Skip Navigation


Nucleic Acids Research Advance Access originally published online on September 8, 2006
Nucleic Acids Research 2006 34(17):4711-4721; doi:10.1093/nar/gkl663
This Article
Right arrow Abstract Freely available
Right arrow Print PDF (1881K) Freely available
Right arrow Screen PDF (474K) Freely available
Right arrowOA All Versions of this Article:
34/17/4711    most recent
gkl663v3
gkl663v2
gkl663v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Shibata, S.
Right arrow Articles by Yoneda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shibata, S.
Right arrow Articles by Yoneda, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 2006, Vol. 34, No. 17 4711-4721
© 2006 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (
http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.


RNA

Exportin-5 orthologues are functionally divergent among species

Satoshi Shibata1, Mitsuho Sasaki1, Takashi Miki1, Akira Shimamoto3, Yasuhiro Furuichi3, Jun Katahira1,2,* and Yoshihiro Yoneda1,2,*

1 Department of Cell Biology and Neuroscience, Graduate School of Medicine, Osaka University 1-3 Yamadaoka, Suita, Osaka 565-0871, Japan 2 Biomolecular Networks Laboratories, Biomolecular Dynamics Group, Graduate School of Frontier Biosciences, Osaka University 1-3 Yamadaoka, Suita, Osaka 565-0871, Japan 3 Department of Target Discovery, GeneCare Research Institute 200 Kajiwara, Kamakura, Kanagawa 247-0063, Japan

*To whom correspondence should be addressed. Tel: +81 6 6879 4605; Fax: +81 6 6879 4609; Email: yyoneda{at}anat3.med.osaka-u.ac.jp

Received July 4, 2006. Revised August 14, 2006. Accepted August 24, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Exportin-5, an evolutionarily conserved nuclear export factor belonging to the importin-ß family of proteins, is known to play a role in the nuclear export of small noncoding RNAs such as precursors of microRNA, viral minihelix RNA and a subset of tRNAs in mammalian cells. In this study, we show that the exportin-5 orthologues from different species such as human, fruit fly and yeast exhibit diverged functions. We found that Msn5p, a yeast exportin-5 orthologue, binds double-stranded RNAs and that it prefers a shorter 22 nt, double-stranded RNA to ~80 nt pre-miRNA, even though both of these RNAs share a similar terminal structure. Furthermore, we found that Drosophila exportin-5 binds pre-miRNAs and that amongst the exportin-5 orthologues tested, it shows the highest affinity for tRNAs. The knockdown of Drosophila exportin-5 in cultured cells decreased the amounts of tRNA as well as miRNA, whereas the knock down of human exportin-5 in cultured cells affected only miRNA but not tRNA levels. These results indicate that double-stranded RNA binding ability is an inherited functional characteristic of the exportin-5 orthologues and that Drosophila exportin-5 functions as an exporter of tRNAs as well as pre-miRNAs in the fruit fly that lacks the orthologous gene for exportin-t.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Since the nucleus and the cytoplasm are physically separated compartments in eukaryotic cells, different classes of RNAs and proteins are transported into and out of the nucleus via the nuclear pore complex. Shuttling transporters are indispensable for the signal mediated nulceo-cytoplasmic transport of different cargoes. The importin-ß family proteins comprise one major class of nucleo-cytoplasmic transporters (14). The importin-ß family proteins are subdivided into two major classes, based on their directionality of transport i.e.; importins function in the nuclear import, whereas exportins are engaged in the nuclear export of various cargoes. The small nuclear GTPase Ran plays a pivotal role, in dictating the directionality of transport mediated by the importin-ß family proteins (5,6).

Exportin-5 (Exp5) has been identified as an exportin for various RNAs including viral mini-helix RNA and precursors of microRNA (pre-miRNAs) (711). These non-coding RNAs share common structural characteristics, such as a small size, hairpin-like fold-back structures due to intramolecular base pairing, and a 2–3 nt protrusion at their 3' ends, which are also known as common structural features of RNase III-processed RNAs. Indeed, a recent report demonstrated that human (hs) Exp5 recognizes pre-microRNAs through their double-stranded (ds) stem and the short overhang at the 3'-end that are produced by nuclear RNaseIII Drosha cleavage (12).

Msn5p, the budding yeast orthologue of mammalian Exp5, was originally identified as an exportin for a subset of proteins, not all but most of which are phosphorylated (1318). Since there is no sequence similarity among these protein cargoes, proteinaceous nuclear export signal (NES) specific for Msn5p is still elusive. In addition to these cargoes, Msn5p may also function as an exportin for tRNAs, albeit it was only indirectly shown (19). The exportin that was first assigned as being specific for tRNAs is Los1p in yeast and exportin-t (Exp-t) in mammals (2024). Although yeast strains lacking either LOS1 or MSN5 alone revealed only moderate defects in the nuclear export of tRNAs (2426), the double knockout strain, lacking both of these genes, showed a significant defect in the nuclear export of tRNAs (19). Using a Xenopus oocyte microinjection system, it was shown that both Exp-t and Exp5 of mammalian origin also promoted the nuclear export of tRNAs, although the potency of Exp-t was higher than that of Exp5 (27).

HsExp-t binds to the T{psi}C and acceptor arms of tRNA under in vitro conditions (20). Both Bohnsack et al. and Calado et al. have suggested that the mechanism of recognition of tRNAs by Exp5 are different from that by Exp-t, based on their observations that Exp5, but not Exp-t, is able to form a ternary complex with tRNA along with a tRNA binding protein, eEF1A (27,28). In plant Arabidopsis, a defect in tRNA processing was observed in an Exp-t orthologue PAUSED (PSD) mutant, but not in an Exp5 orthologue HASTY (HST) mutant (2932). As mentioned above, mammalian Exp5 facilitates the nuclear export of pre-miRNA and the viral mini helix RNA (79), but other cargoes for Exp-t, except for tRNAs have not yet been identified. These cumulative findings suggest that in most organisms, including animals and plants, Exp5 orthologues may play major roles in pre-miRNA export, whereas it comprises a minor export route for tRNAs.

Interestingly, however, it was predicted that no Exp-t orthologous gene exists in several arthropods including Drosophila melanogaster (dm) (33). To date, the issue of how tRNA export is achieved in such organisms remains unknown. In this study, we compared the functional characteristics of three Exp5 orthologues from different species to determine whether Exp5 orthologues from different organisms function in different manners. Although we found that all the Exp5 orthologues examined were able to bind both pre-miRNAs and tRNAs, there are significant differences in their substrate preferences. Yeast Msn5p exhibited a higher affinity for a short 22 bp dsRNA than to a ~80 bp pre-miRNA with the hairpin-like fold-back structure. Though hsExp5 was able to recognize tRNAs as cargoes, the binding of hsExp5 to pre-miRNA was not inhibited by an excess amount of tRNA. In contrast, we found that tRNAs efficiently inhibited the interaction between dmExp5 and pre-miRNA. The RNAi-induced knockdown of the expression of dmExp5 in Drosophila Schneider's 2 cells caused a decrease in the expression of both tRNA and miRNA. The down regulation of hsExp5 in human cells, on the other hand, resulted in a decrease in miRNA but not tRNA. These results indicate that, in Drosophila cells, dmExp5 plays a central role in the nuclear export of tRNA and miRNA and that dsRNA binding ability is an inherited functional property of the Exp5 orthologues. The latter indication suggests the intriguing possibility that dsRNA may be widely involved in the nuclear export of protein cargoes by yeast Msn5p.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid construction
To construct a template for pT7-pre-miR-30, two oligonucleotides 5'-GATCCTTTCTAATACGACTCACTATAGGGGCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGCTTTCAGTCGGATGTTTGCAGCTGCTGCATG -3' and 5'-CAGCAGCTGCAAACATCCGACTGAAAGCCCATCTGTGGCTTCACAGCTTCCAGTCGAGGATGTTTACAGTCGCCCCTATAGTGAGTCGTATTAGAAAG-3' (underline indicates the T7 promoter sequence) were annealed and ligated to the pUC18 vector that had been treated with BamHI and SphI. The template plasmids encoding U1{Delta}Sm and tRNA-Met were generous gifts from M. Ohno, Kyoto University.

The cDNAs for hsExp5 and dmExp5 (GenBank accession numbers, hsExp5: AF298880 [GenBank] , dmExp5: AF222746 [GenBank] .1) were amplified by RT–PCR, subcloned into the NotI–XhoI site of the pcDNA3 vector (Invitrogen) together with an oligonucleotide linker encoding a FLAG peptide tag (DYKDDDDK) and is referred to as pcDNA/hsExp5 and pcDNA/dmExp5, respectively. For the construction of an Escherichia coli expression vector, the cDNA of hsExp5 was amplified by PCR and cloned into the pQE60 vector (Qiagen) that had been linearized by NcoI–BglII double digestion. The cDNA for Msn5p (GenBank accession number: X93302 [GenBank] ) was amplified by PCR using pTYE292 (a gift from T. Yoshihisa, Nagoya University) as a template and cloned into the NcoI–BamHI site of the pQE60 vector. The cDNA of dmExp5 was amplified by PCR and cloned into the BamHI–XhoI site of the pET21a (+) vector (Stratagene). DNA fragments encoding human exportin-1 were amplified by PCR using pB-hCRM1 (34) and cloned into pQE60 vector and pGEX-6P vector (GE Healthcare). The cDNA of Drosophila Ran (GenBank accession number: AF233584 [GenBank] ) was amplified by RT–PCR and cloned into pBluescript SK (+) vector (Stratagene). To generate the dmRanQ69L mutant, this plasmid was mutated using a QuikChange site-directed mutagenesis kit (Stratagene) using the following primers: the forward primer, 5'-TGGGATACCGCTGGCCTGGAGAAGTTCGGCGGGCTGCGCG-3' and the reverse primer, 5'-CCCGCCGAACTTCTCCAGGCCAGCGGTATCCCACACATTG-3'. The mutated DNA fragment was cloned into the pGEX-6p vector. A DNA fragment encoding Gsp1pQ71L was amplified by PCR using pTYE297 as a template (a gift from T. Yoshihisa) and cloned into the pGEX-6p vector. Construction of the E.coli expression vectors for human RanQ69L has been described elsewhere (35). The pQE60-Exp-t vector (20) was a gift from M. Ohno. To obtain an expression vector for hsExp5 in S2 cells, pcDNA/hsExp5 was digested at the NotI–XhoI site and the resulting DNA fragment encoding FLAG-hsExp5 was ligated to the pMT/V5 His A vector (Invitrogen) that had been treated with NotI and XhoI.

For preparation of dsRNAs encoding dmDrosha (GenBank accession number: AF116572 [GenBank] ) and dmDGCR8 (GenBank accession number: NM_143622 [GenBank] ), the full-length cDNAs of dmDrosha and dmDGCR8 were cloned by RT–PCR and ligated into the EcoRV site of the pBluescript SK (+) vector by blunt-end ligation.

Cell culture and establishment of stable cell lines
Drosophila Schneider's 2 (S2) cells were cultured in complete Schneider's Drosophila medium (Invitrogen) containing 10% heat-inactivated fetal bovine serum (FBS) at 28°C. S2 cells (3 x 106) in 3 ml of complete Schneider's Drosophila medium were seeded in 35 mm dishes and grown for 12–16 h prior to transfection. The pMT/V5-His vectors, which express nothing (empty) or hsExp5, were co-transfected with pCoHygro (Invitrogen) using the calcium phosphate transfection procedure. Four days after transfection, stable cells were selected by culturing them in complete medium containing 300 µg/ml Hygromicin-B (Wako) for more than 3 weeks. After examining the stable expression of hsExp5 by western blot using an anti-penta-His antibody, the cells were cultured in the same medium containing 300 µg/ml Hygromycin-B (Wako).

293F cells were cultured in DMEM (Sigma) containing 10% FBS at 37°C in 5% CO2 atmosphere.

Antibodies
Mice were immunized against residues 712–1214 of hsExp5, which was expressed as a His-tagged protein in E.coli. A pool of the sera, the specificities of which were individually confirmed by western blot using a total cell extract of 293F cells (data not shown), was used as a polyclonal anti-hsExp5 antibody. Mouse monoclonal anti-GAPDH, anti-FLAG M2 and anti-penta-His antibodies were purchased from Ambion, Sigma and Qiagen, respectively.

Recombinant proteins
A series of exportins used in electrophoresis mobility sift assays were synthesized in vitro using pcDNA/hsExp5 or pcDNA/dmExp5 as template. In vitro translation reactions were performed using a rabbit reticulocyte lysate system (Promega) according to the manufacturer's protocol.

The recombinant constitutive active mutants of Ran orthologues were expressed in E.coli BL21 and purified as described previously (35).

Histidine-tagged hsExp5 and dmExp5 were expressed in E.coli M15 (pREP4) and Rosseta cells, respectively, at 20°C. Msn5p was expressed in E.coli M15 (pREP4) at 20°C in 2x YT medium containing 1% glucose. After inducing protein expression, the cells were suspended in a buffer (50 mM Tris–HCl pH 7.5, 700 mM NaCl, 10 mM MgCl2, 5% glycerol, 5 mM ß-mercaptoethanol, 10 mM imidazol) and disrupted by sonication. The Exp5 orthologues were purified from soluble supernatants by chromatography on Ni-NTA agarose (Qiagen) followed by a MonoQ (GE Healthcare) FPLC column. The purified Exp5 orthologues were equilibrated with injection buffer (20 mM HEPES–KOH pH 7.5, 110 mM potassium acetate, 2 mM magnesium acetate, 10 mM NaCl) by passing through PD-10 gel filtration columns (GE Healthcare). Histidine-tagged hsExp-t was expressed in E.coli XL1 Blue at 37°C in LB medium. The cells were disrupted by sonication and purified by Ni-NTA agarose column chromatography. Histidine-tagged Exp1 was obtained using the same procedure except that the expression was induced at 20°C. CAS and Exp1 were expressed as glutathione S-transferase (GST)-tagged fusion proteins and purified by glutathione Sepharose column chromatography according to the manufacture's protocol. The GST moieties of the fusion proteins were removed by PreScission protease (GE healthcare) digestion. These proteins were equilibrated with the injection buffer as described above.

Electrophoresis mobility shift assay
The radio-labeled pre-miR-30 RNA probe (10 000 c.p.m.) and 4.5 µl of reticulocyte lysate (TNT Quick Coupled Transcription/translation systems, Promega) containing in vitro translated hsExp5 or dmExp5 were mixed and incubated in the presence or absence of 2 µM constitutive active mutants of Ran orthologues from cognate species. The binding reactions (final volume of 10 µl) were performed in binding buffer (20 mM HEPES–KOH pH 8.0, 150 mM NaCl, 1 mM MgCl2, 10% glycerol, 0.5 mM dithiothreitol,) containing 2 units of RNasin (Promega). For competition assays, 70 nM (for hsExp5 and dmExp5) or 210 nM (for Msn5p) of the recombinant exportins were incubated in binding buffer containing 2 µM of each Ran mutant in a final volume of 10 µl. After incubation for 10 min at room temperature, 2 µl of Blue/Orange 6x loading dye (Promega) was added to these reaction mixtures and the mixture was then applied to 6% non-denaturing polyacrylamide gels. Electrophoresis was carried out at a constant voltage of 10 V/cm at room temperature in 0.5x TBE buffer. RNA–protein complexes were visualized by autoradiography.

In Figure 3C, a RNA-containing fraction was prepared by treating the reticulocyte lysate with proteinase K (Nakalai) followed by phenol/chloroform extraction and ethanol precipitation.

Purified baker's yeast tRNA-phe was purchased from Sigma. For generation of a dsRNA having a 3' or 5' overhanging at one end, two RNA oligonucleotides 5'-GGGCUUUCAGUCGGAUGUUUGCAGC-3' or 5'-GGGCUUUCAGUCGGAUGUUUG-3' and 5'-UGCAAACAUCCGACUGAAAGC-3' were mixed in annealing buffer (100 mM potassium acetate, 30 mM HEPES–KOH pH 7.4, 2 mM magnesium acetate), denatured at 90°C for 1 min and annealed by incubating at 37°C for 3 h. The same procedure was used to generate a dsDNA encoding the same sequence as dsRNA. All the oligonucleotides were synthesized in JBIOS Co. Ltd.

The unlabeled pre-miR-30 competitor RNA was generated by the RiboMAX Large Scale RNA Production System-T7 (Promega) according to the manufacture's protocol. The in vitro transcribed dsRNAs were purified, quantified by A260 nm/A280 readings and their integrity was verified by electrophoresis on denaturing polyacrylamide gels.

Immunoprecipitation from rabbit reticulocyte lysate
The anti-penta-His antibody (3.25 µg) immobilized on Protein-G Sepharose beads (GE Healthcare) was preincubated with a mixture of 55 µl of reticulocyte lysate (TNT Quick Coupled Transcription/translation system, Promega) and 0.2 µM of each recombinant exportin in the presence or absence of 1.8 µM of the Ran mutant for 30 min at 4°C. After 3 h at 4°C, the beads were washed three times with binding buffer [50 mM Tris–HCl pH 7.5, 1 mM Mg(AcO)2, 100 mM KOAc]. For the detection of bound proteins by western blot using the anti-penta-His antibody, the bound proteins were eluted by boiling the beads (7% of total) in SDS sample buffer. The remaining sample was treated with proteinase K for 30 min at 50°C, followed by phenol/chloroform extraction and ethanol precipitation to isolate the co-precipitated RNAs. The RNAs were separated on 6% denaturing polyacrylamide gels and detected by ethidium bromide staining.

RNAi experiments
Preparation of dsRNAs
Templates for GFP, dmExp5, DGCR8 and dmDrosha dsRNAs were amplified by PCR using following primers, GFP/dsRNA: sense primer nt 1–24 and anti-sense primer nt 677–700 of GFP cDNA; dmExp5/dsRNA: sense primer nt 1–24 and anti-sense primer nt 677–700 of dmExp5 cDNA; DGCR8/dsRNA: sense primer nt 1–22 and anti-sense primer nt 700–721 of dmDGCR8 cDNA; Drosha/dsRNA: sense primer nt 1–23 and anti-sense primer nt 680–703 of dmDrosha. These primers contain the T7-promoter sequence (GAATTAATACGACTCACTATAGGG) at their 5' ends. The PCR products were purified using a QIAEX II Gel Extraction Kit (Qiagen) and then subjected to a RiboMAX Large Scale RNA Production System-T7. The resulting dsRNAs were ethanol-precipitated, redissolved in annealing buffer. Annealing was accomplished by incubating the RNAs at 65°C for 30 min followed by slow cooling to room temperature. The integrity of each dsRNA was verified by electrophoresis on agarose gels followed by ethidium bromide staining.

Preparation of short interfering RNAs
A short interfering RNA (siRNA) to deplete hsExp5 (siExp5) was prepared as described previously (8). Both the sense [5'-UGUGAGGAGGCAUGCUUGUd(TT)-3'] and anti-sense [5'-ACAAGCAUGCCUCCUCACAd(TT)-3'] RNAs were obtained from Takara. An siRNA against DsRed [sense, 5'-CACCGUGAAGCUGAAGGUGd(TT)-3' and anti-sense, 5'-CACCUUCAGCUUCACGGUGd(TT)-3'] was obtained from Darmacon.

Knockdown in Drosophila S2 cells
Treatment of S2 cells with dsRNA was performed as described previously (36). Briefly, S2 cells were suspended in serum-free Schneider's Drosophila medium at a density of 1 x 106 cells/ml. Aliquots of the cell suspension (1 ml) were seeded on six-well culture plates and a final concentration of 74 or 111 nM of each dsRNA was then added. After incubation for 6 h at 28°C, 2 ml of serum-containing Schneider's Drosophila medium was added and the cells were further incubated for 3 or 4 days prior to analysis. For the 6 day incubation protocol, an additional dsRNA treatment was performed as above at 3 days after the initial treatment. For complementation studies in S2/hsExp5 cells, the expression of hsExp5 was induced by the addition of CuSO4 to the medium at a final concentration of 500 µM after treatment of the cells with dsRNAs for 24 h. After incubation, the cells were harvested and subjected to total RNA extraction with the TRIzol reagent (Invitrogen) or total protein extraction by boiling in SDS–PAGE sample buffer.

Knockdown in 293F cells
293F cells in six-well culture plates at ~40% confluecy were transfected with siExp5 or siDsRed at a final concentration of 30 µM by Lipofectamine2000 (Invitrogen). At 24 h after the initial siRNA treatment, the second transfection was performed by the same procedure. At 72 h after the initial transfection, the cells were harvested. Total RNA and protein samples were isolated as above.

Northern blot and RT–PCR analysis
For the northern blot, 10 µg of total RNAs were applied to 15% denaturing polyacrylamide gels, electrophoresed and transferred to Hybond-N+ membranes (GE Healthcare). Hybridization was performed for 2 h at 46°C using the PerfectHyb Hybridization Solution (TOYOBO). The following radio-labeled oligonucleotide probes were used. Human let-7a: 5'-AACTATACAACCTACTACCTCA-3'; tRNA-Met: 5'-CAGCACGCTTCCGCTGCGCCACTCT-3'; tRNA-Ser: 5'-ATCGCCTTAACCACTCGGCCACG-3'; fly miR-2: 5'-GCTCCTCAAAGCTGGCTGTGATA-3'; U6 snRNA: 5'-GGCCATGCTAATCTTCTCTGTA-3'; and fly U1 snRNA: 5'-GTTAACCTCTACGCCAGGTAAGT-3'. For RT–PCR analysis, the first strand cDNAs were synthesized with SuperScript III Reverse Transcriptase (Invitrogen) using oligo(dT)20 primer according to manufacture's instruction. PCR were carried out using Taq DNA polymerase and the following primer sets were used. For dmExp5: forward primer, 5'-AATGGACGAGAACAAGGCCG-3', and reverse primer, 5'-CACTTCTCCGGCCCAAAGAG-3'; for GAPDH:forward primer, 5'-CAGAAGACCGTCGACGGTCC-3', and reverse primer, 5'-AGTCCTTGCTCTGCATATAC-3'; for dmDrosha: forward primer, 5'-GCCGAAATATGCCGTGTATG-3', and reverse primer, 5'-TCATCCCAGCGAAGATTTTGAAG-3'; for dmDGCR8: forward primer, 5'-AAAACGCAGCCACGCCTTAC-3', and reverse primer, 5'-TCAAAGTTCCACGTTGTTCAAA-3'. The PCR products were electrophoresed in 1% agarose gels and visualized by ethidium bromide staining. Contamination of genomic DNA was checked by performing RT–PCR without reverse transcription step (data not shown).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Double-stranded RNA binding abilities are conserved features of the Exp5 orthologues
Although it has been recently demonstrated that hsExp5 functions as an exportin for pre-miRNAs and is able to bind them in vitro, the issue of whether the abilities of Exp5 orthologues to recognize the RNA cargoes are evolutionarily conserved remains unknown. Therefore, the binding of bacterially expressed hsExp5, dmExp5 and Msn5p (Figure 1A) to pre-miRNA was first examined by an electrophoresis mobility shift assay (EMSA), in which in vitro transcribed radio-labeled human pre-miR-30 was used as a probe. The labeled pre-miR-30 probe was efficiently exported from Xenopus oocyte nuclei (data not shown), indicating that this probe is functional. Since exportins require Ran-GTP for forming a stable complex with their cargoes, purified RanQ69L-GTP and its orthologous mutants from cognate species, which are deficient in GTP hydrolysis, were added exogenously. We observed that hsExp5 and dmExp5 efficiently bound pre-miR-30 (Figure 1B, hsExp5: lanes 1–5; dmExp5: lanes 6–10), whereas Msn5p exhibited only weak, but still significant binding to pre-miR-30 (Figure 1B, lanes 11–15). The binding of the Exp5 orthologues to pre-miRNA was specific, since it was Ran-dependent (Figure 2A, lanes 1, 15 and 29) and no interaction between pre-miR-30 and CAS or Exp1, which are exportins for importin-{alpha} or leucine-rich NES-containing proteins, was detected irrespective of the presence of Ran-GTP (Figure 1B, lanes 16–19).


Figure 1
View larger version (56K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1 In vitro binding of the Exp5 orthologues to miRNA (A) The exportins indicated in each lane were expressed in E.coli and purified as indicated in Materials and Methods. After separation by SDS–PAGE, they were visualized by Coomassie blue staining. The positions of molecular weight markers are indicated in the left in kilo Daltons. (B) Binding of purified recombinant hsExp5 (lanes 1–5), dmExp5 (lanes 6–10) or Msn5p (lanes 11–15) to pre-miRNA was examined by EMSA. In the presence of 2 µM of hsRanQ69L-GTP (lanes 1– 5, 16, 18) or its orthologous mutants from cognate species (dmRanQ69L-GTP, lanes 6–10; yeast gsp1pQ71L-GTP, lanes 11–15), 0.07 (lanes 1, 6 and 11), 0.35 (lanes 2, 7 and 12), 0.7 (lanes 3, 8 and 13), 3.5 (lanes 4, 9 and14) and 7 (lanes 5, 10 and 15) pmol of each exportin was mixed up with radio-labeled pre-miR-30 probe. The migration of the probe was visualized by 6% non-denaturing PAGE followed by autoradiography. The positions of free and bound probe are indicated on the right. Purified Exp1 (lanes 16 and 17) and CAS (lanes 18 and 19) (7 pmol each) were also subjected to binding reactions as described above in the presence (+) (lanes 16 and 18) or absence (–) (lanes 17 and 19) of hsRanQ69L-GTP.

 


Figure 2
View larger version (57K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2 Binding specificities of the Exp5 orthologues. (A) Interaction between radio-labeled pre-miR-30 and hsExp5 (0.07 µM, lanes 1–14), dmExp5 (0.07 µM, lanes 15–28) or Msn5p (0.21 µM, lanes 29–42) in the presence (lanes 2–14, 16–28 and 30–42) or absence (lanes 1, 15 and 29) of hsRanQ69L-GTP or its orthologous mutants from cognate species was tested as in Figure 1. The binding reactions were performed in the presence of 0.5, 1, 2.5 or 5 pmol of the indicated competitors (unlabeled pre-miRNA, lanes 3–6, 17–20, 31–34; unlabeled dsDNA, lanes 7–10, 21–24, 35–38; unlabeled dsRNA, lanes 11–14, 25–28, 39–42). (B) Radio-activities co-migrating with the shifted bands were quantified using a phosphorimager. The values obtained without competitors were arbitrary set at 100 and those obtained with the indicated amounts of each competitor were calculated. Data are represented by means + SD of three independent experiments. (C) The binding of hsExp5 (lanes 1–3) or Msn5p (lanes 4–6) to radio-labeled pre-miR-30 is competed by 2.5 pmol of dsRNAs with the 5' (lanes 2 and 5) or 3' (lanes 3 and 6) protruding ends. The structures of dsRNAs are schematically indicated below the panel. In lanes 1 and 4, the binding reactions were performed without the unlabeled competitors. Arrows indicate the positions of free and bound probe.

 
To further examine the specificity of the interactions between the Exp5 orthologues and pre-miRNA observed in Figure 1B, competition experiments were performed. Figure 2A indicates that unlabeled pre-miR-30 competed with labeled pre-miR-30 for binding to dmExp5 in a dose-dependent manner and as efficiently as that of hsExp5 (see also Figure 2B for quantitative data). From these data, we conclude that both hsExp5 and dmExp5 bind pre-miR-30 with similar efficiency.

On the other hand, as expected from the result shown in Figure 1B, unlabeled pre-miR-30 was a weak competitor for the binding of Msn5p to pre-miR-30. In contrast, we found that the interactions of all of the Exp5 orthologues to pre-miR-30 were efficiently inhibited by a 22 bp double-stranded (ds) RNA with a 2 nt overhang at the 3'-end (Figure 2A, lanes 11–14, 25–28 and 39–40), but not by a dsDNA encoding the same sequence (Figure 2A, lanes 7–10, 21–24 and 35–38). Interestingly, the binding of Msn5p to pre-miR-30, but not those of hsExp5 and dmExp5, was more efficiently competed with the shorter 22 bp dsRNA than with the miRNA precursor (Figure 2A, compare lanes 30–34 with lanes 39–42). To determine whether Msn5p recognizes the terminal structure of the dsRNA as a binding site, the inhibitory activity of another dsRNA that had the same sequence at double-stranded region with a 2 nt overhang at the 5' end was tested (Figure 2C, bottom). The interaction between pre-miR-30 and hsExp5 or Msn5p was competed by the dsRNA with 3' overhang, but not by that with 5' overhang (Figure 2C, top). These results indicate that Msn5p specifically recognizes the terminal structure of the short dsRNA as reported for mammalian Exp5 (8,12). Thus, we conclude that the RNA binding activities of the Exp5 orthologues are evolutionary conserved from humans to budding yeast, but that there are significant differences in their substrate preferences.

dmExp5 binds tRNAs more strongly than does hsExp5
We next attempted to confirm the binding between labeled pre-miR-30 and Exp5 using in vitro translated proteins by a rabbit reticulocyte lysate (Figure 3A, left panel). As shown in Figure 3A right panel, lane 2, a retard band containing hsExp5 and pre-miR-30 was clearly observed. However, we found that in vitro translated dmExp5 did not bind pre-miR-30 under the same binding conditions (Figure 3A, right panel, lane 4). The same result was obtained when the bacterially expressed recombinant dmExp5 was incubated with pre-miR-30 in the presence of a rabbit reticulocyte lysate (Figure 3B, lane 3). These results raise the possibility that the reticulocyte lysate contains an activity that inhibits the binding between pre-miR-30 and dmExp5. Since the rabbit reticulocyte lysate contains a large amount of RNAs, including tRNAs, we explored the issue of whether the RNA fraction extracted from the reticulocyte lysate inhibits the binding between dmExp5 and pre-miR-30. As shown in Figure 3C, dmExp5 did not bind pre-miR-30 in the presence of the RNA fraction (compare lane 3 with 4). On the other hand, the binding of hsExp5 to pre-miRNA was unaffected under the same conditions (Figure 3B, lane 1 and 3C, lane 1).


Figure 3
View larger version (58K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3 tRNA is a potent inhibitor of the interaction between pre-miR-30 and dmExp5. (A) In vitro translated hsExp5, but not dmExp5, bound pre-miR-30. Left panel: Expression of FLAG-tagged hsExp5 (lane 2) and dmExp5 (lane 3) using an in vitro translation system was confirmed by western blot using anti-FLAG antibody. In lane 1 (mock), an in vitro translation reaction programmed with an empty vector was loaded. Right panel: In vitro translated hsExp5 or dmExp5 as indicated in the left panel was mixed with radio-labeled pre-miR-30 in the presence (+, lanes 2, 4 and 6) or absence (–, lanes 3, 5 and 7) of hsRanQ69L-GTP (lanes 2 and 6) or dmRanQ69L-GTP (lane 4). The RNA–protein complex was detected by EMSA. In lane 1, radio-labeled pre-miR-30 alone was loaded. Arrows indicate the positions of bound and free probe. (B) Bacterially expressed recombinant dmExp5 failed to bind pre-miR-30 in the presence of a reticulocyte lysate. Bacterially expressed recombinant hsExp5 (lanes 1 and 2) or dmExp5 (lanes 3 and 4) along with RanQ69L-GTP were mixed with radio-labeled pre-miR-30 in the presence (indicated by +, lanes 1 and 3) or absence (indicated by –, lanes 2 and 4) of a reticulocyte lysate. The RNA-protein complexes were detected by EMSA. Arrows indicate the positions of bound and free probe. A quantification of the shifted bands was done by using a phosphor imager. The values obtained without the competitor were arbitrary set at 1 and those obtained with the competitor were calculated. The data are indicated below each lane. (C) The binding of dmExp5 to pre-miR-30 was inhibited by RNAs extracted from reticulocyte lysate. Bacterially expressed recombinant hsExp5 (lanes 1 and 2) or dmExp5 (lanes 3 and 4) along with RanQ69L-GTP were mixed with radio-labeled pre-miR-30 in the presence (lanes 1 and 3) or absence (lanes 2 and 4) of an RNA fraction isolated from reticulocyte lysate. The RNA–protein complexes were detected by EMSA. Arrows indicate the positions of bound and free probe. A quantification of the shifted bands was done as in (B). The data are indicated below each lane. (D) Co-immunoprecipitation of tRNAs with exportins. Bacterially expressed recombinant exportins indicated in each lane were mixed with a rabbit reticulocyte lysate in the presence (+) or absence (–) of RanQ69L-GTP or its orthologous mutants from cognate species. After immunoprecipitation with anti-pentaHis antibody-bound Protein G Sepharose, co-precipitated RNAs were extracted from the immunepellets and analyzed by denaturing PAGE followed by ethidium bromide staining (lower panel). Background binding was also examined in the absence of exportins (mock). Co-precipitated proteins were also detected by western blot using an anti-pentaHis antibody (upper panel). Ten percent of input was loaded on the left most lane (total). The amounts of the precipitated exportins and tRNAs in the presence of Ran-GTP were determined by densitometric scanning of the blot and the gel. The relative amounts of co-precipitated tRNAs, which are normalized to the amounts of each exportin, are indicated below the panel.

 
To identify RNAs that cause the inhibition of binding between dmExp5 and pre-miR-30, dmExp5 expressed in E.coli as a histidine-tagged fusion protein (Figure 1B) was mixed with the rabbit reticulocyte lysate and immunoprecipitated with an anti-penta-His antibody. The co-precipitated RNAs were visualized by denaturing acrylamide gel electrophoresis followed by ethidium bromide staining. The bacterially expressed recombinant dmExp5 immunoprecipitated tRNAs only in the presence of dmRanQ69L-GTP (Figure 3D). Although the ability to bind tRNAs is conserved among the Exp5 orthologues from different species, we noticed that dmExp5 was able to immunoprecipitate the greatest amount of tRNAs among them. On the other hand, exportin-1 (Exp1) did not bind tRNAs at all.

To directly confirm that tRNAs actually inhibit the binding of dmExp5 to pre-miR-30, competition experiments were performed. Purified tRNA-Phe from baker's yeast inhibited dmExp5 from interacting with pre-miR-30 in a dose-dependent manner (Figure 4, upper panel, lanes 2–5), whereas negligible competition was found for binding between pre-miR-30 and hsExp5 (Figure 4, upper panel, lanes 10–14). Only a marginal effect was observed when U1{Delta}smRNA was used as a competitor (Figure 4, upper panel, lanes 6–9). From these results, we conclude that dmExp5 preferentially binds to tRNA compared with hsExp5.


Figure 4
View larger version (58K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4 dmExp5 binds tRNA more preferentially than hsExp5. Upper panel: Bacterially expressed dmExp5 (lanes 1–9) or hsExp5 (lanes 10–14) were mixed with radio-labeled pre-miR-30 and RanQ69L-GTP orthologues from cognate species in the absence (lanes 1 and 10) or presence of 5 pmol (lanes 2, 6 and 11), 10 pmol (lanes 3, 7 and 12), 25 pmol (lanes 4, 8 and 13) or 50 pmol (lanes 5, 9 and 14) of indicated competitor RNAs. Protein–RNA complexes were detected by EMSA. Arrows indicate the positions of bound and free probe. Lower panel: Binding efficiency was calculated as in Figure 2B. Data are represented by means + SD of three independent experiments. Note that the concentrations of competitor RNAs were 10 times higher than those in Figure 2.

 
Knockdown of dmExp5 in Drosophila S2 cells decreases the amounts of tRNA and miRNA
Having established that dmExp5 fulfils the functional characteristics as an exportin for both miRNA and tRNA, we then examined whether dmExp5 functions as a sole exportin for both tRNAs and miRNAs in Drosophila cells. For this, we inactivated dmExp5 by RNAi-mediated gene silencing and measured the amounts of mature tRNA and miRNA, which we took for an indirect indication for their export defect as reported previously (8,9,32). As shown in Figure 5, the knockdown of dmExp5 in Drosophila S2 cells was confirmed by RT–PCR (Figure 5B, left panels). A significant decrease in tRNA-Met and tRNA-Ser as well as miR-2 levels was observed by the knockdown of dmExp5 (Figure 5B, right panels). On the contrary, upon depletion of hsExp5 in 293F cells, which was confirmed by a western blot (Figure 5A, left panels), the amounts of tRNA-Met and tRNA-Ser remained unaffected, whereas a significant decrease in mature let-7a was observed (Figure 5A, right panels) as reported previously (9). In both experiments, the amounts of U6 snRNA and U1 snRNA were not altered. In addition, as shown in Figure 5C, depletion of dmDGCR8 or dmDrosha (left panels), which are known components of the nuclear pri-miRNA processing complex, led to a significant decrease in the amount of mature miR-2. However, only marginal effects in tRNA levels were observed in these cells (Figure 5C, lanes 3 and 4). These findings exclude the possibility that the repression of tRNA caused by the depletion of dmExp5 in S2 cells was a secondary effect due to the loss of miRNA function. From these results, we conclude that dmExp5 plays important roles, not only in miRNA expression, but also in tRNA expression in vivo.


Figure 5
View larger version (42K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5 Knockdown of Exp5 in human and Drosophila cultured cells. (A) Let-7a, but not tRNAs, was depleted upon the knock down of hsExp5. Left panels: Human 293F cells were treated with siRNA against DsRed (DsRedi, which was used as a negative control) or hsExp5 (hsExp5i) for three days. The expression of hsExp5 in the cells was confirmed by western blot using anti-hsExp5 antibody (upper panel). The expression of GAPDH was detected as a control (lower panel). Right panels: Total RNAs were extracted from the siRNA treated cells. Northern blot analysis was performed using specific probes indicated on the right of each panel. The signal intensities were quantified by a phosphorimager and normalized by those of U6 snRNA. The relative expression level of each RNA was indicated below each panel. (B) Both miR-2 and tRNA were depleted upon dmExp5 knockdown. Left panels: Drosophila S2 cells were treated with 74 nM of the indicated dsRNA. Total RNAs were isolated 6 days later. GFP/dsRNA was used as a negative control. Expression of dmExp5 and GAPDH was confirmed by RT–PCR (upper panel). The amount of dmExp5 mRNA but not that of GAPDH was decreased upon dmExp5 depletion (lower panel). Right panels: Northern blot analysis was performed as in (A). Both miR-2 and tRNA levels were decreased by dmExp5 knockdown. (C) The amount of tRNAs was unaffected when miRNA processing factors were depleted. Left panels: S2 cells were treated with the indicated dsRNAs for four days. The knockdown of the expression of each mRNA was confirmed by RT–PCR. Right panels: Northern blot analysis was performed as in (A). Decrease in tRNA-Ser level was observed only when dmExp5 was knocked down.

 
To further test if the observed effects by dmExp5 depletion could be rescued by hsExp5, complementation experiments were performed using S2 cells stably expressing FLAG-tagged hsExp5 (S2/hsExp5). S2 cells stably transfected with an empty vector (S2/Emp) served as a negative control. The knockdown of dmExp5 was checked by RT–PCR (Figure 6A, upper and middle panels), while the expression of hsExp5 was confirmed by western blot using an anti-FLAG antibody (Figure 6A, lower panel). In the S2/Emp, the amounts of miR-2 and tRNA-Ser decreased to 34 and 66% of the control level, respectively (lane 2 of Figure 6B top and middle panels). In contrast, when RNAi against dmExp5 was performed in S2/hsExp5, the amount of miR-2 decreased but to a much lower extent (68% of the control cells) (Figure 6B, top panel, right most lane), indicating that exogenously expressed hsExp5 significantly rescued the expression of pre-miRNA. In the same cells, the expression of tRNA-Ser was not rescued so efficiently (Figure 6B, middle panel). Unfortunately, a direct comparison between hsExp5 and hsExp-t could not be done, since we failed to obtain stable transformants of S2 cells that express sufficient amounts of hsExp-t (data not shown). These results indicate that the activity of dmExp5 is at least partially substituted by the expression of hsExp5 and that dmExp5 and hsExp5 are distinctly involved in the expression of pre-miRNA and tRNA.


Figure 6
View larger version (67K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6 The repression of miRNA and tRNA levels induced by knockdown of dmExp5 was restored by overexpression of hsExp5. S2/hsExp5, a S2 cell derivative stably expressing hsExp5, was treated with 111 nM of the indicated dsRNAs as described in Figure 6B. S2/Emp, which harbors an empty vector, was used as a negative control. CuSO4 was added to the culture media 24 h after dsRNA treatment (see Materials and Methods). (A) Depletion of dmExp5 was confirmed by RT–PCR (upper and middle panels). Expression of hsExp5 was confirmed by western blot using anti-FLAG M2 antibody (lower panel). (B) Northern blot analysis was performed as described in Figure 6A. The repression of miRNA and tRNA induced by knockdown of dmExp5 was partially restored by the expression of hsExp5.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, three Exp5 orthologues from different species were extensively characterized. We found that, although the dsRNA binding abilities are well conserved from the budding yeast to human orthologues, certain differences exist in their optimal substrates. Msn5p binds the shorter dsRNA more efficiently than the longer hairpin like RNA (e.g. pre-miR-30), which was found to be the optimal substrate for human and fruit fly Exp5 by others as well as ourselves. In addition, recent studies have shown that, in plant Arabidopsis, miRNAs are detected as fully matured ~22 nt single stranded RNAs in both the nuclear and cytoplasmic fractions (32,37), indicating that HASTY, the Arabidopsis Exp5 orthologue, likely recognizes such short RNAs as cargoes (32). HASTY might inherit the observed substrate preference of yeast Msn5p, leading to the recognition of ~22 nt duplex RNAs as cargoes. These results suggest that the Exp5 orthologues have evolved different modes of substrate recognition to play different functional roles.

In vertebrates and plants, Exp5 is thought to act as a major exportin for pre-miRNAs and to play a minor role in the nuclear export of tRNAs. Consistent with this, we found that hsExp5 bound pre-miRNAs more efficiently than tRNAs and that the depletion of hsExp5 in human cells resulted in defects in miRNA but not in tRNA expression. On the other hand, it was reported that a decrease in tRNA levels, but not in miRNA levels, was observed in the Arabidopsis HASTY mutant, whereas the PAUSED mutation, which is the Exp-t orthologue of Arabidopsis, interfered with tRNA-Tyr processing without obvious effects on miRNA levels (32). In contrast, a previous report indicated that Drosophila does not posses an apparent orthologue of Exp-t (33). Despite repeated efforts, we also failed to identify the Exp-t gene in the Apis mellifera and Anopheles gambiae genomes. On the other hand, a putative Exp-t orthologue, designated as importin-ß family 6 (Imb-6; GenBank accession NM_068919 [GenBank] ), was identified in the C. elegans genome. Thus, we speculate that the Exp-t gene might have been lost when the coelomata diverged from the bilateria. Instead, the following experimental evidence supports the notion that dmExp5 may have evolved as a substitute for the Exp-t function in such organisms. We demonstrated here that the depletion of dmExp5 in S2 cells induced the down regulation of both miRNAs and tRNAs and that dmExp5 binds tRNA with a higher affinity than hsExp5. From these results, we conclude that dmExp5, different from the other Exp5 orthologues, functions as a major export factor in the nuclear export of tRNAs as well as miRNAs in the fruit fly.

In budding yeast cells, Msn5p is known to be involved in the nuclear export of both tRNAs and a subset of proteins. Our in vitro binding data indicate that Msn5p is able to directly recognize RNAs. On the other hand, NESs of the protein cargoes recognized by Msn5p still remain unknown (1318). Does Msn5p recognize both peptide sequences (or protein structure) and RNAs directly? As far as we know, there is no precedent for such a dual specificity in the importin-ß family proteins. What common structural feature(s) in the different cargoes, then, can be recognized as NES by Msn5p? Of note in this context are the recent reports showing that, in mammalian cells JAZ and Staufen, dsRNA binding proteins involved in mRNA metabolism, are indirectly recognized by Exp5 via their affinities to small dsRNAs (38,39). To recognize the protein cargoes, mammalian Exp5 exploits dsRNAs as bridging factors. In yeast, Crz1p, which is functionally homologous to NFATs derived from higher eukaryotes, was reported to be exported by Msn5p (14). Because it was recently demonstrated that an ncRNA is involved in the nuclear localization of mammalian NFATs (40,41), it is conceivable that NFATs have the ability to bind directly or indirectly RNAs. Therefore, it would be very tempting to speculate that Msn5p, via its affinity to small dsRNAs, indirectly recognizes the protein cargoes. Recent genome wide transcription profiling studies suggest that a large proportion of the genome including intergenic regions, is transcribed in both directions in various organisms. These observations indicate that the expression of non-coding RNAs and possibly dsRNAs is more widespread in eukaryotic cells than has ever been expected (4244). Further experiments will be required to determine whether such bridging dsRNAs do exist.


    ACKNOWLEDGEMENTS
 
We thank Drs Mutsuhito Ohno (Kyoto University) and Tohru Yoshihisa (Nagoya University) for providing various plasmids. This work was supported, in part, by grants from the Japanese Ministry of Education, Culture, Sports, Science and Technology and the Human Frontier Science Program. Funding to pay the Open Access publication charges for this article was provided by Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT).

Conflict of interest statement. None declared.


    Footnotes
 
*Correspondence may also be addressed to Jun Katahira. Tel: +81 6 6879 4606; Fax: +81 6 6879 4609; Email: katahira{at}anat3.med.osaka-u.ac.jp

Present address: Akira Shimamoto, Department of Cellular and Molecular Biology, Division of Integrated Medical Science, Program for Biomedical Research, Graduate School of Biomedical Sciences, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553, Japan

The history dates have been corrected.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Chook, Y.M. and Blobel, G. (2001) Karyopherins and nuclear import Curr. Opin. Struct. Biol, . 11, 703–715[CrossRef][Web of Science][Medline] .

  2. Kuersten, S., Ohno, M., Mattaj, I.W. (2001) Nucleocytoplasmic transport: Ran, beta and beyond Trends Cell Biol, . 11, 497–503[CrossRef][Web of Science][Medline] .

  3. Quimby, B.B. and Corbett, A.H. (2001) Nuclear transport mechanisms Cell Mol. Life Sci, . 58, 1766–1773[CrossRef][Web of Science][Medline] .

  4. Weis, K. (2002) Nucleocytoplasmic transport: cargo trafficking across the border Curr. Opin. Cell Biol, . 14, 328–335[CrossRef][Web of Science][Medline] .

  5. Izaurralde, E., Kutay, U., von Kobbe, C., Mattaj, I.W., Gorlich, D. (1997) The asymmetric distribution of the constituents of the Ran system is essential for transport into and out of the nucleus EMBO J, . 16, 6535–6547[CrossRef][Web of Science][Medline] .

  6. Yoneda, Y., Hieda, M., Nagoshi, E., Miyamoto, Y. (1999) Nucleocytoplasmic protein transport and recycling of Ran Cell Struct. Funct, . 24, 425–433[CrossRef][Web of Science][Medline] .

  7. Bohnsack, M.T., Czaplinski, K., Gorlich, D. (2004) Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs RNA, 10, 185–191[Abstract/Free Full Text] .

  8. Lund, E., Guttinger, S., Calado, A., Dahlberg, J.E., Kutay, U. (2004) Nuclear export of microRNA precursors Science, 303, 95–98[Abstract/Free Full Text] .

  9. Yi, R., Qin, Y., Macara, I.G., Cullen, B.R. (2003) Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs Genes Dev, . 17, 3011–3016[Abstract/Free Full Text] .

  10. Gwizdek, C., Ossareh-Nazari, B., Brownawell, A.M., Evers, S., Macara, I.G., Dargemont, C. (2004) Minihelix-containing RNAs mediate exportin-5-dependent nuclear export of the double-stranded RNA-binding protein ILF3 J. Biol. Chem, . 279, 884–891[Abstract/Free Full Text] .

  11. Gwizdek, C., Ossareh-Nazari, B., Brownawell, A.M., Doglio, A., Bertrand, E., Macara, I.G., Dargemont, C. (2003) Exportin-5 mediates nuclear export of minihelix-containing RNAs J. Biol. Chem, . 278, 5505–5508[Abstract/Free Full Text] .

  12. Zeng, Y. and Cullen, B.R. (2004) Structural requirements for pre-microRNA binding and nuclear export by Exportin 5 Nucleic Acids Res, . 32, 4776–4785[Abstract/Free Full Text] .

  13. Blondel, M., Alepuz, P.M., Huang, L.S., Shaham, S., Ammerer, G., Peter, M. (1999) Nuclear export of Far1p in response to pheromones requires the export receptor Msn5p/Ste21p Genes Dev, . 13, 2284–2300[Abstract/Free Full Text] .

  14. Boustany, L.M. and Cyert, M.S. (2002) Calcineurin-dependent regulation of Crz1p nuclear export requires Msn5p and a conserved calcineurin docking site Genes Dev, . 16, 608–619[Abstract/Free Full Text] .

  15. DeVit, M.J. and Johnston, M. (1999) The nuclear exportin Msn5 is required for nuclear export of the Mig1 glucose repressor of Saccharomyces cerevisiae Curr. Biol, . 9, 1231–1241[CrossRef][Web of Science][Medline] .

  16. Kaffman, A., Rank, N.M., O'Neill, E.M., Huang, L.S., O'Shea, E.K. (1998) The receptor Msn5 exports the phosphorylated transcription factor Pho4 out of the nucleus Nature, 396, 482–486[CrossRef][Medline] .

  17. Queralt, E. and Igual, J.C. (2003) Cell cycle activation of the Swi6p transcription factor is linked to nucleocytoplasmic shuttling Mol. Cell. Biol, . 23, 3126–3140[Abstract/Free Full Text] .

  18. Yoshida, K. and Blobel, G. (2001) The karyopherin Kap142p/Msn5p mediates nuclear import and nuclear export of different cargo proteins J. Cell Biol, . 152, 729–740[Abstract/Free Full Text] .

  19. Takano, A., Endo, T., Yoshihisa, T. (2005) tRNA actively shuttles between the nucleus and cytosol in yeast Science, 309, 140–142[Abstract/Free Full Text] .

  20. Arts, G.J., Kuersten, S., Romby, P., Ehresmann, B., Mattaj, I.W. (1998) The role of exportin-t in selective nuclear export of mature tRNAs EMBO J, . 17, 7430–7441[CrossRef][Web of Science][Medline] .

  21. Arts, G.J., Fornerod, M., Mattaj, I.W. (1998) Identification of a nuclear export receptor for tRNA Curr. Biol, . 8, 305–314[CrossRef][Web of Science][Medline] .

  22. Kutay, U., Lipowsky, G., Izaurralde, E., Bischoff, F.R., Schwarzmaier, P., Hartmann, E., Gorlich, D. (1998) Identification of a tRNA-specific nuclear export receptor Mol. Cell, 1, 359–369[CrossRef][Web of Science][Medline] .

  23. Lipowsky, G., Bischoff, F.R., Izaurralde, E., Kutay, U., Schafer, S., Gross, H.J., Beier, H., Gorlich, D. (1999) Coordination of tRNA nuclear export with processing of tRNA RNA, 5, 539–549[Abstract] .

  24. Hellmuth, K., Lau, D.M., Bischoff, F.R., Kunzler, M., Hurt, E., Simos, G. (1998) Yeast Los1p has properties of an exportin-like nucleocytoplasmic transport factor for tRNA Mol. Cell. Biol, . 18, 6374–6386[Abstract/Free Full Text] .

  25. Sarkar, S. and Hopper, A.K. (1998) tRNA nuclear export in Saccharomyces cerevisiae: in situ hybridization analysis Mol. Biol. Cell, 9, 3041–3055[Abstract/Free Full Text] .

  26. Grosshans, H., Hurt, E., Simos, G. (2000) An aminoacylation-dependent nuclear tRNA export pathway in yeast Genes Dev, . 14, 830–840[Abstract/Free Full Text] .

  27. Calado, A., Treichel, N., Muller, E.C., Otto, A., Kutay, U. (2002) Exportin-5-mediated nuclear export of eukaryotic elongation factor 1A and tRNA EMBO J, . 21, 6216–6224[CrossRef][Web of Science][Medline] .

  28. Bohnsack, M.T., Regener, K., Schwappach, B., Saffrich, R., Paraskeva, E., Hartmann, E., Gorlich, D. (2002) Exp5 exports eEF1A via tRNA from nuclei and synergizes with other transport pathways to confine translation to the cytoplasm EMBO J, . 21, 6205–6215[CrossRef][Web of Science][Medline] .

  29. Bollman, K.M., Aukerman, M.J., Park, M.Y., Hunter, C., Berardini, T.Z., Poethig, R.S. (2003) HASTY, the Arabidopsis ortholog of exportin 5/MSN5, regulates phase change and morphogenesis Development, 130, 1493–1504[Abstract/Free Full Text] .

  30. Hunter, C.A., Aukerman, M.J., Sun, H., Fokina, M., Poethig, R.S. (2003) PAUSED encodes the Arabidopsis exportin-t ortholog Plant Physiol, . 132, 2135–2143[Abstract/Free Full Text] .

  31. Li, J. and Chen, X. (2003) PAUSED, a putative exportin-t, acts pleiotropically in Arabidopsis development but is dispensable for viability Plant Physiol, . 132, 1913–1924[Abstract/Free Full Text] .

  32. Park, M.Y., Wu, G., Gonzalez-Sulser, A., Vaucheret, H., Poethig, R.S. (2005) Nuclear processing and export of microRNAs in Arabidopsis Proc. Natl Acad. Sci. USA, 102, 3691–3696[Abstract/Free Full Text] .

  33. Lippai, M., Tirian, L., Boros, I., Mihaly, J., Erdelyi, M., Belecz, I., Mathe, E., Posfai, J., Nagy, A., Udvardy, A., et al. (2000) The Ketel gene encodes a Drosophila homologue of importin-beta Genetics, 156, 1889–1900[Abstract/Free Full Text] .

  34. Kudo, N., Wolff, B., Sekimoto, T., Schreiner, E.P., Yoneda, Y., Yanagida, M., Horinouchi, S., Yoshida, M. (1998) Leptomycin B inhibition of signal-mediated nuclear export by direct binding to CRM1 Exp. Cell Res, . 242, 540–547[CrossRef][Web of Science][Medline] .

  35. Tachibana, T., Hieda, M., Miyamoto, Y., Kose, S., Imamoto, N., Yoneda, Y. (2000) Recycling of importin alpha from the nucleus is suppressed by loss of RCC1 function in living mammalian cells Cell Struct. Funct, . 25, 115–123[CrossRef][Web of Science][Medline] .

  36. Clemens, J.C., Worby, C.A., Simonson-Leff, N., Muda, M., Maehama, T., Hemmings, B.A., Dixon, J.E. (2000) Use of double-stranded RNA interference in Drosophila cell lines to dissect signal transduction pathways Proc. Natl Acad. Sci. USA, 97, 6499–6503[Abstract/Free Full Text] .

  37. Zhang, B., Pan, X., Cannon, C.H., Cobb, G.P., Anderson, T.A. (2006) Conservation and divergence of plant microRNA genes Plant J, . 46, 243–259[CrossRef][Web of Science][Medline] .

  38. Chen, T., Brownawell, A.M., Macara, I.G. (2004) Nucleocytoplasmic shuttling of JAZ, a new cargo protein for exportin-5 Mol. Cell. Biol, . 24, 6608–6619[Abstract/Free Full Text] .

  39. Macchi, P., Brownawell, A.M., Grunewald, B., DesGroseillers, L., Macara, I.G., Kiebler, M.A. (2004) The brain-specific double-stranded RNA-binding protein Staufen2: nucleolar accumulation and isoform-specific exportin-5-dependent export J. Biol. Chem, . 279, 31440–31444[Abstract/Free Full Text] .

  40. Mattick, J.S. (2005) The functional genomics of noncoding RNA Science, 309, 1527–1528[Abstract/Free Full Text] .

  41. Willingham, A.T., Orth, A.P., Batalov, S., Peters, E.C., Wen, B.G., Aza-Blanc, P., Hogenesch, J.B., Schultz, P.G. (2005) A strategy for probing the function of noncoding RNAs finds a repressor of NFAT Science, 309, 1570–1573[Abstract/Free Full Text] .

  42. Okazaki, Y., Furuno, M., Kasukawa, T., Adachi, J., Bono, H., Kondo, S., Nikaido, I., Osato, N., Saito, R., Suzuki, H., et al. (2002) Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs Nature, 420, 563–573[CrossRef][Medline] .

  43. Katayama, S., Tomaru, Y., Kasukawa, T., Waki, K., Nakanishi, M., Nakamura, M., Nishida, H., Yap, C.C., Suzuki, M., Kawai, J., et al. (2005) Antisense transcription in the mammalian transcriptome Science, 309, 1564–1566[Abstract/Free Full Text] .

  44. Carninci, P., Sandelin, A., Lenhard, B., Katayama, S., Shimokawa, K., Ponjavic, J., Semple, C.A., Taylor, M.S., Engstrom, P.G., Frith, M.C., et al. (2006) Genome-wide analysis of mammalian promoter architecture and evolution Nat. Genet, . 38, 626–635[CrossRef][Web of Science][Medline] .


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Print PDF (1881K) Freely available
Right arrow Screen PDF (474K) Freely available
Right arrowOA All Versions of this Article:
34/17/4711    most recent
gkl663v3
gkl663v2
gkl663v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Shibata, S.
Right arrow Articles by Yoneda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shibata, S.
Right arrow Articles by Yoneda, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?