Nucleic Acids Research Advance Access originally published online on December 1, 2006
Nucleic Acids Research 2006 34(22):6684-6695; doi:10.1093/nar/gkl968
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nucleic Acids Research, 2006, Vol. 34, No. 22 6684-6695
© 2006 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Nucleic Acid Enzymes |
Selection and cloning of poly(rC)-binding protein 2 and Raf kinase inhibitor protein RNA activators of 2',5'-oligoadenylate synthetase from prostate cancer cells
1 Department of Chemistry, Cleveland State University Euclid Avenue at East 24th Street, Cleveland, OH 44115, USA 2 Department of Cancer Biology, Lerner Research Institute, Cleveland Clinic 9500 Euclid Avenue, Cleveland, OH 44195, USA 3 Department of Pathology, University of Michigan Medical School 1400 E Medical Center Drive, Ann Arbor, MI 48109, USA 4 Department of Urology, University of Michigan Medical School 1400 E Medical Center Drive, Ann Arbor, MI 48109, USA
*To whom correspondence should be addressed. Tel: +1 216 445 9650; Fax: +1 216 445 6269; Email: silverr{at}ccf.org
Received August 16, 2006. Revised October 9, 2006. Accepted October 16, 2006.
| ABSTRACT |
|---|
|
|
|---|
The antiviral and antitumor functions of RNase L are enabled by binding to the allosteric effectors 5'-phosphorylated, 2',5'-linked oligoadenylates (2-5A). 2-5A is produced by interferon-inducible 2',5'-oligoadenylate synthetases (OAS) upon activation by viral double-stranded RNA (dsRNA). Because mutations in RNase L have been implicated as risk factors for prostate cancer, we sought to determine if OAS activators are present in prostate cancer cells. We show that prostate cancer cell lines (PC3, LNCaP and DU145), but not normal prostate epithelial cells (PrEC), contain RNA fractions capable of binding to and activating OAS. To identify the RNA activators, we developed a cDNA cloning strategy based on stringent affinity of RNAs for OAS. We thus identified mRNAs for Raf kinase inhibitor protein (RKIP) and poly(rC)-binding protein 2 (PCBP2) that bind and potently activate OAS. In addition, human endogenous retrovirus (hERV) envelope RNAs were present in PC3 cells that bind and activate OAS. Analysis of several gene expression profiling studies indicated that PCBP2 RNA was consistently elevated in metastatic prostate cancer. Results suggest that OAS activation may occur in prostate cancer cells in vivo stimulated by cellular mRNAs for RKIP and PCBP2.
| INTRODUCTION |
|---|
|
|
|---|
Interferons (IFNs) are a group of cytokines that confer antiviral and antiproliferative effects by arming the cell with numerous defense mechanisms, including the 2',5'-oligoadenylate synthetase (OAS)/RNase L system (1). Unusual 5'-phosphorylated, 2',5'-oligoadenylates (2-5A) are produced from ATP by IFN-inducible OAS proteins in response to stimulation by dsRNA activators (2,3). To date, all naturally occurring RNA activators of RNase L that have been identified are dsRNA structures of various viral origins (48). RNA activation of OAS precedes and is required for the activation of RNase L. Latent RNase L, present in most mammalian cells, is a monomer lacking ribonuclease activity (9,10). However, upon binding 2-5A, RNase L dimerizes into a potent endoribonuclease that degrades single-stranded regions in viral and cellular RNAs after UpNp dinucleotide sequences (primarily UU and UA), and sequences within the L1 bulge of intact cellular 28S rRNA (1013). The OAS/RNase L pathway is required for a complete innate antiviral response. Accordingly, mice lacking RNase L have a reduced ability to survive infections by any one of several different types of viruses, including Coxsackievirus B4, encephalomyocarditis virus and West Nile virus (1416). Although transient activation of RNase L is compatible with cell survival, sustained activation is not (1720). RNase L activity can result in apoptosis, an outcome that requires the MAP kinase, JNK, and is characterized by cytochrome c release from mitochondria and caspase activation (17,19). Prostate cancer cells deficient in RNase L are highly resistant to apoptosis by the RNase L activator, 2-5A, alone or in combination treatments with a topoisomerase I inhibitor and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) (18). While apoptosis eliminates virus-infected cells, a result consistent with the antiviral activity of RNase L, it can also function as a tumor suppressor mechanism. Interestingly, in several, but not all studies, mutations and variants of RNASEL were correlated with enhanced risk of prostate cancer (2127). For instance, the common variant of RNase L, R462Q, was implicated in up to 13% of unselected prostate cancer cases (22). Recently, we identified a novel gammaretrovirus, XMRV, almost exclusively in prostate tumors homozygous for a reduced activity variant (R462Q) of RNase L (28). Those findings suggested that XMRV is susceptible to the OAS/RNase L pathway, thus providing evidence for an antiviral role of RNase L in humans.
IFN treatment of human cells results in transcription of a cluster of four OAS genes (OAS1, OAS2, OAS3 and OASL) located on chromosome 12q24.2, which encodes 810 latent isoforms of OAS, as a result of alternative splicing (29). Once activated, OAS proteins (excluding OASL), catalyze 2'-specific adenosine nucleotidyl transfer reactions with ATP as a substrate. However, the reason for multiple isoforms of OAS with essentially similar function remains unknown. OAS1 and OAS2 encoded proteins produce predominantly 2-5A trimer and longer oligomers, all of which activate RNase L (30). In contrast, OAS3 encoded proteins produce mostly 2-5A dimer, ppp5'A2'p5'A, which does not activate RNase L (31). Although dsRNAs, such as poly(I):poly(C), are potent activators of OAS, both dsRNA and ssRNA can bind to, and in some instances activate, OAS (32). Activation of OAS was proposed as a two-step process based upon the observation that the binding affinities of different in vitro selected ssRNA aptamers do not correlate with OAS activation potential and the elucidation of the crystal structure of porcine OAS1 (32,33).
Although viral dsRNAs potently activate OAS, IFN treatment by itself inhibits the growth of certain cancer cells, some of which may not be virus infected or may not be dependent on viral infections for cell growth (34). Unidentified nuclear RNA activators of OAS were detected in IFN-sensitive cancer cells but not normal cells, suggesting that these RNAs may play a role in cellular growth arrest (35). The recent identification of RNASEL as a prostate cancer susceptibility gene led us to examine the possible presence of RNA activators of OAS in prostate cancer cells (21). To identify such RNAs, we developed a cDNA cloning strategy based on high affinity of RNA for OAS. These efforts identified two RNA activators of OAS in prostate cancer cells encoding Raf kinase inhibitor protein (RKIP) (36) and poly(rC)-binding protein 2 (PCBP2) (37).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture
Cell lines: LNCaP-FGC (ATCC Catalog no. CRL-1740), DU145 (ATCC Catalog no. HTB-81) and PC3 (ATCC Catalog no. CRL-1435) were grown in RPMI 1640 medium with 2 mM L-glutamine, fetal bovine serum 10%; 100 U/ml penicillin G and 100 µg/ml streptomycin. Normal prostate epithelial cells (PrEC) were obtained from Clonetics Corporation (San Diego, CA) and were maintained in prostate epithelial cell medium (PrEGM) supplemented with a mixture of various growth factors (SingleQuots) (Clonetics); and 10% fetal bovine serum.
Human recombinant OAS1 and RNase L: Escherichia coli (BL21-DE3 Novagen, EMD Biosciences, Inc., USA) was transformed with recombinant human His6-tagged OAS1 p42 cDNA in a modified pET9d plasmid (a gift from Rune Hartmann, University of Aarhus, Denmark) and grown overnight in LuriaBurtani (LB) broth containing 30 µg/ml kanamycin. An aliquot of 5 ml of the overnight culture was inoculated in 1 liter LB containing antibiotic and allowed to grow at 37°C until the OD600 reached 0.6. The culture was cooled on ice and human OAS was induced with 0.5 mM IPTG at 25°C for 12 h with constant shaking at 220 r.p.m. The cells were harvested by centrifugation at 10 000 g for 10 min and washed with chilled phosphate-buffered saline (PBS). The cells were re-suspended in buffer A: [50 mM sodium phosphate buffer (pH 8.0), 300 mM sodium chloride, 5 mM magnesium chloride, 20 mM imidazole, 10% glycerol and 5 mM 2-mercaptoethanol] plus 0.1% NP-40 and EDTA-free complete protease inhibitor cocktail (Roche Diagnostics Corporation, Indianapolis, IN, USA) and lysed using a French press. Cell debris was removed by centrifugation at 20 000 g for 20 min and the lysate was loaded on Nickel(II) nitrilotriacetic acid (Ni2+-NTA) agarose HiTrapTM Chelating HP column (Amersham Biosciences) washed with buffer A and eluted with the same buffer containing 250 mM imidazole (buffer B). The eluate was dialyzed at least four times against buffer C: [10 mM HEPES (pH 7.4), 150 mM sodium chloride, 5 mM magnesium chloride, 5 mM 2-mercaptoethanol and 0.005% surfactant P20] and further purified with size exclusion chromatography with a Superdex HR16/60 column in buffer C. Human recombinant RNase L was expressed in Sf9 insect cells (Invitrogen) from a baculovirus vector and purified to homogeneity as described previously (38).
RNA isolation
Total RNA was isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and DNA was digested with RNase-free DNase I (Ambion, Austin, TX, USA). Poly(A)+ RNA was isolated with the Oligotex mRNA Midi Kit (Qiagen). RNA concentrations were measured with the RIBOgreen quantification kit (Molecular Probes, Invitrogen).
2-5A synthesis assays
2-5A synthesis reaction mixtures, prepared in DEPC-treated H2O, contained OAS buffer [20 mM HEPES (pH 7.6), 20 mM magnesium acetate, 20 mM potassium chloride and 1 mM EDTA], 10 mM ATP (Sigma-Aldrich Inc., USA) (pH 7.4), 2 µg/ml RNA and 20 µg/ml OAS. Samples were prepared on ice, mixed, centrifuged briefly and incubated at 37°C for the indicated time. Control reactions were prepared exactly as described above, except either without ATP, or without both ATP and OAS. 2-5A synthesis reactions were passed through a Centricon-10 filter (Millipore Corp.). 2-5A in each sample was measured with an RNase L-dependent FRET assay as described previously (38). To generate a standard curve, authentic trimeric 2-5A, diluted to final concentrations of 0.1, 0.3, 1, 3, 10, 30, 100 and 300 nM in DEPC-treated water was used. Fluorescence was measured at 5, 30, 60, 90 and 120 min with a Wallac 1420 fluorimeter (Perkin-Elmer LAS Inc., USA) (absorption 485 nm/emission 535 nm).
In vitro selection of the OAS-binding RNAs
All solutions were made with DEPC-treated H2O. The buffer in the OAS preparations was exchanged with OAS buffer without EDTA with a Centricon-10 filter. Ni2+-NTA agarose (Novagen, EMD Bioscience), equilibrated in OAS buffer without EDTA, was incubated with OAS for 30 min. The OASresin complex was washed with 500 µl of OAS buffer minus EDTA. OAS was repeatedly (57 times) added to the complex until the Ni2+-NTA agarose was saturated with OAS. PC3 Poly(A)+ RNA, at a molar ratio of 25:1 to bound OAS, was used in the in vitro selection assays. RNA was added to the OASresin complex and incubated for 15 min and mixed manually every 2 min. The sample was washed twice with 500 µl of OAS buffer minus EDTA. The RNAOASresin complex was washed with 100 µl of the same buffer supplemented with 250 mM potassium chloride followed by two washes with 500 µl of OAS buffer minus EDTA. The RNAOAS complex was removed from the resin by adding 250 µl strip buffer [20 mM TrisHCl (pH 8.0), 100 mM sodium chloride and 100 mM EDTA] in DEPC-treated H2O. Imidazole was not used due to possible site-specific cleavage of RNAs (39). The supernatant was added to 250 µl of protein digestion buffer [50 mM TrisHCl (pH 7.5), 5 mM calcium chloride and 0.5% SDS] and treated with 100 µg/ml Proteinase K (Promega Corp., Madison, WI, USA) at 37°C for 90 min. The samples were extracted with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1), pH 6.6 (Ambion) and the selected RNAs were precipitated with 300 mM sodium acetate, pH 5.2, and 2.5 volumes of 100% ethanol with 10 µg glycogen as a carrier. The RNA was washed with 75% ethanol and air-dried. The pellet was dissolved in DEPC-treated H2O, purified and concentrated with the RNeasy® MinElute Cleanup Kit (Qiagen). OAS was monitored by loading aliquots of washes, beads or supernatant onto a 10% SDSPAGE, and subsequent silver-staining (Bio-Rad Inc., Hercules, CA, USA). Control mock binding experiments were run in parallel without the addition of OAS to determine if RNA species capable of activating OAS were non-specifically binding to the Ni2+-NTA agarose. RNA isolated from the in vitro selection experiments with and without OAS were quantitated with the RIBOgreen quantification kit and analyzed for their ability to activate OAS with the 2-5A synthesis reactions. 2-5A levels in samples were quantified in FRET assays.
cDNAs preparation and cloning
Selected RNAs were annealed with either random hexamer or oligo(dT) primers, and cDNAs were obtained by reverse transcription. First-strand synthesis was performed for 1 h at 55°C with SuperscriptTM Choice System for cDNA Synthesis (Invitrogen). Second-strand synthesis was performed according to the manufacturer's instructions except without the addition of linkers. Three control reactions were carried out in parallel with each RTPCR. The first control was without the addition of selected RNA; the second control was without reverse transcriptase; and the third control was without the addition of primers. The PCR products were cloned into pBluescript KS+. The recombinant clones were sequenced and identified using the BLAST site at www.ncbi.nih.gov. Primers specific for hERV env RNAs, as described previously (40), were used in PCR (Promega PCR Master Mix) with 2 µl of the cDNA produced from PC3 total or selected RNA (described above). Control reactions included PCR with cDNAs generated without RNA, PCR on cDNA with RNA recovered from mock in vitro selection assay, and PCR for GAPDH. Primers for PCR were as follows. GAPDH exon 8; forward d(CCAAGGCTGTGGGCAAGG), reverse d(TCCGACGCCTGCTTCACC), ß-actin; forward d(GCCAGCTCACCATGGATGAT), reverse d(TTTAAGGTGTGCACTTTTATTC), PCBP2; forward d(CACCGGTGTGATTGAAGG), reverse d(TGCCAACTTCCTTTCCATG), RKIP; forward d(CACAATGTGATTTTATGGT), reverse d(TCTTCATTCAGGTTTCTAT). PCRs were as follows: 95°C, 4 min, [95°C, 30 s (annealing temperature 45 s), 72°C, 1 min] for 30 cycles, 72°C, 10 min. Annealing temperature for GAPDH was at 53°C; ERV3 env was 63°C; hERV 4-1 SU env was 55°C; hERV 4-1 TM env was 58°C; ß-actin was 50°C; PCBP2 was 52°C and RKIP was 46°C. The selected cDNAs were cloned into pGEM®-T Easy (Promega Corp.).
Northern blots
Twenty micrograms of PC3, LNCaP, DU145 and PrEC RNA were separated on 1.2% agarose formaldehyde gels and transferred to Hybond-N+ (Amersham Pharmacia Biotech) membranes. The transferred membranes were hybridized with [
-32P]dCTP-labeled probes. cDNA probes specific for PCBP2, RKIP and GAPDH were generated using Prime-It® RmT Random Primer Labeling Kit (Stratagene). Hybridized membranes were exposed to film (Kodak BioMax XAR Film) for 1248 h at 80°C. Blots were stripped in four washes of boiling 0.1x SSC [0.3 M sodium chloride and 0.03 M sodium citrate (pH 7.0)], 0.1% SDS for 5 min.
Preparation of RNAs
RNA was prepared from linearized plasmids by runoff T7 RNA polymerase transcription reactions as described previously (41) then resolved on a formaldehydeagarose gel and eluted using a crush-and-soak method at 4°C. The RNA was extracted with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1), pH 6.6 (Ambion), precipitated with 300 mM sodium acetate (pH 5.2) and 2.5 volume of 100% ethanol and dissolved in DEPC-treated H2O. Aliquots of the purified RNAs were run on formaldehyde gels to confirm RNA integrity. The RNAs used in subsequent assays were first denatured at 70°C and cooled at room temperature for 15 min to allow renaturation. The purified selected RNAs were used in 2-5A synthesis assays and surface plasmon resonance (SPR) assays. Poly(I):poly(C) was obtained from Amersham Bioscience.
Surface plasmon resonance
Kinetic characterization of OAS:RNA binding was performed with SPR on a Biocore 3000 (Biacore Inc., USA). The response units, RU, indicating the extent of binding, were monitored with time. For this purpose, NTA chips (Biacore Inc.) were saturated with Ni2+ solution to achieve a baseline shift of
40 response units (RU). The purified His6-tagged OAS1 p42 (200 ng/ml) in 10 mM HEPES (pH 7.4) containing 5 mM magnesium chloride, 150 mM sodium chloride, 10 µM EDTA and 0.005% surfactant P20 (SPR buffer; Biacore Inc.) was immobilized on Ni2+-NTA Biacore sensorchip at a flow rate of 10 µl/min for 1 min at 25°C to achieve a resonance response of 250300 RU. An additional wash for 5 min at a flow rate of 20 µl/min was performed with buffer alone. The in vitro transcribed, gel-purified RNAs were dissolved in DEPC-treated water and freeze-dried. The freeze-dried RNAs were dissolved in SPR buffer to make a stock of 10 µM RNA. Different concentrations of RNAs (0.1, 0.5, 1, 5, 10, 25, 50 and 100 nM) were prepared and passed over the OAS immobilized sensorchip at a flow rate of 10 µl/min for 1 min while association was monitored. The dissociation was monitored with buffer alone for additional 5 min. Data normalization against buffer alone, analysis and fitting was performed with BIAevaluationTM software, version 3.2 (Biacore Inc.) with the option for simultaneous ka/kd calculation. Fitting of sensorgram data was carried out according to global fitting, and the ka and kd values were calculated with a 1:1 Langmuir model. In addition, these data were also used for independent KD calculations by Scatchard plot analysis.
High-performance liquid chromatography (HPLC)
2-5A synthesis reaction mixtures were passed through a Centricon-10 filter (Millipore Corp.) to remove the protein and RNA before HPLC. Fifty microliter of a 1:10 dilution of clarified 2-5A synthesis reaction mixtures in 20 mM TrisHCl (pH 7.5) were loaded onto a Dionex P100 analytical HPLC column, interfaced with Beckman System Gold HPLC system connected to a 32 Karat workstation, at a flow rate of 1 ml/min and eluted with a linear gradient of 0750 mM NaCl over a period of 1 h. The chromatograms were analyzed with 32 Karat software (Beckman-Coulter).
In silico validation of RKIP and PCBP2 expression
We interrogated RKIP and PCBP2 expression in the ONCOMINE public microarray database (42), which contains transcription profiling of 35 different tumors and 14 177 microarrays profiling for these different tumors. We selected prostate cancer profiling studies from this database for expression analysis of RKIP and PCBP2.
| RESULTS |
|---|
|
|
|---|
RNA activators of OAS in prostate cancer cells
To monitor and compare RNA activators of OAS in prostate cancer and normal cells, we isolated RNA from three established human prostate cancer cell lines (PC3, LNCaP and DU145) and normal prostatic epithelial cells (PrEC). RNA was incubated with purified histidine-tagged human OAS1 (subsequently OAS) while conversion of ATP to 2-5A was determined by measuring activation of RNase L in FRET assays (Materials and Methods). 2-5A levels were calculated from relative fluorescence units, corresponding to RNA cleavage, when compared to a standard curve generated with known amounts of authentic 2-5A trimer. RNA quality and integrity was established by separation on RNA chips with an Agilent bioanalyzer (data not shown). Remarkably, amounts of 2-5A were 9- to 12-fold higher in OAS reactions containing RNA isolated from the three prostate cancer cell lines (PC3, LNCaP, DU145) in comparison to reactions with RNA isolated from normal prostate epithelial RNA (PrEC) (Figure 1). 2-5A synthesis was dependent on the presence of OAS, RNA and ATP. The highest level of OAS activation (2 h incubation at 37°C) was obtained with PC3 RNA (5.8 nmol 2-5A/µg total RNA), whereas the RNA isolated from LNCaP and DU145 cells produced 4.4 and 4.7 nmol 2-5A/µg total RNA, respectively. In contrast, RNA from the PrEC cells produced only
0.5 nmol 2-5A/µg RNA. Because PC3 RNA reproducibly showed the highest OAS activating potential, we used RNA from these cells to clone RNA activators of OAS.
|
RNA activators of OAS are present in the poly(A)+ fraction of PC3 cell RNA
To determine whether the PC3 RNA responsible for OAS activation was mRNA, poly(A)+ and poly(A) RNA fractions were compared (Figure 2). The poly(A)+ RNA fraction clearly contained the OAS activator(s) since it had a 15-fold higher specific activity in the OAS assay than the poly(A) RNA (Figure 2A). Curiously, however, the specific activity of the poly(A)+ RNA was slightly lower than that of the total RNA, despite being enriched for the OAS-activating species. These results suggest that there may be RNA species inhibitory to OAS in the poly(A)+ RNA fraction.
|
To isolate RNA species in the PC3 poly(A)+ RNA fraction that have high affinity for OAS, we developed an in vitro selection method (Materials and Methods). Binding and elution of OAS to and from the Ni2+-NTA beads during the RNA binding and washing procedures was monitored by gel electrophoresis and silver staining of the OAS (Figure 2B). These methods included a KCl wash to remove any RNA species that bind OAS with low affinities. The bound RNA, recovered after proteinase K digestion of the OAS, produced 4.8 nmol 2-5A/µg RNA when incubated with freshly added OAS, while <50 pmol 2-5A/µg RNA was produced by OAS from RNA recovered with Ni2+-NTA agarose alone (Figure 3).
|
Cloning and identification of PC3 mRNAs that activate OAS
To clone and identify the RNA species that bind OAS, we performed reverse transcription using the PC3 poly(A)+ RNA fraction isolated by in vitro selection. Typically, RNA(s) that bind to and activate OAS are double-stranded or have a defined secondary structure. Therefore, reverse transcription at lower temperatures may not allow efficient cDNA synthesis. Accordingly, the temperature of the first-strand synthesis reaction was performed at 55°C. To maximize the amount of clones produced, separate reverse transcription reactions were performed with either random hexamer or oligo(dT) primers. Using this strategy, only two clones were obtained from
16 rounds of selection and cloning. The two clones were sequenced and identified as partial cDNAs for RKIP and PCBP2. The RKIP cDNA, 368 nt in length, was from the 3'-UTR [nt 11381506; GenBank accession no. NM_002567
[GenBank]
] whereas the PCBP2 cDNA, 72 nt in length, was from the 5' region of the ORF (356428 nt, translation start site at 351 nt; GenBank accession no. AB188306
[GenBank]
). The RKIP clone was produced using oligo(dT) primed reverse transcription, while the PCBP2 encoding clone was produced using random hexamer primers. The level of expression of the selected RNAs in the prostate cancer cell lines and PrEC was determined in northern blots. Levels of PCBP2 mRNA were highly elevated (>10-fold) in the prostate cancer cells (PC3, LNCaP and DU145) compared with the normal (PrEC) cells after normalizing for levels of GAPDH mRNA (Figure 4). The PCBP2 cDNA probe identified a doublet produced from alternative splicing. However, while normalized levels of RKIP mRNA were elevated in the PC3 cells (6-fold), they were not elevated in the LNCaP and DU145 cells.
|
hERV env RNAs bind OAS
A report of the presence of hERV RNAs in prostate cancer cells, and the recognition that viral RNAs often activate OAS, led us to examine if such RNAs were capable of binding and activating OAS (40). Therefore, RTPCR was performed for hERV env RNAs with PC3 poly(A)+ RNA fractions isolated by OAS-selection. PCR primers were specific for the env regions of hERV 4-1 transmembrane TM (599 bp) (nt 75018099; GenBank accession no. M10976 [GenBank] ), hERV 4-1 surface subunit (SU) (1349 bp) (nt 62117559; GenBank accession no. M10976 [GenBank] ) and ERV3 (1745 bp) (nt 7862530; GenBank accession no. M12140 [GenBank] ), previously identified in prostate cancer (40). RNA initiated PCR performed with both total RNA and OAS-selected RNA from PC3 cells showed the presence of hERV 4-1 TM and SU and ERV3 env RNAs (Figure 5A and B). No PCR products were obtained when GAPDH primers were used on cDNA prepared from the OAS-selected RNA indicating that GAPDH mRNA is a suitable non-specific RNA control (Figure 5B, lower panel). In a mock selection, performed in the absence of OAS, these hERV cDNAs were not amplified (Figure 5C). Primers specific for GAPDH mRNA was performed on PC3 cDNA as a positive control (Figure 5C, lane 1). These findings show that the different hERV env RNAs are present in PC3 cells and that these RNA bind OAS.
|
OAS-binding affinities of the selected RNAs
To determine affinities of the selected RNAs for OAS, SPR was performed on a Biacore 3000 instrument (Materials and Methods). Representative sensograms for RKIP, PCBP2 and hERV 4-1 SU env RNAs show concentration-dependent steady-state binding to OAS with rapid association/dissociation rates (Figure 6AC). Global data analyses with BIAevaluationTM software (version 3.2; Biacore Inc.) were used to determine the dissociation constants (KD) and the association and dissociation rates (ka and kd, respectively) (Table 1). Scatchard analyses with SigmaPlotTM (version 2000) produced similar KD values (Figure 6D and data not shown). The quality of the fit was determined by
2-values, as well as from the magnitude and distribution of the residuals (Table 1) (43). The KD values are in the subnanomolar to nanomolar range. The highest and lowest affinities (0.9 and 18 nM) were obtained for PCBP2 and hERV 4-1 SU RNAs, respectively (Table 1). Although there are considerable differences in the ka and KD for different RNAs, the off rates, kd, are very similar. There was no significant binding of the RNAs to the Ni2+-NTA chip alone (data not shown).
|
OAS-selected RNAs potently activate the catalytic function of OAS
To measure the abilities of the RNAs to activate OAS, they were produced by in vitro transcription and gel-purified to remove contaminants (Materials and Methods). To confirm RNA size and integrity, RNA species were analyzed by formaldehyde gel electrophoresis (Figure 7A). 2-5A produced in OAS reactions was measured by the ability to activate RNase L using FRET. The OAS-selected RNA species with the highest activating abilities were ERV3 env and PCBP2 RNAs, producing 22.5 and 21 nmol 2-5A/µg RNA, respectively. HERV 4-1 SU env, RKIP RNA and hERV 4-1 TM env produced
16, 15.5 and 6 nmol 2-5A/µg RNA, respectively. In comparison, poly(I):poly(C) and ß-actin RNA produced 37.5 and 3 nmol 2-5A/µg RNA, respectively (Figure 7B and Table 1). As expected, no 2-5A was produced in control mixtures lacking OAS and/or ATP. Therefore, all of the OAS-selected RNAs, with the exception of the hERV 4-1 TM RNA, approached or exceeded half the activity of poly(I):poly(C) and were several-fold more potent than ß-actin RNA.
|
|
2-5A oligomer size distribution
To determine amounts of different 2-5A oligomers generated in the OAS reactions, HPLC was performed (Figure 8 and Table 2). Representative HPLC profiles of 2-5A produced with RKIP, PCBP2 and hERV 4-1 SU env RNAs as OAS activators are shown (Figure 8). Poly(I):poly(C) and ß-actin RNA produced the largest and least amounts of functional 2-5A (trimer and longer species) (ppp(A2'p)nA, n = 2 to
4) (Table 2). The relative abilities of the different RNAs to cause trimeric or longer oligomers of 2-5A to be synthesized were in agreement with RNase L activation data (Figure 7 and Table 2).
|
|
Levels of RKIP and PCBP2 RNAs in human prostate and prostate tumors
To compare levels of RKIP and PCBP2 RNA in normal prostate and prostate cancer, we interrogated the expression of these genes in prostate tumor expression profiling studies from several different research groups using the ONCOMINE expression profiling database (42). ONCOMINE is an oncogenomic database of 14 177 microarrays that profiled 35 different types of tumors from which gene expression results can be mined by a web-based platform. RKIP showed variable patterns of RNA expression in two independent studies. Although Dhanasekaran et al. (44) showed downregulation RKIP in localized and metastatic prostate cancer, Lapointe et al. (45) showed upregulation of RKIP RNA in lymph node metastasis, but not in primary tumors (Figure 9A). In contrast, data from four independent prostate cancer profiling studies indicated upregulation of PCBP2 expression in prostate cancer, particularly in metastatic tumors (Figure 9B). These data show overexpression of PCBP2 in aggressive prostate tumors in agreement with our findings from the prostate cancer cell lines (Figure 4).
|
| DISCUSSION |
|---|
|
|
|---|
RNA activators of OAS in prostate cancer cells
Here we provide the first identification of cellular RNA species that activate OAS. Prostate cancer cells, especially from prostate cancer metastasis, are enriched in RNAs capable of activating OAS compared with normal prostate epithelial cells. OAS activation usually leads to stimulation of RNase L. Because sustained RNase L activity causes apoptosis, these findings are consistent with reports of mutations in RNase L in prostate cancer (21,22,25,26). Alternatively, defects in apoptosis pathways could render prostate cancer cells resistant to RNase L activity. Most of the RNAs studied here (except for hERV4-1 TM) potently activated OAS, with 4060% of the activity obtained with poly(I):poly(C) (Figure 7). Our data show there is no clear correlation between RNA size, binding affinity and OAS activation (Table 1 and Figure 7). For instance, ERV3 RNA has a 10-fold lower KD than PCBP2 RNA, yet both activate OAS to the same extent. RKIP and ß-actin RNAs have similar KD's, yet RKIP RNA is 5-fold more active. These findings support a prior report that suggested RNA binding per se is insufficient for OAS activation (32). Analysis of the crystal structure of porcine OAS1 led to a model suggesting that activation of OAS is a two-step process in which RNA binding induces conformation changes in the catalytic domain (33).
RKIP and PCBP2 mRNAs potently activate OAS
The two cellular mRNAs capable of binding and activating OAS encode RKIP and PCBP2. There were no obvious secondary structure or sequence motif similarities between these two RNAs (data not shown). RKIP, a member of the phosphatidylethanolamine binding protein family (PEBP-2), is an inhibitor of Raf kinase (46) [reviewed in (36)]. In addition to inhibiting the Raf-MEK-ERK cascade, RKIP also modulates G-protein and NF-
B signaling (47,48). RKIP suppresses prostate cancer metastasis by inhibiting angiogenesis and cell invasion and by promoting apoptosis (49,50). Enhancing RKIP levels in metastatic prostate cancer cells decreased invasion, whereas decreasing RKIP expression in non-metastatic prostate cancer cells increased their ability to invade (49). In contrast, RKIP does not affect growth of prostate cancer cells in vitro or the ability to form colonies in soft agar. RKIP expression is rapidly induced upon chemotherapeutic drug treatment in human prostate and breast cancer cells, sensitizing the cells to apoptosis while decreased the expression of RKIP confers resistance to chemotherapeutic agents (50). A recent study showed that RKIP expression was a prognostic marker for prostate cancer, with low expression of RKIP correlating with a high rate of recurrence based on prostate-specific antigen levels (51). These studies suggest that RKIP may sensitize prostate cancer cells to apoptosis by inhibiting the Raf/MEK/ERK and NF-
B survival signaling pathways. It is tempting to speculate an apoptotic function for RKIP mRNA, by way activating the OAS/RNase L pathway, that is completely independent of the encoded protein. However, there was no consistent difference in levels of RKIP mRNA in the three prostate cancer cell lines and normal prostate epithelial cells (Figure 4). In addition, there were variable levels of RKIP mRNA in prostate cancer in two microarray studies (44,45). Therefore, RKIP mRNA does not appear to be responsible for the higher OAS activation obtained with total RNA from prostate cancer cell lines compared to normal prostate epithelial cells (Figure 1).
PCBP2 (also known as hnRNP E2 and
CP-2) is a member of a family of host proteins with triplicate KH RNA-binding domains and poly(C)-binding activity. PCBP2 has a range of cellular functions including mRNA stabilization and control of both translational initiation and transcription (37). Interestingly, PCBP2 binds to a conserved UC-rich region containing a CCCUCCC motif in the 3'-UTR of the androgen receptor mRNA, suggesting a role for PCBP2 in modulating AR mRNA stability and/or translation (52,53). In addition, PCPB2 is an essential host factor in poliovirus replication playing roles in both translation initiation and viral RNA synthesis (54). Perhaps OAS and RNase L affect translation or stability of PCBP2 mRNA and thus indirectly regulate both virus replication and androgen receptor synthesis. The former activity is consistent with the antiviral activity of the OAS/RNase L pathway, while the latter is consistent with the proposed role of RNase L in prostate cancer pathogenesis. In this regard, PCBP2 expression was higher in all of the prostate cancer cell lines that we examined compared with normal prostate epithelial cells. Furthermore, PCBP2 RNA levels were elevated in localized and/or metastatic prostate cancer from four independent microarray studies (45,5557) (Figure 9A). These investigations suggest that PCBP2 is a potential marker for aggressive forms of prostate cancer and that it could regulate androgen receptor synthesis.
hERV RNAs bind and activate OAS
We identified three hERV env RNAs that bind with high affinity and activate OAS. hERVs are descendants of exogenous retroviruses that integrated into genomic DNA of host germ line cells and account for
89% of the total human genome (5860). Many functions for hERVs have been proposed, including roles in tumorigenesis, autoimmune diseases and neurological disorders (6165). In addition, the fusogenic properties of a hERV-W envelope protein is utilized for the formation of the placental syncytiotrophoblast layer (66,67). hERV transcripts are found in various human tissues (68), including prostate cancer cells specifically, but lacking in normal prostatic tissues (40). However, the pathobiology of hERV RNAs is poorly understood.
It is likely that the OAS/RNase L pathway suppresses retroviral infections. For instance, overexpression of OAS (69) or RNase L (70) in cultured cells impairs HIV replication, and suppression of RNase L activity by expression of an RNase L inhibitor (RLI, ABCE1, HP68) enhances HIV growth in culture (71). OAS is activated by HIV-1 TAR RNA (8). In addition, we identified a novel gammaretrovirus, XMRV, almost exclusively in prostate cancer patients homozygous for a reduced activity variant of RNase L (28). The fact that some hERV RNAs are capable of activating OAS suggests that their role in prostate cancer may be more protective than destructive by initiating an antiproliferative mechanism in cancer cells. Nevertheless, further studies are clearly required to establish the roles of these RNA activators of OAS in the RNA biology of prostate cancer. Our findings show that OAS activators are enriched in prostate cancer. Furthermore, these results demonstrate that both viral and cellular RNA can possess the ability to bind and activate OAS.
| ACKNOWLEDGEMENTS |
|---|
These studies were supported by a grant from the National Institutes of Health, National Cancer Institute (CA103943 R.H.S.) and a Molecular Medicine Fellowship from Cleveland State University and the Cleveland Clinic Foundation (R.J.M.). We thank Rune Hartmann, University of Aarhus, Denmark, for the gift of human hexahistidine-OAS1 p42 cDNA. Funding to pay the Open Access publication charges for this article was provided by grant CA103943 from the National Institutes of Health, National Cancer Institute.
Conflict of interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Stark, G.R., Kerr, I.M., Williams, B.R., Silverman, R.H., Schreiber, R.D. (1998) How cells respond to interferons Annu. Rev. Biochem, . 67, 227264[CrossRef][Web of Science][Medline] .
- Hovanessian, A.G., Brown, R.E., Kerr, I.M. (1977) Synthesis of low molecular weight inhibitor of protein synthesis with enzyme from interferon-treated cells Nature, 268, 537540[CrossRef][Medline] .
- Kerr, I.M. and Brown, R.E. (1978) pppA2'p5'A2'p5'A: an inhibitor of protein synthesis synthesized with an enzyme fraction from interferon-treated cells Proc. Natl Acad. Sci. USA, 75, 256260
[Abstract/Free Full Text] . - Sharp, T.V., Raine, D.A., Gewert, D.R., Joshi, B., Jagus, R., Clemens, M.J. (1999) Activation of the interferon-inducible (2'5') oligoadenylate synthetase by the EpsteinBarr virus RNA, EBER-1 Virology, 257, 303313[CrossRef][Web of Science][Medline] .
- Mordechai, E., Kon, N., Henderson, E.E., Suhadolnik, R.J. (1995) Activation of the interferon-inducible enzymes, 2',5'-oligoadenylate synthetase and PKR by human T-cell leukemia virus type I Rex-response element Virology, 206, 913922[CrossRef][Web of Science][Medline] .
- Gribaudo, G., Lembo, D., Cavallo, G., Landolfo, S., Lengyel, P. (1991) Interferon action: binding of viral RNA to the 40-kilodalton 2'5'-oligoadenylate synthetase in interferon-treated HeLa cells infected with encephalomyocarditis virus J. Virol, . 65, 17481757
[Abstract/Free Full Text] . - Desai, S.Y., Patel, R.C., Sen, G.C., Malhotra, P., Ghadge, G.D., Thimmapaya, B. (1995) Activation of interferon-inducible 2'5' oligoadenylate synthetase by adenoviral VAI RNA J. Biol. Chem, . 270, 34543461
[Abstract/Free Full Text] . - Maitra, R.K., McMillan, N.A., Desai, S., McSwiggen, J., Hovanessian, A.G., Sen, G., Williams, B.R., Silverman, R.H. (1994) HIV-1 TAR RNA has an intrinsic ability to activate interferon-inducible enzymes Virology, 204, 823827[CrossRef][Web of Science][Medline] .
- Zhou, A., Molinaro, R.J., Malathi, K., Silverman, R.H. (2005) Mapping of the human RNASEL promoter and expression in cancer and normal cells J. Interferon Cytokine Res, . 25, 595603[CrossRef][Web of Science][Medline] .
- Dong, B. and Silverman, R.H. (1995) 2-5A-dependent RNase molecules dimerize during activation by 25A J. Biol. Chem, . 270, 41334137
[Abstract/Free Full Text] . - Wreschner, D.H., McCauley, J.W., Skehel, J.J., Kerr, I.M. (1981) Interferon actionsequence specificity of the ppp(a2'p)na-dependent ribonuclease Nature, 289, 414417[CrossRef][Medline] .
- Iordanov, M.S., Paranjape, J.M., Zhou, A., Wong, J., Williams, B.R., Meurs, E.F., Silverman, R.H., Magun, B.E. (2000) Activation of p38 mitogen-activated protein kinase and c-Jun NH2-terminal kinase by double-stranded RNA and encephalomyocarditis virus: involvement of RNase L, protein kinase R, and alternative pathways Mol. Cell. Biol, . 20, 617627
[Abstract/Free Full Text] . - Floyd-Smith, G., Slattery, E., Lengyel, P. (1981) Interferon action: RNA cleavage pattern of a (2'5')oligoadenylatedependent endonuclease Science, 212, 10301032
[Abstract/Free Full Text] . - Zhou, A., Paranjape, J., Brown, T.L., Nie, H., Naik, S., Dong, B., Chang, A., Trapp, B., Fairchild, R., Colmenares, C., et al. (1997) Interferon action and apoptosis are defective in mice devoid of 2'5'-oligoadenylate-dependent RNase L EMBO J, . 16, 63556363[CrossRef][Web of Science][Medline] .
- Samuel, M.A., Whitby, K., Marri, A., Williams, B.R.G., Silverman, R.H., Diamond, M.S. (2006) PKR and RNASEL contribute to protection against lethal west nile virus infection by controlling early spread in the periphery and viral replication in neurons J. Virol, . 80, 70097019
[Abstract/Free Full Text] . - Flodstrom-Tullberg, M., Hultcrantz, M., Stotland, A., Maday, A., Tsai, D., Fine, C., Williams, B., Silverman, R., Sarvetnick, N. (2005) RNase l and double-stranded RNA-dependent protein kinase exert complementary roles in islet cell defense during coxsackievirus infection J. Immunol, . 174, 11711177
[Abstract/Free Full Text] . - Rusch, L., Zhou, A., Silverman, R.H. (2000) Caspase-dependent apoptosis by 2',5'-oligoadenylate activation of RNase l is enhanced by IFN-ß J. Interferon Cytokine Res, . 20, 10911100[CrossRef][Web of Science][Medline] .
- Malathi, K., Paranjape, J.M., Ganapathi, R., Silverman, R.H. (2004) HPC1/RNASEL mediates apoptosis of prostate cancer cells treated with 2',5'-oligoadenylates, topoisomerase I inhibitors, and tumor necrosis factor-related apoptosis-inducing ligand Cancer Res, . 64, 91449151
[Abstract/Free Full Text] . - Li, G., Xiang, Y., Sabapathy, K., Silverman, R.H. (2004) An apoptotic signaling pathway in the interferon antiviral response mediated by RNase l and c-Jun NH2-terminal kinase J. Biol. Chem, . 279, 11231131
[Abstract/Free Full Text] . - Castelli, J.C., Hassel, B.A., Maran, A., Paranjape, J., Hewitt, J.A., Li, X.L., Hsu, Y.T., Silverman, R.H., Youle, R.J. (1998) The role of 2'5' oligoadenylate-activated ribonuclease L in apoptosis Cell Death Differ, . 5, 313320[CrossRef][Web of Science][Medline] .
- Carpten, J., Nupponen, N., Isaacs, S., Sood, R., Robbins, C., Xu, J., Faruque, M., Moses, T., Ewing, C., Gillanders, E., et al. (2002) Germline mutations in the ribonuclease L gene in families showing linkage with HPC1 Nature Genet, . 30, 181184[CrossRef][Web of Science][Medline] .
- Casey, G., Neville, P.J., Plummer, S.J., Xiang, Y., Krumroy, L.M., Klein, E.A., Catalona, W.J., Nupponen, N., Carpten, J.D., Trent, J.M., et al. (2002) RNASEL Arg462Gln variant is implicated in up to 13% of prostate cancer cases Nature Genet, . 32, 581583[CrossRef][Medline] .
- Downing, S.R., Hennessy, K.T., Abe, M., Manola, J., George, D.J., Kantoff, P.W. (2003) Mutations in ribonuclease L gene do not occur at a greater frequency in patients with familial prostate cancer compared with patients with sporadic prostate cancer Clin. Prostate Cancer, 2, 177180[Medline] .
- Maier, C., Haeusler, J., Herkommer, K., Vesovic, Z., Hoegel, J., Vogel, W., Paiss, T. (2005) Mutation screening and association study of RNASEL as a prostate cancer susceptibility gene Br. J. Cancer, 92, 11591164[CrossRef][Web of Science][Medline] .
- Rennert, H., Bercovich, D., Hubert, A., Abeliovich, D., Rozovsky, U., Bar-Shira, A., Soloviov, S., Schreiber, L., Matzkin, H., Rennert, G., et al. (2002) A novel founder mutation in the rnasel gene, 471delaaag, is associated with prostate cancer in ashkenazi jews Am. J. Hum. Genet, . 71, 981984[CrossRef][Web of Science][Medline] .
- Rennert, H., Zeigler-Johnson, C.M., Addya, K., Finley, M.J., Walker, A.H., Spangler, E., Leonard, D.G., Wein, A., Malkowicz, S.B., Rebbeck, T.R. (2005) Association of susceptibility alleles in ELAC2/HPC2, RNASEL/HPC1, and MSR1 with prostate cancer severity in European American and African American men Cancer Epidemiol. Biomarkers Prev, . 14, 949957
[Abstract/Free Full Text] . - Wiklund, F., Jonsson, B.A., Brookes, A.J., Stromqvist, L., Adolfsson, J., Emanuelsson, M., Adami, H.O., Augustsson-Balter, K., Gronberg, H. (2004) Genetic analysis of the RNasel gene in hereditary, familial and sporadic prostate cancer Clin. Cancer Res, . 10, 71507156
[Abstract/Free Full Text] . - Urisman, A., Molinaro, R.J., Fischer, N., Plummer, S.J., Casey, G., Klein, E.A., Malathi, K., Magi-Galluzzi, C., Tubbs, R.R., Ganem, D., et al. (2006) Identification of a novel gammaretrovirus in prostate tumors of patients homozygous for R462Q RNASEL variant PLoS Pathog, . 2, e25[CrossRef][Medline] .
- Rebouillat, D. and Hovanessian, A.G. (1999) The human 2',5'-oligoadenylate synthetase family: interferon-induced proteins with unique enzymatic properties J. Interferon Cytokine Res, . 19, 295308[CrossRef][Web of Science][Medline] .
- Marie, I., Blanco, J., Rebouillat, D., Hovanessian, A.G. (1997) 69-kDa and 100-kDa isoforms of interferon-induced (2'5')oligoadenylate synthetase exhibit differential catalytic parameters Eur. J. Biochem, . 248, 558566[Web of Science][Medline] .
- Rebouillat, D., Hovnanian, A., Marie, I., Hovanessian, A.G. (1999) The 100-kDa 2',5'-oligoadenylate synthetase catalyzing preferentially the synthesis of dimeric pppA2'p5'A molecules is composed of three homologous domains J. Biol. Chem, . 274, 15571565
[Abstract/Free Full Text] . - Hartmann, R., Norby, P.L., Martensen, P.M., Jorgensen, P., James, M.C., Jacobsen, C., Moestrup, S.K., Clemens, M.J., Justesen, J. (1998) Activation of 2'5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers J. Biol. Chem, . 273, 32363246
[Abstract/Free Full Text] . - Hartmann, R., Justesen, J., Sarkar, S.N., Sen, G.C., Yee, V.C. (2003) Crystal structure of the 2'-specific and double-stranded RNA-activated interferon-induced antiviral protein 2'5'-oligoadenylate synthetase Mol. Cell, 12, 11731185[CrossRef][Web of Science][Medline] .
- Rosenblum, M.G., Yung, W.K., Kelleher, P.J., Ruzicka, F., Steck, P.A., Borden, E.C. (1990) Growth inhibitory effects of interferon-beta but not interferon-alpha on human glioma cells: correlation of receptor binding, 2',5'-oligoadenylate synthetase and protein kinase activity J. Interferon Res, . 10, 141151[Web of Science][Medline] .
- Hubbell, H.R., Sheetz, P.C., Iogal, S.S., Brodsky, I., Kariko, K., Li, S.W., Suhadolnik, R.J., Sobol, R.W. (1991) Heterogeneous nuclear RNA from hairy cell leukemia patients activates 2',5'-oligoadenylate synthetase Anticancer Res, . 11, 19271932[Web of Science][Medline] .
- Keller, E.T., Fu, Z., Brennan, M. (2005) The biology of a prostate cancer metastasis suppressor protein: Raf kinase inhibitor protein J. Cell Biochem, . 94, 273278[CrossRef][Web of Science][Medline] .
- Makeyev, A.V. and Liebhaber, S.A. (2002) The poly(C)-binding proteins: a multiplicity of functions and a search for mechanisms RNA, 8, 265278[Abstract] .
- Thakur, C.S., Xu, Z., Wang, Z., Novince, Z., Silverman, R.H. (2005) A convenient and sensitive fluorescence resonance energy transfer assay for RNase L and 2',5' oligoadenylates Methods Mol. Med, . 116, 103113[Medline] .
- Ushijima, K., Gouzu, H., Hosono, K., Shirakawa, M., Kagosima, K., Takai, K., Takaku, H. (1998) Site-specific cleavage of tRNA by imidazole and/or primary amine groups bound at the 5'-end of oligodeoxyribonucleotides Biochim. Biophys. Acta, 1379, 217223[Medline] .
- Wang-Johanning, F., Frost, A.R., Jian, B., Azerou, R., Lu, D.W., Chen, D.T., Johanning, G.L. (2003) Detecting the expression of human endogenous retrovirus E envelope transcripts in human prostate adenocarcinoma Cancer, 98, 187197[CrossRef][Web of Science][Medline] .
- Kao, C., Rudisser, S., Zheng, M. (2001) A simple and efficient method to transcribe rnas with reduced 3' heterogeneity Methods, 23, 201205[CrossRef][Web of Science][Medline] .
- Rhodes, D.R., Yu, J., Shanker, K., Deshpande, N., Varambally, R., Ghosh, D., Barrette, T., Pandey, A., Chinnaiyan, A.M. (2004) Oncomine: a cancer microarray database and integrated data-mining platform Neoplasia, 6, 16[Web of Science][Medline] .
- Myszka, D.G. (1997) Kinetic analysis of macromolecular interactions using surface plasmon resonance biosensors Curr. Opin. Biotechnol, . 8, 5057[CrossRef][Web of Science][Medline] .
- Dhanasekaran, S.M., Barrette, T.R., Ghosh, D., Shah, R., Varambally, S., Kurachi, K., Pienta, K.J., Rubin, M.A., Chinnaiyan, A.M. (2001) Delineation of prognostic biomarkers in prostate cancer Nature, 412, 822826[CrossRef][Medline] .
- Lapointe, J., Li, C., Higgins, J.P., van de Rijn, M., Bair, E., Montgomery, K., Ferrari, M., Egevad, L., Rayford, W., Bergerheim, U., et al. (2004) Gene expression profiling identifies clinically relevant subtypes of prostate cancer Proc. Natl Acad. Sci. USA, 101, 811816
[Abstract/Free Full Text] . - Yeung, K., Seitz, T., Li, S., Janosch, P., McFerran, B., Kaiser, C., Fee, F., Katsanakis, K.D., Rose, D.W., Mischak, H., et al. (1999) Suppression of Raf-1 kinase activity and MAP kinase signalling by RKIP Nature, 401, 173177[CrossRef][Medline] .
- Kroslak, T., Koch, T., Kahl, E., Hollt, V. (2001) Human phosphatidylethanolamine-binding protein facilitates heterotrimeric G protein-dependent signaling J. Biol. Chem, . 276, 3977239778
[Abstract/Free Full Text] . - Yeung, K.C., Rose, D.W., Dhillon, A.S., Yaros, D., Gustafsson, M., Chatterjee, D., McFerran, B., Wyche, J., Kolch, W., Sedivy, J.M. (2001) Raf kinase inhibitor protein interacts with NF-
B-inducing kinase and TAK1 and inhibits NF-
B activation Mol. Cell. Biol, . 21, 72077217[Abstract/Free Full Text] . - Fu, Z., Smith, P.C., Zhang, L., Rubin, M.A., Dunn, R.L., Yao, Z., Keller, E.T. (2003) Effects of raf kinase inhibitor protein expression on suppression of prostate cancer metastasis J. Natl Cancer Inst, . 95, 878889
[Abstract/Free Full Text] . - Chatterjee, D., Bai, Y., Wang, Z., Beach, S., Mott, S., Roy, R., Braastad, C., Sun, Y., Mukhopadhyay, A., Aggarwal, B.B., et al. (2004) RKIP sensitizes prostate and breast cancer cells to drug-induced apoptosis J. Biol. Chem, . 279, 1751517523
[Abstract/Free Full Text] . - Fu, Z., Kitagawa, Y., Shen, R., Shah, R., Mehra, R., Rhodes, D., Keller, P.J., Mizokami, A., Dunn, R., Chinnaiyan, A.M., et al. (2006) Metastasis suppressor gene Raf kinase inhibitor protein (RKIP) is a novel prognostic marker in prostate cancer Prostate, 66, 248256[CrossRef][Web of Science][Medline] .
- Yeap, B.B., Voon, D.C., Vivian, J.P., McCulloch, R.K., Thomson, A.M., Giles, K.M., Czyzyk-Krzeska, M.F., Furneaux, H., Wilce, M.C., Wilce, J.A., et al. (2002) Novel binding of hur and poly(C)-binding protein to a conserved UC-rich motif within the 3'-untranslated region of the androgen receptor messenger RNA J. Biol. Chem, . 277, 2718327192
[Abstract/Free Full Text] . - Yeap, B.B., Wilce, J.A., Leedman, P.J. (2004) The androgen receptor mRNA Bioessays, 26, 672682[CrossRef][Web of Science][Medline] .
- Walter, B.L., Parsley, T.B., Ehrenfeld, E., Semler, B.L. (2002) Distinct poly(rC) binding protein KH domain determinants for poliovirus translation initiation and viral RNA replication J. Virol, . 76, 1200812022
[Abstract/Free Full Text] . - Yu, Y.P., Landsittel, D., Jing, L., Nelson, J., Ren, B., Liu, L., McDonald, C., Thomas, R., Dhir, R., Finkelstein, S., et al. (2004) Gene expression alterations in prostate cancer predicting tumor aggression and preceding development of malignancy J. Clin. Oncol, . 22, 27902799
[Abstract/Free Full Text] . - LaTulippe, E., Satagopan, J., Smith, A., Scher, H., Scardino, P., Reuter, V., Gerald, W.L. (2002) Comprehensive gene expression analysis of prostate cancer reveals distinct transcriptional programs associated with metastatic disease Cancer Res, . 62, 44994506
[Abstract/Free Full Text] . - Vanaja, D.K., Ballman, K.V., Morlan, B.W., Cheville, J.C., Neumann, R.M., Lieber, M.M., Tindall, D.J., Young, C.Y. (2006) PDLIM4 repression by hypermethylation as a potential biomarker for prostate cancer Clin. Cancer Res, . 12, 11281136
[Abstract/Free Full Text] . - Li, W.H., Gu, Z., Wang, H., Nekrutenko, A. (2001) Evolutionary analyses of the human genome Nature, 409, 847849[CrossRef][Medline] .
- Leib-Mosch, C., Brack-Werner, R., Werner, T., Bachmann, M., Faff, O., Erfle, V., Hehlmann, R. (1990) Endogenous retroviral elements in human DNA Cancer Res, . 50, 5636S5642S .
- Lander, E.S., Linton, L.M., Birren, B., Nusbaum, C., Zody, M.C., Baldwin, J., Devon, K., Dewar, K., Doyle, M., FitzHugh, W., et al. (2001) Initial sequencing and analysis of the human genome Nature, 409, 860921[CrossRef][Medline] .
- Yolken, R.H. and Torrey, E.F. (1995) Viruses, schizophrenia, and bipolar disorder Clin. Microbiol. Rev, . 8, 131145
[Abstract/Free Full Text] . - Yi, J.M., Lee, W.H., Kim, H.M., Kim, H.S. (2001) Identification of new endogenous retroviral sequences belonging to the HERV-W family in human cancer cells Intervirology, 44, 333338[CrossRef][Web of Science][Medline] .
- Sutkowski, N., Conrad, B., Thorley-Lawson, D.A., Huber, B.T. (2001) EpsteinBarr virus transactivates the human endogenous retrovirus HERV-K18 that encodes a superantigen Immunity, 15, 579589[CrossRef][Web of Science][Medline] .
- Perl, A. (2003) Role of endogenous retroviruses in autoimmune diseases Rheum. Dis. Clin. North Am, . 29, 123143 vii[CrossRef][Web of Science][Medline] .
- Marguerat, S., Wang, W.Y., Todd, J.A., Conrad, B. (2004) Association of human endogenous retrovirus K-18 polymorphisms with type 1 diabetes Diabetes, 53, 852854
[Abstract/Free Full Text] . - Mi, S., Lee, X., Li, X., Veldman, G.M., Finnerty, H., Racie, L., LaVallie, E., Tang, X.Y., Edouard, P., Howes, S., et al. (2000) Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis Nature, 403, 785789[CrossRef][Medline] .
- Blond, J.L., Lavillette, D., Cheynet, V., Bouton, O., Oriol, G., Chapel-Fernandes, S., Mandrand, B., Mallet, F., Cosset, F.L. (2000) An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor J. Virol, . 74, 33213329
[Abstract/Free Full Text] . - Seifarth, W., Frank, O., Zeilfelder, U., Spiess, B., Greenwood, A.D., Hehlmann, R., Leib-Mosch, C. (2005) Comprehensive analysis of human endogenous retrovirus transcriptional activity in human tissues with a retrovirus-specific microarray J. Virol, . 79, 341352
[Abstract/Free Full Text] . - Schroder, H.C., Suhadolnik, R.J., Pfleiderer, W., Charubala, R., Muller, W.E. (1992) (2'5')Oligoadenylate and intracellular immunity against retrovirus infection Int. J. Biochem, . 24, 5563[CrossRef][Web of Science][Medline] .
- Maitra, R.K. and Silverman, R.H. (1998) Regulation of human immunodeficiency virus replication by 2',5'-oligoadenylate-dependent RNase L J. Virol, . 72, 11461152
[Abstract/Free Full Text] . - Martinand, C., Montavon, C., Salehzada, T., Silhol, M., Lebleu, B., Bisbal, C. (1999) RNase l inhibitor is induced during human immunodeficiency virus type 1 infection and down regulates the 2-5A/RNase L pathway in human T cells J. Virol, . 73, 290296
[Abstract/Free Full Text] .
This article has been cited by other articles:
![]() |
X.-L. Li, H. J. Ezelle, T.-J. Kang, L. Zhang, K. A. Shirey, J. Harro, J. D. Hasday, S. K. Mohapatra, O. R. Crasta, S. N. Vogel, et al. An essential role for the antiviral endoribonuclease, RNase-L, in antibacterial immunity PNAS, December 30, 2008; 105(52): 20816 - 20821. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ghosh, G. P. Srivastava, D. Xu, L. C. Schulz, and R. M. Roberts A link between SIN1 (MAPKAP1) and poly(rC) binding protein 2 (PCBP2) in counteracting environmental stress PNAS, August 19, 2008; 105(33): 11673 - 11678. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









