. S. Jeong, T. W. Chan, J.-Y. Im, and M. M. Mouradian
Repression of {alpha}-synuclein expression and toxicity by microRNA-7
PNAS, August 4, 2009; 106(31): 13052 - 13057.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
D. Fan, P. B. Bitterman, and O. Larsson
Regulatory element identification in subsets of transcripts: Comparison and integration of current computational methods
RNA, August 1, 2009; 15(8): 1469 - 1482.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. T. Hashimi, J. A. Fulcher, M. H. Chang, L. Gov, S. Wang, and B. Lee
MicroRNA profiling identifies miR-34a and miR-21 and their target genes JAG1 and WNT1 in the coordinate regulation of dendritic cell differentiation
Blood, July 9, 2009; 114(2): 404 - 414.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
M. Bhaskaran, Y. Wang, H. Zhang, T. Weng, P. Baviskar, Y. Guo, D. Gou, and L. Liu
MicroRNA-127 modulates fetal lung development
Physiol Genomics, May 13, 2009; 37(3): 268 - 278.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. C. Walker and R. M. Harland
microRNA-24a is required to repress apoptosis in the developing neural retina
Genes & Dev., May 1, 2009; 23(9): 1046 - 1051.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. G. Barringhaus and P. D. Zamore
MicroRNAs: Regulating a Change of Heart
Circulation, April 28, 2009; 119(16): 2217 - 2224.
[Full Text] [PDF]


Home page
FASEB J.Home page
A. Izzotti, G. A. Calin, P. Arrigo, V. E. Steele, C. M. Croce, and S. De Flora
Downregulation of microRNA expression in the lungs of rats exposed to cigarette smoke
FASEB J, March 1, 2009; 23(3): 806 - 812.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
L.-L. Wang, Z. Zhang, Q. Li, R. Yang, X. Pei, Y. Xu, J. Wang, S.-F. Zhou, and Y. Li
Ethanol exposure induces differential microRNA and target gene expression and teratogenic effects which can be suppressed by folic acid supplementation
Hum. Reprod., March 1, 2009; 24(3): 562 - 579.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Watanabe, Y. Ueda, S.-i. Akaboshi, Y. Hino, Y. Sekita, and M. Nakao
HMGA2 Maintains Oncogenic RAS-Induced Epithelial-Mesenchymal Transition in Human Pancreatic Cancer Cells
Am. J. Pathol., March 1, 2009; 174(3): 854 - 868.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Webster, K. M. Giles, K. J. Price, P. M. Zhang, J. S. Mattick, and P. J. Leedman
Regulation of Epidermal Growth Factor Receptor Signaling in Human Cancer Cells by MicroRNA-7
J. Biol. Chem., February 27, 2009; 284(9): 5731 - 5741.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. Suarez and W. C. Sessa
MicroRNAs As Novel Regulators of Angiogenesis
Circ. Res., February 27, 2009; 104(4): 442 - 454.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
X. Liu, Y. Cheng, S. Zhang, Y. Lin, J. Yang, and C. Zhang
A Necessary Role of miR-221 and miR-222 in Vascular Smooth Muscle Cell Proliferation and Neointimal Hyperplasia
Circ. Res., February 27, 2009; 104(4): 476 - 487.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Schembri, S. Sridhar, C. Perdomo, A. M. Gustafson, X. Zhang, A. Ergun, J. Lu, G. Liu, X. Zhang, J. Bowers, et al.
MicroRNAs as modulators of smoking-induced gene expression changes in human airway epithelium
PNAS, February 17, 2009; 106(7): 2319 - 2324.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
C. Mascaux, J. F. Laes, G. Anthoine, A. Haller, V. Ninane, A. Burny, and J. P. Sculier
Evolution of microRNA expression during human bronchial squamous carcinogenesis
Eur. Respir. J., February 1, 2009; 33(2): 352 - 359.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Y. Lu, J. Xiao, H. Lin, Y. Bai, X. Luo, Z. Wang, and B. Yang
A single anti-microRNA antisense oligodeoxyribonucleotide (AMO) targeting multiple microRNAs offers an improved approach for microRNA interference
Nucleic Acids Res., February 1, 2009; 37(3): e24 - e24.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Zhao, A. Kalota, S. Jin, and A. M. Gewirtz
The c-myb proto-oncogene and microRNA-15a comprise an active autoregulatory feedback loop in human hematopoietic cells
Blood, January 15, 2009; 113(3): 505 - 516.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. C. Amaral, N. Torres, F. Saggioro, L. Neder, H. R. Machado, W. A. Silva Jr, A. C. Moreira, and M. Castro
MicroRNAs Differentially Expressed in ACTH-Secreting Pituitary Tumors
J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 320 - 323.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Q. Jiang, Y. Wang, Y. Hao, L. Juan, M. Teng, X. Zhang, M. Li, G. Wang, and Y. Liu
miR2Disease: a manually curated database for microRNA deregulation in human disease
Nucleic Acids Res., January 1, 2009; 37(suppl_1): D98 - D104.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Taccioli, E. Fabbri, R. Visone, S. Volinia, G. A. Calin, L. Y. Fong, R. Gambari, A. Bottoni, M. Acunzo, J. Hagan, et al.
UCbase & miRfunc: a database of ultraconserved sequences and microRNA function
Nucleic Acids Res., January 1, 2009; 37(suppl_1): D41 - D48.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
K.-W. Chang, C.-J. Liu, T.-H. Chu, H.-W. Cheng, P.-S. Hung, W.-Y. Hu, and S.-C. Lin
Association between High miR-211 microRNA Expression and the Poor Prognosis of Oral Carcinoma
Journal of Dental Research, November 1, 2008; 87(11): 1063 - 1068.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
T. Xu, Y. Zhu, Q.-K. Wei, Y. Yuan, F. Zhou, Y.-Y. Ge, J.-R. Yang, H. Su, and S.-M. Zhuang
A functional polymorphism in the miR-146a gene is associated with the risk for hepatocellular carcinoma
Carcinogenesis, November 1, 2008; 29(11): 2126 - 2131.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Zhou, X. Qi, J. A. Potashkin, F. W. Abdul-Karim, and G. I. Gorodeski
MicroRNAs miR-186 and miR-150 Down-regulate Expression of the Pro-apoptotic Purinergic P2X7 Receptor by Activation of Instability Sites at the 3'-Untranslated Region of the Gene That Decrease Steady-state Levels of the Transcript
J. Biol. Chem., October 17, 2008; 283(42): 28274 - 28286.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Papagiannakopoulos, A. Shapiro, and K. S. Kosik
MicroRNA-21 Targets a Network of Key Tumor-Suppressive Pathways in Glioblastoma Cells
Cancer Res., October 1, 2008; 68(19): 8164 - 8172.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. El Ouaamari, N. Baroukh, G. A. Martens, P. Lebrun, D. Pipeleers, and E. van Obberghen
miR-375 Targets 3'-Phosphoinositide-Dependent Protein Kinase-1 and Regulates Glucose-Induced Biological Responses in Pancreatic {beta}-Cells
Diabetes, October 1, 2008; 57(10): 2708 - 2717.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Suarez, C. Fernandez-Hernando, J. Yu, S. A. Gerber, K. D. Harrison, J. S. Pober, M. L. Iruela-Arispe, M. Merkenschlager, and W. C. Sessa
Dicer-dependent endothelial microRNAs are necessary for postnatal angiogenesis
PNAS, September 16, 2008; 105(37): 14082 - 14087.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
V. Vopalensky, T. Masek, O. Horvath, B. Vicenova, M. Mokrejs, and M. Pospisek
Firefly luciferase gene contains a cryptic promoter
RNA, September 1, 2008; 14(9): 1720 - 1729.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
K. Hino, K. Tsuchiya, T. Fukao, K. Kiga, R. Okamoto, T. Kanai, and M. Watanabe
Inducible expression of microRNA-194 is regulated by HNF-1{alpha} during intestinal epithelial cell differentiation
RNA, July 1, 2008; 14(7): 1433 - 1442.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Fasanaro, Y. D'Alessandra, V. Di Stefano, R. Melchionna, S. Romani, G. Pompilio, M. C. Capogrossi, and F. Martelli
MicroRNA-210 Modulates Endothelial Cell Response to Hypoxia and Inhibits the Receptor Tyrosine Kinase Ligand Ephrin-A3
J. Biol. Chem., June 6, 2008; 283(23): 15878 - 15883.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. G. Romero, M. W. Plonczynski, C. A. Carvajal, E. P. Gomez-Sanchez, and C. E. Gomez-Sanchez
Microribonucleic Acid-21 Increases Aldosterone Secretion and Proliferation in H295R Human Adrenocortical Cells
Endocrinology, May 1, 2008; 149(5): 2477 - 2483.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Medina, S. K. Zaidi, C.-G. Liu, J. L. Stein, A. J. vanWijnen, C. M. Croce, and G. S. Stein
MicroRNAs 221 and 222 Bypass Quiescence and Compromise Cell Survival
Cancer Res., April 15, 2008; 68(8): 2773 - 2780.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Xia, A. O'Hara, I. Araujo, J. Barreto, E. Carvalho, J. B. Sapucaia, J. C. Ramos, E. Luz, C. Pedroso, M. Manrique, et al.
EBV MicroRNAs in Primary Lymphomas and Targeting of CXCL-11 by ebv-mir-BHRF1-3
Cancer Res., March 1, 2008; 68(5): 1436 - 1442.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Camps, F. M. Buffa, S. Colella, J. Moore, C. Sotiriou, H. Sheldon, A. L. Harris, J. M. Gleadle, and J. Ragoussis
hsa-miR-210 Is Induced by Hypoxia and Is an Independent Prognostic Factor in Breast Cancer
Clin. Cancer Res., March 1, 2008; 14(5): 1340 - 1348.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
A. Feber, L. Xi, J. D. Luketich, A. Pennathur, R. J. Landreneau, M. Wu, S. J. Swanson, T. E. Godfrey, and V. R. Litle
MicroRNA expression profiles of esophageal cancer.
J. Thorac. Cardiovasc. Surg., February 1, 2008; 135(2): 255 - 260.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
M. M. Fabani and M. J. Gait
miR-122 targeting with LNA/2'-O-methyl oligonucleotide mixmers, peptide nucleic acids (PNA), and PNA-peptide conjugates
RNA, February 1, 2008; 14(2): 336 - 346.
[Abstract] [Full Text] [PDF]


Home page
Exp Biol MedHome page
T. E. Callis, Z. Deng, J.-F. Chen, and D.-Z. Wang
Muscling Through the microRNA World
Exp Biol Med, February 1, 2008; 233(2): 131 - 138.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Q. Wang, Z. Huang, H. Xue, C. Jin, X.-L. Ju, J.-D. J. Han, and Y.-G. Chen
MicroRNA miR-24 inhibits erythropoiesis by targeting activin type I receptor ALK4
Blood, January 15, 2008; 111(2): 588 - 595.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
P. E. Blower, J.-H. Chung, J. S. Verducci, S. Lin, J.-K. Park, Z. Dai, C.-G. Liu, T. D. Schmittgen, W. C. Reinhold, C. M. Croce, et al.
MicroRNAs modulate the chemosensitivity of tumor cells
Mol. Cancer Ther., January 1, 2008; 7(1): 1 - 9.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. U. Mertens-Talcott, S. Chintharlapalli, X. Li, and S. Safe
The Oncogenic microRNA-27a Targets Genes That Regulate Specificity Protein Transcription Factors and the G2-M Checkpoint in MDA-MB-231 Breast Cancer Cells
Cancer Res., November 15, 2007; 67(22): 11001 - 11011.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
D. Gou, H. Zhang, P. S. Baviskar, and L. Liu
Primer extension-based method for the generation of a siRNA/miRNA expression vector
Physiol Genomics, November 14, 2007; 31(3): 554 - 562.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. F. Corsten, R. Miranda, R. Kasmieh, A. M. Krichevsky, R. Weissleder, and K. Shah
MicroRNA-21 Knockdown Disrupts Glioma Growth In vivo and Displays Synergistic Cytotoxicity with Neural Precursor Cell Delivered S-TRAIL in Human Gliomas
Cancer Res., October 1, 2007; 67(19): 8994 - 9000.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
X. Tang, J. Gal, X. Zhuang, W. Wang, H. Zhu, and G. Tang
A simple array platform for microRNA analysis and its application in mouse tissues
RNA, October 1, 2007; 13(10): 1803 - 1822.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. Xu, Y. Lu, Z. Pan, W. Chu, X. Luo, H. Lin, J. Xiao, H. Shan, Z. Wang, and B. Yang
The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes
J. Cell Sci., September 1, 2007; 120(17): 3045 - 3052.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Thum, P. Galuppo, C. Wolf, J. Fiedler, S. Kneitz, L. W. van Laake, P. A. Doevendans, C. L. Mummery, J. Borlak, A. Haverich, et al.
MicroRNAs in the Human Heart: A Clue to Fetal Gene Reprogramming in Heart Failure
Circulation, July 17, 2007; 116(3): 258 - 267.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Baroukh, M. A. Ravier, M. K. Loder, E. V. Hill, A. Bounacer, R. Scharfmann, G. A. Rutter, and E. Van Obberghen
MicroRNA-124a Regulates Foxa2 Expression and Intracellular Signaling in Pancreatic {beta}-Cell Lines
J. Biol. Chem., July 6, 2007; 282(27): 19575 - 19588.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W.-O. Lui, N. Pourmand, B. K. Patterson, and A. Fire
Patterns of Known and Novel Small RNAs in Human Cervical Cancer
Cancer Res., July 1, 2007; 67(13): 6031 - 6043.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Ji, Y. Cheng, J. Yue, J. Yang, X. Liu, H. Chen, D. B. Dean, and C. Zhang
MicroRNA Expression Signature and Antisense-Mediated Depletion Reveal an Essential Role of MicroRNA in Vascular Neointimal Lesion Formation
Circ. Res., June 8, 2007; 100(11): 1579 - 1588.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
V. Fulci, S. Chiaretti, M. Goldoni, G. Azzalin, N. Carucci, S. Tavolaro, L. Castellano, A. Magrelli, F. Citarella, M. Messina, et al.
Quantitative technologies establish a novel microRNA profile of chronic lymphocytic leukemia
Blood, June 1, 2007; 109(11): 4944 - 4951.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Xiao, X. Luo, H. Lin, Y. Zhang, Y. Lu, N. Wang, Y. Zhang, B. Yang, and Z. Wang
MicroRNA miR-133 Represses HERG K+ Channel Expression Contributing to QT Prolongation in Diabetic Hearts
J. Biol. Chem., April 27, 2007; 282(17): 12363 - 12367.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Kulshreshtha, M. Ferracin, S. E. Wojcik, R. Garzon, H. Alder, F. J. Agosto-Perez, R. Davuluri, C.-G. Liu, C. M. Croce, M. Negrini, et al.
A MicroRNA Signature of Hypoxia
Mol. Cell. Biol., March 1, 2007; 27(5): 1859 - 1867.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Chen and R. L. Stallings
Differential Patterns of MicroRNA Expression in Neuroblastoma Are Correlated with Prognosis, Differentiation, and Apoptosis
Cancer Res., February 1, 2007; 67(3): 976 - 983.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
H. Osada and T. Takahashi
MicroRNAs in biological processes and carcinogenesis
Carcinogenesis, January 1, 2007; 28(1): 2 - 12.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Amanai, M. Brahmajosyula, and A. C.F. Perry
A Restricted Role for Sperm-Borne MicroRNAs in Mammalian Fertilization
Biol Reprod, December 1, 2006; 75(6): 877 - 884.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
B. S. Cobb, A. Hertweck, J. Smith, E. O'Connor, D. Graf, T. Cook, S. T. Smale, S. Sakaguchi, F. J. Livesey, A. G. Fisher, et al.
A role for Dicer in immune regulation
J. Exp. Med., October 30, 2006; 203(11): 2519 - 2527.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
C. Roldo, E. Missiaglia, J. P. Hagan, M. Falconi, P. Capelli, S. Bersani, G. A. Calin, S. Volinia, C.-G. Liu, A. Scarpa, et al.
MicroRNA Expression Abnormalities in Pancreatic Endocrine and Acinar Tumors Are Associated With Distinctive Pathologic Features and Clinical Behavior
J. Clin. Oncol., October 10, 2006; 24(29): 4677 - 4684.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Ason, D. K. Darnell, B. Wittbrodt, E. Berezikov, W. P. Kloosterman, J. Wittbrodt, P. B. Antin, and R. H. A. Plasterk
From the Cover: Differences in vertebrate microRNA expression
PNAS, September 26, 2006; 103(39): 14385 - 14389.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
K. Kajimoto, H. Naraba, and N. Iwai
MicroRNA and 3T3-L1 pre-adipocyte differentiation
RNA, September 1, 2006; 12(9): 1626 - 1632.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Xi, R. Shalgi, O. Fodstad, Y. Pilpel, and J. Ju
Differentially Regulated Micro-RNAs and Actively Translated Messenger RNA Transcripts by Tumor Suppressor p53 in Colon Cancer.
Clin. Cancer Res., April 1, 2006; 12(7): 2014 - 2024.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Garzon, F. Pichiorri, T. Palumbo, R. Iuliano, A. Cimmino, R. Aqeilan, S. Volinia, D. Bhatt, H. Alder, G. Marcucci, et al.
MicroRNA fingerprints during human megakaryocytopoiesis
PNAS, March 28, 2006; 103(13): 5078 - 5083.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Davis, B. Lollo, S. Freier, and C. Esau
Improved targeting of miRNA with antisense oligonucleotides.
Nucleic Acids Res., January 1, 2006; 34(8): 2294 - 2304.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
X. Bo, S. Lou, D. Sun, J. Yang, and S. Wang
AOBase: a database for antisense oligonucleotides selection and design
Nucleic Acids Res., January 1, 2006; 34(suppl_1): D664 - D667.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Felli, L. Fontana, E. Pelosi, R. Botta, D. Bonci, F. Facchiano, F. Liuzzi, V. Lulli, O. Morsilli, S. Santoro, et al.
MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation
PNAS, December 13, 2005; 102(50): 18081 - 18086.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. V. Iorio, M. Ferracin, C.-G. Liu, A. Veronese, R. Spizzo, S. Sabbioni, E. Magri, M. Pedriali, M. Fabbri, M. Campiglio, et al.
MicroRNA Gene Expression Deregulation in Human Breast Cancer
Cancer Res., August 15, 2005; 65(16): 7065 - 7070.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. A. Chan, A. M. Krichevsky, and K. S. Kosik
MicroRNA-21 Is an Antiapoptotic Factor in Human Glioblastoma Cells
Cancer Res., July 15, 2005; 65(14): 6029 - 6033.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (251K) Freely available
Right arrow Screen PDF (211K) Freely available
Right arrow Supplementary Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (230)
Right arrowScopus Links
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Cheng, A. M.
Right arrow Articles by Ford, L. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, A. M.
Right arrow Articles by Ford, L. P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?