Published online 23 March 2005
Article |
The archaeal eIF2 homologue: functional properties of an ancient translation initiation factor
1Department of Cellular Biotechnology and Hematology, University of Rome La Sapienza Viale Regina Elena 324, 00161 Rome, Italy 2Max F. Perutz Laboratories, Department of Microbiology and Immunobiology, University Departments at the Vienna Biocenter Dr Bohrgasse 9, 1030 Vienna, Austria 3Department of Medical Biochemistry, Biology and Physics (DIBIFIM), University of Bari Piazza Giulio Cesare, 70124 Bari, Italy
*To whom correspondence should be addressed. Tel: +39 06 4940463; Fax: +39 06 4462891; Email: londei{at}bce.uniroma1.it
Received February 4, 2005. Revised March 4, 2005. Accepted March 4, 2005.
| ABSTRACT |
|---|
|
|
|---|
The eukaryotic translation initiation factor 2 (eIF2) is pivotal for delivery of the initiator tRNA (tRNAi) to the ribosome. Here, we report the functional characterization of the archaeal homologue, a/eIF2. We have cloned the genes encoding the three subunits of a/eIF2 from the thermophilic archaeon Sulfolobus solfataricus, and have assayed the activities of the purified recombinant proteins in vitro. We demonstrate that the trimeric factor reconstituted from the recombinant polypeptides has properties similar to those of its eukaryal homologue: it interacts with GTP and Met-tRNAi, and stimulates binding of the latter to the small ribosomal subunit. However, the archaeal protein differs in some functional aspects from its eukaryal counterpart. In contrast to eIF2, a/eIF2 has similar affinities for GDP and GTP, and the ß-subunit does not contribute to tRNAi binding. The detailed analysis of the complete trimer and of its isolated subunits is discussed in light of the evolutionary history of the eIF2-like proteins.
| INTRODUCTION |
|---|
|
|
|---|
During translation initiation, ribosomes identify the initiation codon on the mRNA and set the correct reading frame for decoding. This rate-limiting step is carried out in different ways in the primary domains of cell descent. In bacteria, the small ribosomal subunit interacts directly with the mRNA by base-pairing of the ShineDalgarno (SD) motif, preceding the initiation codon, with the anti-SD motif at the 3' end of 16S rRNA. The initiation step is assisted by three protein factors, IF1, IF2 and IF3 (1,2). In eukarya, selection of the initiation codon entails a scanning mechanism, whereby the 40S subunit binds to the capped 5' end of the mRNA and then slides downstream until the initiator AUG, usually the first one available, is encountered (3). This process is promoted by many factors, several of which are involved in cap recognition and mRNA unwinding, while others interact with the ribosome and/or the mRNA to ensure correct selection of the initiation codon (4,5).
In archaea, two different mechanisms for translational initiation seem to exist (6,7). One is based on a canonical SD/anti-SD interaction and operates on internal cistrons of polycistronic mRNAs. In contrast, monocistronic mRNAs as well as proximal cistrons of polycistronic mRNAs are frequently devoid of a 5'-untranslated region. These leaderless mRNAs are decoded by an initiation mechanism independent of the SD/anti-SD interaction, which requires, analogously to bacteria (8), pairing of the start codon with initiator-tRNA (tRNAi) (7). The complexity of archaeal translational initiation seems to be underscored by the presence of a larger-than-bacterial set of initiation factors. All archaeal genomes encode about 10 proteins homologous to eukaryal initiation factors (9,10).
A central step in translation initiation is the delivery of tRNAi to the ribosomal P site. This task is assisted in bacteria by the monomeric protein IF2, and is performed in eukarya by the trimeric complex eIF2, consisting of the
-, ß-, and
-subunits, none of which is homologous to bacterial IF2. Eukarya possess a homologue of bacterial IF2, termed eIF5B, which seems to act at a later initiation step, promoting the joining of the 60S ribosomal subunit to the 40S initiation complex (11). Like eukarya, archaea possess both IF2 and eIF2 homologues, but their respective functions remain poorly characterized.
In this study, we have analysed a number of functional features of the eIF2-like protein (herein denoted as a/eIF2) of the thermophilic archaeon Sulfolobus solfataricus. The genome of this organism, as well as those of the other archaea sequenced so far, contains homologues of all three subunits of the eukaryal factor (12). In S.solfataricus, the largest subunit is the
-homologue, which comprises 415 amino acids and contains a recognizable G-domain. The
-subunit homologue contains 266 amino acids. The ß-subunit is the smallest polypeptide of a/eIF2 (139 amino acids in S.solfataricus) and has experienced the most extensive evolutionary drift with respect to the eukaryotic protein. Indeed, eukaryotic ß-subunits are about twice the size of archaeal ones, and include domains involved in the interaction with two other proteins essential for eIF2 function: eIF2B, a factor required for GDP/GTP exchange (13,14) and eIF5, necessary for the hydrolysis of eIF2-bound GTP (1416). Neither eIF2B nor eIF5 have homologues in archaeal genomes. The conserved region of the ß-subunit in archaea and eukaryotes includes a domain containing a zinc-finger motif, which has been implicated in controlling the accuracy of initiation codon recognition (17). Recently, it has been shown that the recombinant
-, ß- and
-subunits of a/eIF2 from the hyperthermophilic archaeon Pyrococcus abyssi can re-associate in vitro to form a trimer able to bind selectively Met-tRNAi (18). The tRNA binding site seems to reside on the
-subunit (19), however an
dimer is required for a stable interaction with Met-tRNAi (18).
In this work, we have cloned the genes and purified the corresponding three subunits of a/eIF2 from the crenarchaeon S.solfataricus. In vitro assays carried out with the individual a/eIF2 subunits, with dimers thereof and with the complete trimer have confirmed that the factor binds Met-tRNAi, and that this GTP-dependent binding requires the
dimer. We also show that a/eIF2
and
ß
strongly stimulate binding of Met-tRNAi to the small ribosomal subunit in the presence of GTP. Furthermore, an analysis of guanine nucleotide exchange has revealed that a/eIF2 has a similar affinity for GTP and GDP, and that the G nucleotide binding properties of the isolated
-subunit are similar to those of the complete factor. In addition, the
-subunit was found to be responsible for the interaction of the factor with ribosomes. Finally, we show that a/eIF2 lacks an intrinsic ribosome-dependent GTPase activity. The differences and similarities with the eukaryal factor are discussed.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning of the genes and purification of the a/eIF2 subunits
The genes encoding the
-, ß- and
-subunits of a/eIF2 were cloned by means of PCR amplification from Sulfolobus solfataricus genomic DNA: 3035mer oligonucleotides complementary to the 5' and 3' ends of the respective coding sequences were used, which contained appropriate restriction sites for insertion into the expression plasmid pRSETB (Invitrogen). The recombinant plasmids were selected in E.coli Top10 (Invitrogen), and then transformed into E.coli BL21(DE3) (Stratagene). The expression of the a/eIF2 genes was induced for 3 h with 1 mM IPTG at an OD600 of 0.50.6. The cells were then lysed and the extracts were enriched for the thermophilic recombinant proteins by heating at 70°C for 10 min followed by centrifugation at 10 000 g for 10 min to remove the precipitated host proteins. The recombinant polypeptides, which contained an N-terminal tag of six histidines, were purified by affinity chromatography on Ni-NTA agarose following standard protocols. The purified proteins were dialysed against storage buffer (10 mM MOPS, 200 mM KCl, 10 mM ß-mercaptoethanol and 10% glycerol) and stored at 80°C in aliquots.
Interaction between the a/eIF2 polypeptides
To test whether the recombinant polypeptides interact and form dimeric and trimeric complexes, 30 pmol of
-, ß- and
-proteins were mixed in all possible combinations in a buffer containing 30 mM KCl, 0.5 mM MgCl2 and 50 mM TrisHCl, pH 7.1, in the presence or absence of 1 mM GTP. The proteins and their complexes were visualized by non-denaturing electrophoresis on 12% polyacrylamide gels prepared in acetate buffer (120 mM potassium acetate and 72 mM acetic acid, pH 4.3). The gels included a stacking overlay of 4% polyacrylamide in acetate buffer (120 mM potassium acetate and 12 mM acetic acid, pH 6.8). The running buffer was 133 mM acetic acid and 350 mM ß-alanine, pH 4.4. After the run, the gels were stained with Coomassie brilliant blue.
Preparation of ribosomes and tRNAi
70S ribosomes and 30S and 50S ribosomal subunits were obtained from frozen S.solfataricus cells as described previously (20). Purified tRNAi was obtained by in vitro transcription of a synthetic S.solfataricus tRNAi gene. Two DNA oligomers were created based on the sequence of the S.solfataricus tRNAi gene as deduced from the published genome sequence (12). The following oligonucleotides were used:
- tRNAi: 5'-GTGTAATACGACTCACTATAAGCGGGGTGGGCTAGCCTGGTAAGGCCGCGGGGCTCATAACCCCGAGGTCCCTGGTTCAAATCCAGGCCCCGCTACCA-3'.
- anti-tRNAi: 5'-AGCTTGGTAGCGGGGCCTGGATTTGAACCAGGGACCTCGGGGTTATGAGCCCCGCGGCCTTACCAGGCTAGCCCACCCCGCTTATAGTGAGTCGTATTACACGTA-3'.
- anti-tRNAi: 5'-AGCTTGGTAGCGGGGCCTGGATTTGAACCAGGGACCTCGGGGTTATGAGCCCCGCGGCCTTACCAGGCTAGCCCACCCCGCTTATAGTGAGTCGTATTACACGTA-3'.
The purified tRNAi was charged with methionine, cold or labelled with [35S], using a recombinant E.coli methyltransferase: Briefly,
200 pmol of tRNAi were incubated at 37°C for 30 min with 150 pmol methyltransferase, 4 mM ATP and 100 µM [35S]methionine [specific activity (s.a.) 1000 Ci/mmol] or unlabelled methionine as required. To check the efficiency of aminoacylation, 100 pmol of Met-tRNAi was loaded on a 6.5% polyacrylamide gel made in 0.1 M NaOAc, pH 5 and 8 M urea. The gel was run for 24 h at 500 V (
12 V/cm) and then stained with ethidium bromide. The bands corresponding to Met-tRNAi and uncharged tRNAi were quantified using the ImageQuant software;
35% of the tRNAi was found to be aminoacylated under these conditions. To recover the charged Met-tRNAi, the incubation mixture was subjected to phenol extraction. The RNA precipitated with ethanol from the aqueous phase was finally resuspended in 10 mM acetate buffer, pH 5.2.
Guanine nucleotides binding and exchange
The purified a/eIF2 subunits (20 pmol each), alone or in combinations, were incubated for 10 min at 65°C in buffer containing 30 mM KCl, 50 mM HEPES, pH 7.5, 0.5 mM MgCl2, and 1 mM DTT (incubation buffer) with increasing concentrations (0100 pmol) of [3H]GDP (
1300 c.p.m./pmol) or [32P]GTP (
6000 c.p.m./pmol). The samples were filtered through Millipore 0.22 µm nitrocellulose disks, which were washed extensively with incubation buffer. The disks were dried and the amount of retained radioactivity was measured in a liquid scintillation counter. The Kd values for nucleotide binding were determined graphically from Scatchard plots derived from the binding curves.
To determine the rate of G nucleotides exchange, isolated
-subunits (100 pmol) or the complete trimer reconstituted with 100 pmol of each
-, ß- and
-subunits were incubated with a 10-fold excess of [3H]GDP for 10 min at 65°C. The mixtures were supplemented with 10 mM unlabelled GTP or GTP, and the incubation was continued at 80°C while withdrawing samples after 0, 3, 5, 7 and 10 min. The samples were filtered through 0.22 µm nitrocellulose disks, which were washed with incubation buffer, dried and then subjected to scintillation counting.
[35S]Met-tRNAi interaction with a/eIF2
To assay the capacity of a/eIF2 to interact with [35S]Met-tRNAi, 50 pmol of the recombinant subunits, individually or in different combinations, were incubated at different temperatures ranging from 25 to 75°C in 20 µl (final volume) of incubation buffer containing 1 mM GTP and 100 pmol of [35S]Met-tRNAi (s.a.
500 c.p.m./pmol). Incubation was carried out for 15 min. Samples were withdrawn at times 1, 3, 5, 10 and 15 min. The samples were filtered through 0.22 µm nitrocellulose disks, which were washed and processed as described above.
Protection by a/eIF2 of [35S]Met-tRNAi against spontaneous hydrolysis was assayed in 20 mM HEPESNaOH (pH 8.0), 100 mM KCl, 5 mM MgCl2, 1 mM DTT, 0.1 mM EDTA, 0.2 mg/ml BSA and 5% glycerol, in the presence of 1 mM GTP, 1 mM GDP or 1 mM Gpp(NH)p, and 50 nM of [35S]Met-tRNAi and a/eIF2 (0.2 and 2 µM). Before the addition of [35S]Met-tRNAi, the three subunits were incubated in the presence of GTP [GDP or Gpp(NH)p] for 10 min at 65°C to allow subunit formation. The mixtures were then incubated at 65°C. To determine the rate of de-acylation, aliquots were withdrawn at various times (1030 min) and precipitated with 5% trichloroacetic acid. The precipitates were collected on Whatman filters, which were washed 2x with ice-cold 5% TCA, and then dried for 10 min at 85°C. The amount of the retained [35S]Met-tRNAi was determined by scintillation counting.
Interaction of a/eIF2 subunits with ribosomes
To determine which of the a/eIF2 polypeptides contained the domain for interaction with ribosomes, 50 pmol of each
-, ß- or
-subunit were incubated at 65°C for 10 min in incubation buffer in the presence of 1 mM GTP and
100 pmol of Met-tRNAi (charged with cold methionine). The samples were supplemented with 30 pmol of ribosomes and incubation was continued for another 10 min. The reaction was stopped by adding an appropriate volume of 10x loading buffer (0.02% bromophenol blue, 0.02% xylene cyanol and 50% glycerol), and the samples were immediately loaded on running non-denaturing 4% polyacrylamide gels made in 20 mM potassium acetate, 2.5 mM MgCl2 and 40 mM TrisHCl, pH 6. Electrophoresis was continued at 4°C and 50 mA for 45 h. After the run, the samples were transferred to Hybond N membranes by electroblotting and the position of the recombinant proteins was visualized by immunostaining with anti-His tagged antibodies.
Interaction of [35S]Met-tRNAi with ribosomes
The ability of a/eIF2 to stimulate binding of [35S]Met-tRNAi to ribosomes was tested as follows: 50 pmol of each
-, ß- and
-proteins, or
or
only were mixed and incubated for 10 min at 65°C in 50 µl incubation buffer with 1 mM GTP to allow formation of the trimeric or dimeric complexes. [35S]Met-tRNAi (100 pmol, s.a.
500 c.p.m./pmol) were added and incubation was continued for 5 min. Finally, the mixtures were supplemented with 30 pmol of ribosomes and further incubated for 10 min. The samples were immediately electrophoresed on non-denaturing 4% polyacrylamide gels as described above, then dried and exposed to an X-ray film to visualize the labelled tRNAi. In parallel, the gels were stained with Coomassie brilliant blue to determine the position of the ribosomes.
GTPase activity assay
The presence of a ribosome-dependent GTPase activity of trimeric a/e IF2 was assayed as follows: 20 pmol of each
-, ß- and
-subunits were mixed in 50 µl (final volume) of 70 mM KCl, 25 mM TrisHCl, pH 7.5, 7 mM MgCl2, 1 mM DTT and 35 µM [32P]GTP (s.a.
15 mCi/mmol). The mixture was incubated for 5 min at 65°C to allow formation of the trimer. Met-tRNAi (20 pmol; charged with unlabelled methionine) was then added and the incubation was continued for another 5 min. Then, the reaction mixture was further supplemented with 5 pmol of 70S ribosomes and 5 pmol of a 30mer RNA oligonucleotide mimicking a translation initiation region endowed with a SD-motif (5'-UUUGAGGUGACUCUCUCAUGUUUUUUUUUU-3': start codon and SD motif are underlined). Incubation was continued at 65°C for 10 min and samples were withdrawn at 0, 1, 5 and 10 min. The samples were supplemented with an equal volume of 1 M HClO4 and 2 mM KH2PO4, gently shaken and further supplemented with 3 vol of 20 mM Na4MoO4. Finally, an equal volume of ethyl acetate was added, the mixture was shaken vigorously and centrifuged for 5 min at 6500 r.p.m. to separate the phases: 200 µl were withdrawn from the top phase and the free [32P] present therein was measured in a liquid scintillation counter.
| RESULTS |
|---|
|
|
|---|
Purification of the three S.solfataricus a/eIF2 subunits
The genes encoding the
-, ß- and
-subunits of S.solfataricus a/eIF2 were cloned by PCR amplification of genomic DNA and inserted into the E.coli His-tag vector pRSET to facilitate purification after over-expression in vivo. The recombinant proteins were purified by a two-step procedure, including heating of the E.coli lysates at 70°C for 10 min to remove most of the host mesophilic proteins, followed by selective capture of the recombinant polypeptides by affinity chromatography on a Ni-NTA resin. As shown in Figure 1, the three recombinant polypeptides were purified to near homogeneity. They had the expected molecular weights of
45 kDa (
-subunit), 28 kDa (
-subunit) and 15 kDa (ß-subunit). However, their yield was markedly different: the
-subunit was produced in large amounts, whereas the
- and, particularly, the ß-subunit were produced in lower quantities. The histidine-tags were not removed, since they apparently did not affect the activity assays, as previously noted for the P.abyssi factor (18).
|
Interaction between the subunits
The functionality of the purified recombinant polypeptides was first tested by monitoring their capacity to form dimeric and trimeric complexes. Equimolar amounts of the a/eIF2 subunits as well as combinations thereof were incubated at 65°C for 15 min and then electrophoresed on acidic, non-denaturing polyacrylamide gels. As shown in Figure 2, under these conditions the three recombinant polypeptides were competent for mutual recognition. When mixed together in equimolar amounts, the
-, ß- and
-proteins interacted quantitatively to reconstitute the trimeric complex; essentially no free subunits were left over under these conditions (Figure 2). The quantitative formation of
and ß
dimers was likewise readily observed, whereas the
- and ß-subunits did not interact with each other. These experiments supported previous data (18,19) in that the
-subunit acts as a scaffold for the assembly of the trimer. As S.solfataricus is an extreme thermophile, we assayed whether temperature affected these proteinprotein interactions. We found that dimeric and trimeric complexes formed readily at room temperature, thus indicating that even at non-physiological temperatures, the proteins are in an interaction-competent conformation (data not shown). The polypeptides were able to assemble also in the presence of GDP as well as without guanine nucleotides, showing that GTP activation of the
-subunit is not required for complex formation.
|
Guanine nucleotide binding and exchange
Having ascertained the ability of the a/eIF2 polypeptides to reconstitute the native complex, we next analysed the capacity of the individual subunits and of combinations thereof to bind GDP and GTP. The aim of these experiments was to compare the relative affinity for guanine nucleotides of a/eIF2 with that of its eukaryal counterpart. It is known that the eukaryal eIF2 has a significantly higher affinity for GDP than for GTP. As a consequence, the conversion of GDPeIF2 to GTPeIF2 requires the pentameric nucleotide exchange factor eIF2B (13). However, archaeal genomes lack apparent homologues of the catalytic subunits of the eIF2B complex (21), which could suggest that an exchange factor is not required for a/eIF2. A 20 pmol of each recombinant subunit of S.solfataricus a/eIF2 was incubated in all possible combinations (except
ß) with increasing amounts of [3H]GDP or [32P]GTP at 65°C, and the amount of bound nucleotide was determined by a filter-binding assay. The quantitative interaction of the recombinant subunits, i.e. the formation of dimers and trimers, was separately verified by non-denaturing gel electrophoresis (data not shown; see Figure 2).
As shown in Figure 3, the binding curves revealed that the guanine nucleotide binding capacity resides entirely on the
-subunit. In fact, protein complexes containing the
-subunit (
, ß
or the trimeric factor) displayed GDP and GTP binding curves essentially overlapping with those obtained with the
-subunit alone, while neither
nor ß (data not shown) bound to G nucleotides. These results indicated that the G-domain on the
-subunit is fully competent for nucleotide binding and that binding is not affected by either the
- or ß-subunits. From the binding curves shown in Figure 3, we calculated the Kd values for GDP and GTP of the
-subunit and of the trimeric factor. The values (Table 1) were very similar in all cases, indicating that the G-nucleotide binding domain of a/eIF2, unlike that of eIF2, has comparable affinities for GDP and GTP. For verification, we also measured the off-rate for bound radiolabelled GDP in the presence of an excess of unlabelled GDP or GTP, for the
-subunit as well as for the reconstituted a/eIF2 trimer. A 100-fold molar excess of cold GDP or GTP was added to the
-subunit or to the a/eIF2 trimer, both of which had been saturated with [3H]GDP. Samples were withdrawn at different times thereafter to determine the amount of radioactive nucleotide retained. As shown in Figure 4, at the optimal growth temperature for S.solfataricus (80°C) bound GDP was substituted by either GDP or GTP at a comparable rate and nucleotide exchange was complete within 4 min. The
-subunit and the complete trimer behaved similarly. Taken together, the binding curves and the exchange kinetics suggested that the GTPa/eIF2 complex forms spontaneously without an auxiliary factor. These results are in agreement with the observation that archaeal genomes harbour only two homologues of the five polypeptides composing the eukaryal eIF2B, and that these two do not include the catalytic subunits known to be essential for guanine nucleotide exchange in eukaryotes (21).
|
|
|
Binding of Met-tRNAi to a/eIF2
The primary role of the eukaryal eIF2 in translation entails the delivery of tRNAi to ribosomes through formation of a stable ternary complex with GTP and tRNAi. Recently, it was shown that archaeal a/eIF2 from P.abyssi, reconstituted in vitro from the recombinant subunits, has a similar capacity for selective binding to Met-tRNAi (18). Accordingly, we tested the capacity of S.solfataricus a/eIF2 to interact stably with Met-tRNAi by employing a filter-binding assay.
The three a/eIF2 subunits and combinations thereof were incubated at 70°C in the presence of 1 mM GTP with S.solfataricus [35S]Met-tRNAi. Samples were withdrawn at different times upon incubation and filtered through nitrocellulose disks as described above. As shown in Figure 5A, a stable complex with [35S]Met-tRNAi was formed exclusively by either the complete trimer or the
dimer. The binding kinetics of these complexes were hardly distinguishable, demonstrating that the
dimer is necessary and sufficient for the stable interaction with Met-tRNAi, as previously observed by Yatime et al. (18). At variance with these authors, we observed very little retention of Met-tRNAi by the isolated
-subunit. This could be due to the different techniques used in both studies since filter binding only captures fairly stable RNAprotein complexes. It is worth noting that Met-tRNAi binding was strictly dependent on temperature, being very low at 25°C and reaching an optimum between 60 and 75°C (data not shown). At the optimal temperature, saturation was complete within
5 min (Figure 5A). The temperature-dependent binding of Met-tRNAi cannot be attributed to a lack of interaction among the subunits as dimeric and trimeric complexes formed readily at low temperature (data not shown). Thus, we assume that this observation is due to a direct effect of high temperature on the conformation of the Met-tRNAi binding domain(s) of a/eIF2.
|
As another means to demonstrate binding to and protection of Met-tRNAi by a/eIF2, we tested whether the trimeric factor protects the charged tRNAi from deacylation. Without protection by a/eIF2 of Met-tRNAi, the tRNA was nearly completely deacylated after 30 min (Figure 5B). Similarly, in the presence of GDP, no protection by a/eIF2 of Met-tRNAi was observed (Figure 5B), verifying that Met-tRNAi binding to a/eIF2 requires GTP. In contrast, in the presence of 2 µM a/eIF2 and 1 mM GTP
80% of the tRNAi remained acylated after 30 min. The addition of non-hydrolysable Gpp(NH)p had no effect on the protection, which indicated that GTP is not hydrolysed under these conditions.
Interaction of a/eIF2 with ribosomes
Next, we attempted to determine the a/eIF2 domain responsible for the interaction with ribosomes. High-salt purified S.solfataricus 70S ribosomes were incubated at 70°C for 15 min with each of the purified a/eIF2 subunits. After incubation, the samples were loaded on a non-denaturing polyacrylamide gel and electrophoresis was continued for 5 h. The position of the a/eIF2 subunit proteins in the gel was visualized by western blotting using antibodies directed against the His-tag. Since free a/eIF2 subunits have a basic isoelectric point and were expected to run to the anode in the used electrophoresis system, only ribosome-associated factors could be detected. As shown in Figure 6, neither the
- nor the ß-subunits was detectably retained by ribosomes. The
-polypeptide associated with a band that contained 30S subunits as determined by Coomassie blue staining (Figure 6) and western blotting using polyclonal antibodies raised against purified S.solfataricus 30S ribosomes (data not shown). We therefore concluded that the a/eIF2 factor interacts with the small ribosomal subunit by means of a domain located on the
-subunit.
|
Stimulation of Met-tRNAi binding to ribosomes
The next experiments were aimed at determining whether a/eIF2, like its eukaryal counterpart, stimulates the formation of a pre-initiation complex containing the small ribosomal subunit and Met-tRNAi. To this end, the reconstituted trimeric factor was pre-incubated with GTP and [35S]Met-tRNAi to allow formation of the ternary complex. After 10 min of pre-incubation, 70S ribosomes were added and the incubation was continued at 65°C for 15 min. The formation of the pre-initiation complexes was then monitored by means of non-denaturing gel electrophoresis.
The results shown in Figure 7 illustrate that a/eIF2 did stimulate binding of Met-tRNAi to the ribosome. The [35S]Met-tRNAi appeared to interact with the 30S subunits, even when 70S ribosomes were added to the assay. However, it should be noted that S.solfataricus 70S ribosomes are actually a mixture of dissociated subunits, since the monomeric particle is stable only when engaged in translation (20). A small quantity of the nucleic acid bound to the 30S subunits in the absence of any factor and the addition of increasing amounts of a/eIF2 resulted in a linear increase of [35S]Met-tRNAi associated with the ribosome. We also found that
dimers were indistinguishable from the complete trimer with regard to their capacity to stimulate [35S]Met-tRNAi binding to ribosomes which agreed with their Met-tRNAi binding competence. Interestingly, the isolated
-subunit was also able to stimulate the interaction of [35S]Met-tRNAi with the small ribosomal subunit, although to a lesser extent than the
dimer or the complete trimer. This latter result indicated that the
-polypeptide has some intrinsic capacity for interacting with Met-tRNAi as well as with the ribosome independently of the presence of the other two subunits.
|
GTP hydrolysis
Lastly, we examined the requirements for triggering hydrolysis of GTP bound to the a/eIF2 trimer. First, a/eIF2 was pre-incubated with GTP and Met-tRNAi at 65°C to allow formation of the ternary complex. Then, we added to the mixture 70S ribosomes and an oligo-ribonucleotide comprising a strong translation initiation site. In parallel, we verified by non-denaturing gel electrophoresis the ability of the oligo-ribonucleotide to bind to ribosomes (data not shown). The reaction was continued and samples were withdrawn at different times upon incubation. Under these conditions, no significant GTP hydrolysis was observed (data not shown), suggesting that the interaction of the factor with the ribosome, even in the presence of codonanticodon pairing, is not sufficient by itself to trigger the reaction. This situation is reminiscent to eukaryotes, where GTP hydrolysis on eIF2 requires the auxiliary protein eIF5. However, an eIF5 homologue is apparently lacking in archaea, raising the possibility that a hitherto unidentified factor is involved in hydrolysis of GTP bound to a/eIF2.
| DISCUSSION |
|---|
|
|
|---|
In this study, we have analysed several functional aspects of the eIF2 homologue from the thermophilic archaeon S.solfataricus. The purified recombinant a/eIF2 subunits readily assembled in vitro to form dimeric and trimeric complexes. As observed previously for P.abyssi a/eIF2 (18), we found that the S.solfataricus a/eIF2
-subunit constitutes the structural core of the trimeric complex since it interacts with both
- and ß-subunits as well as individually with either of them. In contrast, the
- and ß-subunits are unable to interact with each other independent of the
-polypeptide (Figure 2). Proteinprotein recognition is independent of both GTP and high temperature. The recombinant trimeric S.solfataricus a/eIF2 displays properties very similar to those of its eukaryal counterpart: it interacts with Met-tRNAi (Figure 5), and stimulates its binding to the small ribosomal subunits (Figure 7). Taken together with the results of Yatime et al. (18), we therefore conclude that a/eIF2 is the principal tRNAi binding factor in archaea.
The archaeal and eukaryal IF2 factors display several notable functional differences, which may aid towards a better understanding of the evolutionary history of this protein. One difference concerns the tRNAi-binding site. According to a recent crystallographic analysis, the
-subunit of P.abyssi a/eIF2 includes an apparently complete tRNAi-binding domain similar to that of elongation factor Tu, another translational G-protein with tRNA-binding properties (19,22). In agreement with this finding, the
-subunit of a/eIF2 does possess some intrinsic capacity for Met-tRNAi binding: it protects the tRNA-bound methionine from alkaline hydrolysis (18), and it can promote to some extent binding of Met-tRNAi to the 30S ribosomal subunits (Figure 7). Nevertheless, a stable interaction with Met-tRNAi is only achieved by a
dimer, and therefore requires the presence of the
-subunit (Figure 5A) (18). It has been found that the C-terminal portion of the
-subunit is sufficient for stable tRNA binding (18). However, the precise role of the
-subunit in Met-tRNAi binding by the trimeric a/eIF2, or by the
complex, remains to be elucidated. In contrast, in eukaryal IF2 the Met-tRNAi binding site seems to be shared between the
- and the ß-subunits (23,24), while the main function of the
-subunit is the regulation of the factor activity (25). It should be pointed out that the eukaryal ß-subunit is about twice the size of its archaeal counterpart, and, besides Met-tRNAi binding, is implicated in several other essential tasks, such as controlling the interaction with eIF5 and eIF2B (1416), and possibly mRNA binding (26). Only the C-terminal half of the eukaryal polypeptide is conserved in the archaeal one, while the N-terminal moiety, containing the interaction domains for eIF2B and eIF5, has been apparently added during eukaryotic evolution. Therefore, if the eukaryal ß-subunit is involved in the interaction with tRNAi, this function is most likely acquired during eukaryotic evolution and not present in the ancestral ß-subunit of a/eIF2.
Another relevant functional difference between a/eIF2 and eIF2 concerns the binding of guanine nucleotides. The eukaryal protein has a much higher affinity for GDP than for GTP and requires a GDP/GTP exchange factor, the pentameric protein eIF5B, to be reactivated after GTP hydrolysis. In contrast, the analysis presented here of guanine nucleotide binding and exchange on a/eIF2 allows the conclusion that the archaeal factor has a similar affinity for GDP and GTP (Figures 3 and 4), and therefore might not require an exchange factor. This agrees with the observation that archaeal genomes lack a complete eIF5B homologue (21). It is also worth noting that in lower eukaryotes (yeast), eIF2 seems to have a reduced requirement for the exchange factor when compared with the mammalian protein (27). These data suggest the possibility that the free-nucleotide-exchanging archaeal a/eIF2 represents the prototype factor from which an exchange factor-dependent one has evolved in eukaryotes, which provided additional or even a more sophisticated translational control. Taken together, these observations would suggest that no eukaryal-type functional regulation of a/eIF2 based on the inhibition of guanine nucleotide exchange exists in archaea. However, it has been recently reported that the
-subunit of Pyrococcus horikoscii a/eIF2 is phosphorylated by a specific protein kinase (28). Thus, the determination of the function of
-subunit phosphorylation of archaeal a/eIF2 will be an interesting task, which may help to clarify why archaea, unlike bacteria but like eukarya, have adopted a trimeric Met-tRNAi binding factor.
Another unresolved problem concerns GTP hydrolysis. Given the lack of an eIF5 homologue, our expectation was to find a ribosome-triggered, but otherwise spontaneous, hydrolysis of a/eIF2-bound GTP. However, all our attempts to reveal in vitro the presence of such a mechanism failed. Therefore, the possibility exists that archaea possess a domain-specific auxiliary GTPase, different from eIF5. Some years ago, Kyrpides and Woese (21) suggested that the auxiliary GTPase of a/eIF2 might be aIF2, the universal factor homologous to bacterial IF2 and eukaryal eIF5B. The aIF2 protein is a G protein and does possess a ribosome-dependent GTPase activity (A. Berardi, S. Marzi, E. Maone, L. Peri, C. O. Gualerzi, P. Cammarano and P. Londei, unpublished data).
An interesting outcome of our study is the general conclusion that most of the functions of the factor are carried out by its largest component, the
-subunit. At least in vitro, the
-subunit has retained some intrinsic ability to interact with Met-tRNAi, to bind to the small ribosomal subunits, and to promote the interaction between Met-tRNAi and the ribosome. The
-subunit is clearly involved in stabilizing Met-tRNAi binding, while the function of the small ß-subunit remains elusive at the moment. On the whole, these observations suggest that the
-subunit functioned as a monomer early in evolution, preceding the time when the archaealeukaryal line split into two separate domains. This hypothesis agrees with the fact that the
-subunit of eIF2-like proteins belongs to a family of tRNA-binding G-proteins that includes the elongation factor Tu/1-A and its specialized version SELB (29). The latter is the factor that selects selenocysteine tRNA during the synthesis of selenoproteins in all primary domains (3032). The
-subunit of eukaryal and archaeal IF2 is most closely related to SELB (29), suggesting that the a/eIF2
-subunit arose by gene duplication from elongation factor Tu at about the same time as SELB. Each of the two proteins became then specialized for interacting with a single aminoacyl-tRNA species, whereas the elongation factor Tu retained the capacity to bind any aminoacyl-tRNA. Probably, a/eIF2 acquired a selective affinity for Met-tRNAi during the evolution of the common ancestor of Archaea and Eukarya. However, a/eIF2 must soon have acquired its present trimeric form, as genes encoding the
- and ß-subunits are found in all archaea, including the hyperthermophile Nanoarchaeum equitans, which has a genome size of only 0.5 Mb (33).
| ACKNOWLEDGEMENTS |
|---|
P.L. was supported by funds from the Italian Ministry of University and Research PRIN 2000 and 2002 projects: Translational initiation of leadered and leaderless mRNA in bacteria and archaea: comparative analysis of the functions of IF2, an essential and universally conserved translation initiation factor and Evolution of the gene expression machinery: characterization of a set of universally conserved factors modulating translational initiation. We thank Maria Grazia Pantano for performing the experiment in Figure 2 and Dr Laura Nicolini of ISS for her invaluable help in growing S.solfataricus cells. P.C. acknowledges support from the Agenzia Spaziale Italiana contract IR298/02. The work in U.B.'s laboratory was supported by grant P15334 [GenBank] from the Austrian Science Fund. Funding to pay the Open Access publication charges for this article was provided by the Max Perutz Library, Vienna Biocenter.
Conflict of interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Kozak, M. (1983) Comparison of initiation of protein synthesis in procaryotes, eucaryotes and organelles Microbiol. Rev., 47, 145
[Free Full Text] . - Gualerzi, C.O. and Pon, C.L. (1990) Initiation of mRNA translation in prokaryotes Biochemistry, 29, 58815889[CrossRef][Medline] .
- Kozak, M. (1989) The scanning model for translation: an update J. Cell Biol., 108, 224229 .
- Merrick, W.C. (1992) Mechanism and regulation of eukaryotic protein synthesis Microbiol. Rev., 56, 291315
[Abstract/Free Full Text] . - Pestova, T.V. and Kolupaeva, V.G. (2002) The roles of individual eukaryotic translation initiation factors in ribosomal scanning and initiation codon selection Genes Dev., 16, 29062922
[Abstract/Free Full Text] . - Tolstrup, N., Sensen, C.W., Garrett, R.A. (2000) Two different and highly organized mechanisms of translation initiation in the archaeon Sulfolobus solfataricus Extremophiles, 4, 175179[CrossRef][Medline] .
- Benelli, D., Maone, E., Londei, P. (2003) Two different mechanism for ribosome/mRNA interaction in archaeal translational initiation Mol. Microbiol., 50, 635643[CrossRef][Web of Science][Medline] .
- Grill, S., Gualerzi, C.O., Londei, P., Bläsi, U. (2000) Selective stimulation of translation of leaderless mRNA by IF2: evolutionary implications for translation EMBO J., 19, 41014110[CrossRef][Web of Science][Medline] .
- Dennis, P.P. (1997) Ancient ciphers: translation in archaea Cell, 89, 10071010[CrossRef][Web of Science][Medline] .
- Bell, S.D. and Jackson, S.P. (1998) Transcription and translation in archaea: a mosaic of eukaryal and bacterial features Trends Microbiol., 6, 222227[CrossRef][Web of Science][Medline] .
- Pestova, T.V., Lomakin, I.B., Lee, J.H., Choi, S.K., Dever, T.E., Hellen, C.U. (2000) The joining of ribosomal subunits in eukaryotes requires eIF5B Nature, 403, 332335[CrossRef][Medline] .
- She, Q., Singh, R.K., Confalonierie, F., Zivanovic, Y., Allard, G., Awayez, M.J., Chan-Weiher, C.C., Clausen, I.G., Curtis, B.A., De Moors, A., et al. (2001) The complete genome of the crenarchaeon Sulfolobus solfataricus P2 Proc. Natl Acad. Sci. USA, 98, 78357840
[Abstract/Free Full Text] . - Kimball, S.R., Everson, W.V., Myers, L.M., Jefferson, L.S. (1987) Purification and characterization of eukaryotic initiation factor 2 and a guanine nucleotide exchange factor from rat liver J. Biol. Chem., 262, 22202227
[Abstract/Free Full Text] . - Asano, K., Krishnamoorthy, T., Phan, L., Pavitt, G.D., Hinnebusch, A.G. (1999) Conserved bipartite motifs in yeast eIF5 and eIF2B, GTPase activating and GDPGTP exchange factors in translation initiation, mediate binding to their common substrate eIF2 EMBO J., 18, 16731688[CrossRef][Web of Science][Medline] .
- Das, S., Maiti, T., Das, K., Maitra, U. (1997) Specific interaction of eukaryotic translation initiation factor 5 (eIF5) with the ß-subunit of eIF2 J. Biol. Chem., 272, 3171231718
[Abstract/Free Full Text] . - Das, S. and Maitra, U. (2000) Mutational analysis of mammalian translation initiation factor 5 (eIF5): role of the interaction between the beta subunit of eIF2 and eIF5 in eIF5 function in vivo and in vitro Mol. Cell. Biol., 11, 39423950 .
- Huang, H., Yoon, H., Hanning, E.M., Donahue, T.F. (1997) GTP hydrolysis controls stringent selection of the AUG start codon during translation initiation in Saccharomyces cerevisiae Genes Dev., 11, 23962413
[Abstract/Free Full Text] . - Yatime, L., Schmitt, E., Blanquet, S., Mechulam, Y. (2004) Functional molecular mapping of archaeal translation initiation factor 2 J. Biol. Chem., 279, 1598415993
[Abstract/Free Full Text] . - Schmitt, E., Blanquet, S., Mechulam, Y. (2002) The large subunit of initiation factor aIF2 is a close structural homologue of elongation factor Tu EMBO J., 21, 18211832[CrossRef][Web of Science][Medline] .
- Londei, P., Altamura, S., Cammarano, P., Petrucci, L. (1986) Differential features of ribosomes and of poly(U) directed cell-free systems derived from sulfur-dependent archaebacteria Eur. J. Biochem., 157, 455462[Web of Science][Medline] .
- Kyrpides, N.C. and Woese, C.R. (1998) Archaeal translation initiation revisited: the initiation factor 2 and eukaryotic initiation factor 2B
ß
subunit families Proc. Natl Acad. Sci. USA, 95, 37263730[Abstract/Free Full Text] . - Roll-Mecak, A., Alone, P., Cao, C., Dever, T.E., Burley, S.K. (2004) X-ray structure of translation initiation factor eIF2gamma: implications for tRNA and eIF2alpha binding J. Biol. Chem., 279, 1063410642
[Abstract/Free Full Text] . - Erickson, F.L. and Hannig, M. (1996) Ligand interaction with eukaryotic translation initiation factor 2: role of the gamma subunit EMBO J., 15, 63116320[Web of Science][Medline] .
- Das, A., Bagchi, M.K., Ghosh-Dastidar, P., Gupta, N.K. (1982) Protein synthesis in rabbit reticulocytes. A study of peptide chain initiation using native and ß-subunit depleted eukaryotic initiation factor 2 J. Biol. Chem., 257, 12821288
[Free Full Text] . - Colthurst, D.R., Campbell, D.G., Proud, C.G. (1987) Structure and regulation of eukaryotic initiation factor eIF2: sequence of the site in the
subunit phosphorylated by the haem-controlled repressor and by the double-stranded RNA-activated inhibitor Eur. J. Biochem., 166, 357363[Web of Science][Medline]
. - Laurino, J.P., Thompson, G.M., Pacheco, E., Castilho, B.A. (1999) The beta subunit of eukaryotic translation initiation factor 2 binds mRNA through the lysine repeats and a region comprising the C2C2 motif Mol. Cell. Biol., 19, 173181
[Abstract/Free Full Text] . - Nika, J., Yang, W., Pavitt, G.D., Hinnebusch, A.G., Hannig, E.M. (2000) Purification and kinetic analysis of eIF2B from Saccharomyces cerevisiae J. Biol. Chem., 34, 2601126017 .
- Tahara, M., Ohsawa, A., Saito, S., Kimura, M. (2004) In vitro phosphorylation of initiation factor 2 alpha (aIF2 alpha) from hyperthermophilic archaeon Pyrococcus horikoshii OT3 J. Biochem., 135, 479485
[Abstract/Free Full Text] . - Keeling, P.J., Fast, N.M., McFadden, G.I. (1998) Evolutionary relationships between translation initiation factor eIF2 gamma and selenocysteine-specific elongation factor SELB: change of function in translation factors J. Mol. Evol., 47, 649655[CrossRef][Web of Science][Medline] .
- Ringquist, S., Schneider, D., Gibson, T., Baron, C., Böck, A., Gold, L. (1994) Recognition of the mRNA selenocysteine insertion sequence by the specialized translation elongation factor SELB Genes Dev., 8, 376385
[Abstract/Free Full Text] . - Fagegaltier, D., Hubert, N., Yamada, K., Mizutani, T., Carbon, P., Krol, A. (2000) Characterization of mSelB, a novel mammalian elongation factor for selenoprotein translation EMBO J., 19, 47964805[CrossRef][Web of Science][Medline] .
- Rother, M., Wilting, R., Commans, S., Böck, A. (2000) Identification and characterisation of the selenocysteine-specific translation factor SelB from the archaeon Methanococcus jannaschii J. Mol. Biol., 299, 351358[CrossRef][Web of Science][Medline] .
- Waters, E., Hohn, M.J., Ahel, I., Graham, D.E., Adams, M.D., Barnstead, M., Beeson, K.Y., Bibbs, L., Bolanos, R., Keller, M., et al. (2003) The genome of Nanoarchaeum equitans: insights into early archaeal evolution and derived parasitism Proc. Natl Acad. Sci. USA, 100, 1298412988
[Abstract/Free Full Text] .
This article has been cited by other articles:
![]() |
D. Hasenohrl, T. Lombo, V. Kaberdin, P. Londei, and U. Blasi Translation initiation factor a/eIF2(-{gamma}) counteracts 5' to 3' mRNA decay in the archaeon Sulfolobus solfataricus PNAS, February 12, 2008; 105(6): 2146 - 2150. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yatime, Y. Mechulam, S. Blanquet, and E. Schmitt Structure of an archaeal heterotrimeric initiation factor 2 reveals a nucleotide state between the GTP and the GDP states PNAS, November 20, 2007; 104(47): 18445 - 18450. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sokabe, M. Yao, N. Sakai, S. Toya, and I. Tanaka Structure of archaeal translational initiation factor 2 beta{gamma}-GDP reveals significant conformational change of the beta-subunit and switch 1 region PNAS, August 29, 2006; 103(35): 13016 - 13021. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. V. Alone and T. E. Dever Direct Binding of Translation Initiation Factor eIF2{gamma}-G Domain to Its GTPase-activating and GDP-GTP Exchange Factors eIF5 and eIF2B{epsilon} J. Biol. Chem., May 5, 2006; 281(18): 12636 - 12644. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. HASENOHRL, D. BENELLI, A. BARBAZZA, P. LONDEI, and U. BLASI Sulfolobus solfataricus translation initiation factor 1 stimulates translation initiation complex formation RNA, April 1, 2006; 12(4): 674 - 682. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









