Nucleic Acids Research Advance Access originally published online on August 16, 2006
Nucleic Acids Research 2006 34(14):4060-4068; doi:10.1093/nar/gkl577
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nucleic Acids Research, 2006, Vol. 34, No. 14 4060-4068
© 2006 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Molecular Biology |
Isolation of a single-stranded DNA-binding protein from the methylotrophic yeast, Pichia pastoris and its identification as zeta crystallin
Department of Biochemistry, Indian Institute of Science Bangalore 560012, India
*To whom correspondence should be addressed. Tel/Fax: +91 80 2360492; Email: pnr{at}biochem.iisc.ernet.in
Received June 12, 2006. Revised July 20, 2006. Accepted July 24, 2006.
| ABSTRACT |
|---|
|
|
|---|
A single-stranded DNA (ssDNA)-binding protein (SSB) that binds to specific upstream sequences of alcohol oxidase (AOX1) promoter of the methylotrophic yeast Pichia pastoris has been isolated and identified as zeta crystallin (ZTA1). The cDNA encoding P.pastoris ZTA1 (PpZTA1) was cloned into an Escherichia coli expression vector, the recombinant PpZTA1 was expressed and purified from E.coli cell lysates. The DNA-binding properties of recombinant PpZTA1 are identical to those of the SSB present in P.pastoris cell lysates. PpZTA1 binds to ssDNA sequences >24 nt and its DNA-binding activity is abolished by NADPH. This is the first report on the characterization of DNA-binding properties of a yeast ZTA1.
| INTRODUCTION |
|---|
|
|
|---|
Single-stranded DNA (ssDNA)-binding proteins (SSBs) perform several essential functions in cells. For many species, SSBs that bind to ssDNA with little or no sequence specificity have been identified, and such proteins have been identified in almost all living cells. SSBs can be divided into several classes ranging from monomeric proteins of bacteriophages such as gene-32 protein (1) to dimeric SSBs of filamentous phages (2) to heterotrimeric nuclear SSBs in eukaryotes such as replication protein A (3) and finally to homotetrameric SSBs (46). Zeta Crystallin (ZTA1), an NADPH-dependent quinone oxidoreductase, is a major eye lens protein in certain vertebrates such as guinea pigs and camels (7,8) but not in others such as humans, mice or cattle. It is a soluble enzyme and is distinct from membrane-bound quinone oxidoreductase, the large complex in the respiratory chain (9). It is also distinct from the mammalian quinone oxidoreductase called DT-diaphorase, a flavin adenine dinucleotide-containing enzyme that catalyses NAD(P)H-dependent two-electron reduction of quinones (10). ZTA1 reduces naturally occurring quinones such as 1,2-naphthoquinone and phenanthraquinone and the physiological function of ZTA1 is speculated to be detoxification or metabolism of a quinone (7,11,12). Genes encoding ZTA1 homologues are widely distributed from bacteria to higher plants and animals and the crystal structure of Escherichia coli quinone oxidoreductase/ZTA1 is known (13). Among the mammalian zeta crystallins, the bovine ZTA1 was shown to be capable of binding to single-stranded as well as double-stranded Z-DNA which could be competed with NADPH (14). Bovine ZTA1, also known as RF-36, was shown to play pleiotropic roles in gene expression, growth and differentiation of bovine lens (1519). A well-characterized nucleotide-binding domain (Rossmann fold) as well as a pyridine nucleotide-binding sequence (GxxGxxG) or its variant are present in ZTA1 of all species (12,13,20,21). Genes encoding ZTA1 are reported in the genomes of Saccharomyces cerevisiae (http://db.yeastgenome.org/cgibin/locus.pl?locus=zta1) and Pichia pastoris (http://ergo.integratedgenomics.com/ERGO/CGI/prot.cgi?prot=RPPA06848) but the proteins are not biochemically characterized.
In the methylotrophic yeast P.pastoris, alcohol oxidase (AOX) is the first enzyme involved in the methanol metabolism. It is encoded by two methanol-inducible genes, AOX1 and AOX2, of which transcription of AOX1 gene is induced to very high levels by methanol (22,23). Therefore, the upstream region of AOX promoter between 735 and 1 is widely used for heterologous expression of a number of foreign proteins in P.pastoris (http://faculty.kgi.edu/cregg/index.htm). Recently, a protein referred to as methanol expression regulator 1 (Mxr1p) binding to the upstream region of P.pastoris AOX1 promoter was identified (24). Mxr1p binds to the AOX1 upstream region between 415 and 172 in vitro and deletion of this region results in a significant decrease in AOX1 gene expression in vivo. However, deletion of sequences outside Mxr1p-binding region in the AOX1 promoter also results in a decrease in AOX1 gene expression indicating the involvement of multiple regulatory circuits in AOX1 gene regulation (24). In this study, we employed a biochemical approach to identify proteins interacting with specific upstream sequences of AOX1 promoter. Such efforts have led to the isolation of an SSB which was purified and identified as the P.pastoris homologue of ZTA1.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Growth of P.pastoris cells and preparation of whole cell extracts
P.pastoris (GS115 strain) cells were grown overnight in YPD medium (1% yeast extract, 2% peptone, 2% glucose) at 30°C with vigorous shaking. Stationary phase cells were centrifuged once at 2000 g, washed with water and resuspended in buffer A (20 mM TrisHCl, pH 8.0, 10 mM MgCl2, 7 mM ß-mercaptoethanol, 10% glycerol, 1 mM phenylmethylsulfonyl flouride and 1 µg/ml each of pepstatin, aprotinin and leupeptin) containing 50 mM NaCl. An equal volume of acid-washed glass beads (0.45 mm) suspended in ice-cold buffer A were added and cells were lysed at 4°C by vigorous intermittent vortexing for 30 min or using a bead beater (Biospec Products, USA). The whole cell extracts obtained after centrifugation at 10 000 g for 20 min at 4°C were stored at 80°C.
Heparin agarose and DEAE cellulose chromatography
The whole cell extracts were loaded onto heparin agarose column (20 mg protein/ml resin) equilibrated with buffer A, the unbound protein was collected and stored separately as the flow through fraction. The column was washed with 2 column volumes of buffer A and the bound protein was eluted sequentially with buffer A containing 200 mM (E1), 300 mM (E2) and 400 mM NaCl (E3). These eluate fractions were dialysed against buffer A at 4°C and stored at 80°C in aliquots. The E1 fraction was loaded onto a DEAE cellulose column equilibrated with buffer A, the unbound protein fraction (flow through) was collected and stored at 80°C. The column was washed with buffer A, the bound proteins were eluted in buffer A containing 200 mM NaCl and stored at 80°C in aliquots after dialysis against buffer A.
Synthesis of oligonucleotides and preparation of radiolabelled DNA probes
Oligonucleotides listed in Table 1 were purchased from Sigma-Aldrich Chemicals, Bangalore, India. High-specific activity 32P-radiolabeled probes were prepared by random prime labelling and lower specific activity probes were prepared by 5' end labelling. The former (288*, 229* and 174*) were generated by first annealing complementary oligonucleotides (288 and 288c1, 229 and 229c1, 174 and 174 c1) by heating at 75°C for 15 min in presence of 10 mM TrisHCl, pH 7.5, and 100 mM NaCl followed by slow cooling to room temperature. These partially double-stranded DNA (dsDNA) molecules were then radiolabelled in presence of dATP, dGTP, dTTP, [
-32P]dCTP and klenow fragment of DNA polymerase I at 37°C for 20 min (Figure 1A). End-labelled DNA probes were generated by annealing complementary oligonucleotides (288 and 288c, 229 and 229c, 174 and 174c) and then incubating these double-stranded oligonucleotides with T4 polynucleotide kinase and [
-32P]ATP at 37°C for 45 min (Figure 2A). After radiolabelling, unincorporated radionucleotides were removed by sephadex G-50 chromatography.
|
|
|
Electrophoretic mobility shift assay (EMSA)
Protein preparations (510 µg) obtained from heparin agarose and DEAE cellulose chromatography were incubated with radiolabelled oligonucleotides (40 000 CPM) in a 30 µl reaction containing 50 mM TrisHCl, pH 8.0, 50 mM NaCl, 1 mM DTT, 0.05% NP-40, 6% glycerol and 100 ng of poly(dIdC) for 30 min at 4°C. The reaction mixtures were subjected to electrophoresis at 4°C on 5% non-denaturing polyacrylamide gel in a buffer containing 7 mM TrisHCl (pH 7.4), 3 mM boric acid and 1 mM EDTA. The gels were dried and autoradiographed. In some experiments, P.pastoris cell extract was replaced by recombinant ZTA1. For the calculation of dissociation constant, EMSA was carried out with 15 ng of recombinant ZTA1 and increasing amounts of end-labelled ssDNA probes. The amount of oligonucleotide bound by protein was calculated as the difference between the known total input concentration of oligonucleotide and the amount detected in the position for free oligonucleotide on the mobility shift gels. Kd values were determined by quantitative analysis using a Scatchard plot.
Production and purification of recombinant P.pastoris ZTA1 (PpZTA1)
PpZTA1 cDNA was isolated by RTPCR from P.pastoris cellular RNA using the primer pair 5'ggatccatgactacaattccc 3' and 5'aagctttcattgagggatctc 3' and cloned into BamHI and HindIII sites of pRSETA vector (Invitrogen, USA) using standard molecular biology protocols (25). The restriction sites in the primers are underlined. The recombinant plasmid was transformed into E.coli BL21(DE3)pLysS cells and expression of the recombinant protein was induced by the addition of 0.5 mM isopropyl-ß-D-thiogalactoside. Three hours after induction, cells were harvested and resuspended in a buffer B (50 mM TrisHCl, pH 8.0, 250 mM NaCl, 10% glycerol and 10 mM ß-mercaptoethanol) containing 10 mM imidazole. Cells were lysed by sonication and the lysate was centrifuged at 10 000 g at 4°C for 30 min. The clear supernatant was loaded onto a Ni2+-NTA agarose column (Qiagen, USA). The column was washed with buffer B containing 50 mM imidazole and the Histidine-tagged PpZTA1 protein was eluted with buffer B containing 150 mM imidazole. The protein was dialysed against buffer A and stored in aliquots at 80°C after ascertaining its purity by SDSPAGE.
| RESULTS |
|---|
|
|
|---|
Identification of an SSB in P.pastoris cell extracts
The upstream region of AOX1 promoter between 735 and 1 has been extensively used for methanol-inducible expression of a number of proteins. This region was shown to harbour multiple regulatory elements including the binding site for the recently identified transcription factor Mxr1p (24). In this study, we first focused our attention on the sequences in the near upstream region of AOX1 promoter between 288 and the major transcription start site (0115) of AOX1 promoter. Oligonucletodies spanning this region were designed (Table 1) and their ability to interact with proteins present in whole cell extracts of P.pastoris cells grown in YPD was examined by EMSA. Since EMSA with whole cell extracts did not yield significant results, we enriched DNA-binding proteins by heparin agarose chromatography and also generated high-specific activity 32P-labelled DNA probes (Materials and Methods and Figure 1A). The results presented in Figure 1B indicate that 229* and 288* DNA probes formed proteinDNA complexes (E1, E2 and E3) while no significant super shift was observed with probe 174*. In this study, we focussed our attention on complex I generated by the E1 fraction (Figure 1B).
In the next set of experiments, we generated 5' end-labelled DNA probes using polynucleotide kinase and [
-32P]ATP (Figure 2A) and examined their ability to form complex I by EMSA. Surprisingly, complex I was generated by ssDNA probes (Figure 2B, lanes 1, 2, 4, 5 and 8) except 174c (Figure 2B, lane 7) but not by dsDNA probes (Figure 2B, lanes 3, 6 and 9). These results indicate that complex I is formed by an SSB protein present in the E1 fraction.
Purification and characterization of SSB from P.pastoris cell extracts
To purify the SSB present in P.pastoris cell extract, the E1 fraction was fractionated on a DEAE-Sepharose column, the flow through and 200 mM NaCl eluate fractions were analysed by SDSPAGE (Figure 3A) and EMSA (Figure 3B). The SSB activity was detected in the flow through fraction (Figure 3B, lane 1) but not in the eluate (Figure 3B, lane 2). UV cross-linking of DEAE flow through fraction and 32P-labelled 229 DNA followed by SDSPAGE and autoradiography lead to the identification of a radioactive band of
3540 kDa molecular weight (data not shown). Since a protein of similar molecular weight was enriched in the DEAE flow through fraction (indicated by an arrow in Figure 3A), this protein band was excised from the gel, subjected to trypsin digestion and the amino acid sequence of one of its tryptic peptides was determined. BLASTP search of this amino acid sequence (AYLSPSTFAQYTK) against the S.cerevisiae genome database revealed it to be homologous to a 37 kDa protein annotated as YBR046c/zeta crystallin (ZTA1) (http://db.yeastgenome.org/cgibin/locus.pl?locus=zta1). BLASTP search of ScZTA1 amino acid sequence with the P.pastoris genome database (http://ergo.integratedgenomics.com) led to the identification of a protein (ID # RPPA06848) annotated as quinone oxidoreductase. Multiple sequence alignment of amino acid sequences of ZTA1 from different species indicated that the NADPH-binding motif (AXXGXXG) present in the ZTA1 isolated from E.coli and mammalian cells is conserved in the yeast ZTA1 as well (Figure 4A). Yeast ZTA1 had
55% and 4649% homology to E.coli and mammalian ZTA1, respectively (Figure 4B). Since the molecular weight as well as the amino acid sequence of the protein sequenced in this study was similar to that encoded by S.cerevisiae YBR046c/ZTA1 and identical to that encoded by P.pastoris RPPA06848 genes, we conclude that the protein sequenced in this study is the P.pastoris homologue of E.coli and mammalian ZTA1 (PpZTA1).
|
|
Characterization of SSB activity of recombinant PpZTA1
To examine whether PpZTA1 is an SSB, oligonucleotide primers were designed based on the PpZTA1 nucleotide sequence and the full-length PpZTA1 cDNA was isolated from P.pastoris cellular RNA by RTPCR. The cDNA was cloned into an E.coli expression vector (Figure 5A) and the recombinant PpZTA1 was purified as a histidine-tagged protein using Ni2+-affinity chromatography (Figure 5B). The ability of recombinant PpZTA1 to bind ssDNA was examined by EMSA. The results indicate that the SSB properties of recombinant PpZTA1 are indistinguishable from those of the SSB purified from P.pastoris cell extracts (compare Figures 5C and 2). To gain further insights into the DNA-binding properties of PpZTA1, we chose 5' end-labelled 288c and 229c ssDNA probes and annealed them to a number of short complementary oligonucleotides to generate partial duplex DNA molecules for use in EMSA as depicted in Figure 6A. The results indicate that the DNA-binding activity of ZTA1 is not abolished when the 3' end (Figure 6B, lanes 2 and 2a) or a region near the 3' end of ssDNA molecule (Figure 6B, lanes 5 and 5a, and Figure 6C, v) is double-stranded. However, PpZTA1 failed to bind partial duplex DNA with double-stranded regions in the middle (Figure 6B, lanes 3 and 3a), 5' end (Figure 6B, lanes 4 and 4a) or near the 5' end (Figure 6B, lanes 6 and 6a). The results of EMSA are summarized in Figure 6C. Dissociation constants (Kd) for the interaction between recombinant PpZTA1 and three different oligonucleotides were calculated using scatchard plots and the results indicate that PpZTA1 binds 174 (Kd = 1 x 1010M) and 229 (Kd = 2 x 1010M) ssDNA probes with higher affinity than 288 ssDNA (Kd = 9 x 1010M). To identify the minimal ssDNA region required PpZTA1 binding, short oligonucleotides of 2032 nt in length were designed (Figure 7A) and used in EMSA. The results presented in Figure 7B indicate that PpZTA1 binds to ssDNA of 28 and 32 nt in length but not to shorter oligonucleotides. Since E.coli and mammalian ZTA1 are NADPH quinone oxidoreductases capable of binding to NADPH through the AXXGXXG nucleotide-binding motif, we examined the effect of NADPH on the SSB activity of PpZTA1. The results presented in Figure 8 indicate that SSB activity of recombinant PpZTA1 (Figure 8) is abolished in presence of NADPH but not NADH. Finally, gel filtration chromatography indicates that PpZTA1 exists as a dimer in solution since it co-elutes with albumin (Figure 9).
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Our efforts to identify proteins interacting with the upstream sequences of P.pastoris AOX1 promoter have led to the isolation of a SSB. This SSB could be identified in P.pastoris cell extracts primarily because of our strategy of radiolabelling oligonucleotides by method A as well as enrichment of DNA-binding proteins by heparin agarose chromatography. Radiolabelling of oligonucleotides by method A (Figure 1A) resulted in the generation of full-length as well as partially double-stranded radiolabelled DNA molecules and the latter are responsible for binding to the SSB enriched in the E1 and flow through fractions (Figure 1B). The results presented in Figure 2 clearly demonstrate that complex I is indeed generated by an SSB present in the E1 fraction. Partial purification and sequencing of a
37 kDa protein enriched in the DEAE flow through fraction led to the identification of PpZTA1. Studies carried out with recombinant PpZTA1 clearly establish its identity as an SSB. Although gene sequences encoding ZTA1 have been reported for a number of organisms (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=protein&cmd=search&term=zeta?crystallin), thus far only the bovine ZTA1 was shown to have SSB activity (14,18,19). Our studies indicate that PpZTA1 is similar to bovine ZTA1 since it also binds ssDNA. In this study, we focused our attention on the DNA-binding activity of PpZTA1 using oligonucletodies of defined length and sequence since such studies have not been carried out thus far. We have also calculated the Kd values which are comparable with those for other well-characterized DNA-binding proteins (26). Of the six different single-stranded oligonucleotides examined in this study, ZTA1 binds to five of them (Figure 5, lanes 1, 2, 4, 5 and 7) but does not bind to 174c oligonucleotide (Figure 5, lane 8), which is complementary to 174. This is a very interesting observation since it demonstrates for the first time that the binding of ZTA1 to ssDNA may be sequence-specific. However, the results presented in Figure 6 does not completely support this notion. To address these issues, we are now carrying out DNA-binding studies using chimeric oligonucleotides in which specific regions in 174 ssDNA are replaced by corresponding regions in 174c ssDNA. We are also examining the ability of ZTA1 to bind to homopolymers such as poly(dA), poly(dT), poly(dC) and poly(dG). Such studies aimed at understanding the molecular mechanism of ZTA1 DNA binding will be published in a separate study. Earlier studies on analysis of SSB of bovine ZTA1 were carried out using denatured or high molecular weight bovine lens DNA and Z-DNA (14,18,19). For the first time, we report the purification of ZTA1 based on its ability to bind to ssDNA sequences of defined length. Further, the SSB activity of PpZTA1 is abolished in presence of NADPH as observed in case of bovine ZTA1 (14). Among the mammalian ZTA1 proteins studied thus far, bovine but not guinea pig ZTA1 binds ssDNA and the theoretical pI of bovine and guinea pig ZTA1 calculated based on their amino acid sequences is 8.61 and 7.81, respectively (14). It was suggested that the increased positive charge may contribute to the high affinity of bovine ZTA1 for ssDNA (14). The theoretical pI of PpZTA1 calculated based on the amino acid sequence is 8.93 which is similar to that of bovine ZTA1 rather than guinea pig ZTA1. Thus, there appears to be a good correlation between the net positive charge of ZTA1 of different species and the SSB activity.
The redox potential of cells vary during the metabolism of different carbon sources and proteins which act as redox sensors as well as regulators of gene expression may play an important role in cellular homeostasis. A number of pyridine nucleotide-binding proteins possessing nucleotide-binding domains also bind nucleic acids indicating a dual role for these metabolic enzymes in enzyme catalysis as well as gene regulation (27). It is tempting to speculate that ZTA1 may have such dual functions wherein, it not only performs catalytic function in the cytoplasm but also under conditions of reduced cytosolic NADPH levels, translocates to nucleus, bind to single-stranded regions in the promoters of genes such as AOX1 and functions as a regulator of gene expression. ZTA1 is localized in cytoplasm as well as nucleus in S.cerevisiae cells (http://yeastgfp.ucsf.edu/getOrf.php?orf=YBR046C) and preliminary studies from our laboratory indicate that PpZTA1 is also localized in both these compartments (B. V. Kranthi and P. N. Rangarajan, unpublished data). It should be noted that deletion of ZTA1 results in a viable phenotype (http://db.yeastgenome.org/cgibin/phenotype/phenotype.pl?dbid=S000000250) in S.cerevisiae indicating that the function of ZTA1 may be evident only under specific growth conditions. Identification of these growth conditions as well as characterization of the DNA sequences to which ZTA1 binds in vivo may pave way for the understanding of the physiological functions of ZTA1.
Bovine ZTA1 was originally identified as a DNA-binding protein called regulatory factor 36 (RF-36) involved in the homeotic switch concerned with adult lens gene expression (28). RF-36 was shown to bind to alpha-crystallin A-2 gene promoter region between the TATA box and transcription initiation site which possesses a Z-DNA conformation (16,17). Addition of bovine ZTA1 (RF-36) to in vitro transcription reactions was shown to result in 6- to 10-fold increase in transcription of alpha-crystallin A-2 gene or purified bovine lens chromatin (15,16). It is speculated that mammalian ZTA1 may act as a transcriptional enhancer in the outer lens cortex by binding to Z-DNA sequences in the lens crystallin gene promoters (19). In the light of these observations, a role for PpZTA1 in AOX gene regulation cannot be ruled out. Finally, ZTA1 is induced by various oxidative stress treatments in Arabidopsis thaliana and it confers tolerance toward oxidative stress to yeast when introduced into the yeast, suggesting that the enzyme is involved in an antioxidative mechanism in plants (29). Whether PpZTA1 has a similar role during the oxidative stress induced by methanol and oleate metabolism in P.pastoris remains to be examined.
| ACKNOWLEDGEMENTS |
|---|
The authors acknowledge the financial support received from the Department of Biotechnology, New Delhi, India. Funding to pay the Open Access publication charges for this article was provided by the Department of Biotechnology, New Delhi, India.
Conflict of interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Shamoo, Y., Friedman, A.M., Parsons, M.R., Konigsberg, W.H., Steitz, T.A. (1995) Crystal structure of a replication fork single-stranded DNA binding protein (T4 gp32) complexed to DNA Nature, 376, 362366[CrossRef][Medline] .
- Stassen, A.P., Folmer, R.H., Hilbers, C.W., Konings, R.N. (1995) Single-stranded DNA binding protein encoded by the filamentous bacteriophage M13: structural and functional characteristics Mol. Biol. Rep, . 20, 109127 .
- Bochkarev, A., Pfuetzner, R.A., Edwards, A.M., Frappier, L. (1997) Structure of the single-stranded-DNA-binding domain of replication protein A bound to DNA Nature, 385, 176181[CrossRef][Medline] .
- Raghunathan, S., Ricard, C.S., Lohman, T.M., Waksman, G. (1997) Crystal structure of the homo-tetrameric DNA binding domain of Escherichia coli single-stranded DNA-binding protein determined by multiwavelength x-ray diffraction on the selenomethionyl protein at 2.9-A resolution Proc. Natl Acad. Sci. USA, 94, 66526657
[Abstract/Free Full Text] . - Webster, G., Genschel, J., Curth, U., Urbanke, C., Kang, C.H., Hilgenfeld, R. (1997) A common core for binding single-stranded DNA: structural comparison of the single-stranded DNA-binding proteins (SSB) from E.coli and human mitochondria FEBS Lett, . 411, 313316[CrossRef][Web of Science][Medline] .
- Yang, C., Curth, U., Urbanke, C., Kang, C.H. (1997) Crystal structure of human mitochondrial single-stranded DNA binding protein at 2.4 A resolution Nature Struct. Biol, . 4, 153157[CrossRef][Web of Science][Medline] .
- Duhaiman, A.S., Rabbani, A., AlJafari, A.A., Alhomida, A.S. (1995) Purification and characterization of
-crystallin from the camel lens Biochem. Biophys. Res. Commun, . 215, 632640[CrossRef][Web of Science][Medline]
. - Rao, P.V. and Zigler, J.S. (1992) Purification and characterization of zeta-crystallin/quinone reductase from guinea pig liver Biochim. Biophys. Acta, 1117, 315320[Medline] .
- Yagi, T. (1991) Bacterial NADH-quinone oxidoreductases J. Bioenerg. Biomembr, . 23, 211225[CrossRef][Web of Science][Medline] .
- Li, R., Bianchet, M.A., Talalay, P., Amzel, L.M. (1995) The three-dimensional structure of NAD(P)H:quinone reductase, a flavoprotein involved in cancer chemoprotection and chemotherapy: mechanism of the two-electron reduction Proc. Natl Acad. Sci. USA, 92, 88468850
[Abstract/Free Full Text] . - Gonzalez, P., Rao, P.V., Zigler, J.S. (1993) Molecular cloning and sequencing of zeta-crystallin/quinone reductase cDNA from human liver Biochem. Biophys. Res. Commun, . 191, 902907[CrossRef][Web of Science][Medline] .
- Rao, P.V., Krishna, C.M., Zigler, J.S. (1992) Identification and characterization of the enzymatic activity of zeta-crystallin from guinea pig lens J. Biol. Chem, . 267, 96102
[Abstract/Free Full Text] . - Thorn, J.M., Barton, J.D., Dixon, N.E., Ollis, D.L., Edwards, K.J. (1995) Crystal structure of Escherichia coli QOR quinone oxidoreductase complexed with NADPH J. Mol. Biol, . 249, 785799[CrossRef][Web of Science][Medline] .
- Rao, P.V., Gonzalez, P., Persson, B., Jornvall, H., Garland, D., Zigler, J.S., Jr. (1997) Guinea pig and bovine zeta-crystallins have distinct functional characteristics highlighting replacements in otherwise similar structures Biochemistry, 36, 53535362[CrossRef][Medline] .
- Chen, J.H. and Kang, L.-Y. (1986) The pleiotropic role of RF-36 gene product: homeotic switch during lens growth and differentiation. In Lavers,G.C. and Chen,J.H. (eds), Cellular and Molecular Aspects of Eye Research, .Sino-American, NY pp. 107113 .
- Chen, J.H., Shen, D-F., Tong, T.C., Zhang, L., Liu, H.L. (1989) The pleiotropic roles of RF-36 nucleic acid binding protein: DNA topology and receptor response in crystallin gene expression In Papas, T.S. (Ed.). Advances In Applied Biotechnology Series, Houston Gulf Publishing Vol. 7, pp. 107121 .
- den Dunnen, J.T., van Neck, J.W., Cremers, F.P.M., Lubsen, N.H., Schoenmakers, J.G.G. (1989) Nucleotide sequence of the rat gamma-crystallin gene region and comparison with an orthologous human region Gene, 78, 201213[CrossRef][Web of Science][Medline] .
- Gagna, C.E., Lambert, W.C., Kuo, H.-R., Farnsworth, P.N. (1997) The localization of B-DNA and Z-DNA in terminally differentiating fiber cells in the adult lens J. Histochem. Cytochem, . 45, 15111521
[Abstract/Free Full Text] . - Gagna, C.E., Chen, J.H., Kuo, H.R., Lambert, W.C. (1998) Binding properties of bovine ocular lens zeta-crystallin to right-handed B-DNA, left-handed Z-DNA, and single-stranded DNA Cell Biol. Int, . 22, 217225[CrossRef][Web of Science][Medline] .
- Mano, J., Babiychuk, E., Belles-Boix, E., Hiratake, J., Kimura, A., Inzé, D., Kushnir, S., Asada, A. (2000) A novel NADPH:diamide oxidoreductase activity in Arabidopsis thaliana P1
-crystallin Eur. J. Biochem, . 267, 36613671[Web of Science][Medline]
. - Shimomura, Y., Kakuta, Y., Fukuyama, K. (2003) Crystal structures of the quinone oxidoreductase from Thermus thermophilus HB8 and its complex with NADPH: implication for NADPH and substrate recognition J. Bacteriol, . 185, 42114218
[Abstract/Free Full Text] . - Ellis, S.B., Brust, P.F., Koutz, P.J., Waters, A.F., Harpold, M.M., Gingeras, T.R. (1985) Isolation of alcohol oxidase and two other methanol regulatable genes from the yeast Pichia pastoris Mol. Cell. Biol, . 5, 11111121
[Abstract/Free Full Text] . - Ohi, H., Miura, M., Hiramatsu, R., Ohmura, T. (1994) The positive and negative cis-acting elements for methanol regulation in the Pichia pastoris AOX2 gene Mol. Gen. Genet, . 243, 489499[CrossRef][Web of Science][Medline] .
- Lin-Cereghino, G.P., Godfrey, L., de la Cruz, B.J., Johnson, S., Khuongsathiene, S., Tolstorukov, I., Yan, M., Lin-Cereghino, J., Veenhuis, M., Subramani, S., et al. (2006) Mxr1p, a key regulator of the methanol utilization pathway and peroxisomal genes in Pichia pastoris Mol. Cell. Biol, . 26, 883897
[Abstract/Free Full Text] . - Sambrook, J., Fritsch, E.F., Maniatis, T. Molecular Cloning: A Laboratory Manual, (1989) 2nd edn Cold Spring Harbor, NY Cold Spring Harbor Laboratory Press .
- Dubey, A.K. and Roberts, R.J. (1992) Sequence-specific DNA binding by the MspI DNA methyltransferase Nucleic Acids Res, . 20, 31673173
[Abstract/Free Full Text] . - Hentze, M.W. (1994) Enzymes as RNA-bindingproteins: a role for (di) nucleotide-binding domains Trends Biochem. Sci, . 19, 101103[CrossRef][Web of Science][Medline] .
- Kang, L.Y., Zheng, S.H., Liu, Y.X., Shen, D.E., Chen, J.H. (1985) Isolation and characterization of a novel nucleic acid binding protein from calf lenses Curr. Eye Res, . 4, 199206[Web of Science][Medline] .
- Babiychuk, E., Kushnir, S., Belles-Boixm, E., Van Montagu, M., Inze, D. (1995) Arabidopsis thaliana NADPH oxidoreductase homologs confer tolerance of yeasts toward the thiol-oxidizing drug diamide J. Biol. Chem, . 270, 2622426231
[Abstract/Free Full Text] .
This article has been cited by other articles:
![]() |
D. Basu, G. Khare, S. Singh, A. Tyagi, S. Khosla, and S. C. Mande A novel nucleoid-associated protein of Mycobacterium tuberculosis is a sequence homolog of GroEL Nucleic Acids Res., August 1, 2009; 37(15): 4944 - 4954. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Porte, E. Valencia, E. A. Yakovtseva, E. Borras, N. Shafqat, J. E. Debreczeny, A. C. W. Pike, U. Oppermann, J. Farres, I. Fita, et al. Three-dimensional Structure and Enzymatic Function of Proapoptotic Human p53-inducible Quinone Oxidoreductase PIG3 J. Biol. Chem., June 19, 2009; 284(25): 17194 - 17205. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










