Skip Navigation

Nucleic Acids Research 2006 34(5):1351-1357; doi:10.1093/nar/gkl012
This Article
Right arrow Abstract Freely available
Right arrow Print PDF (487K) Freely available
Right arrow Screen PDF (287K) Freely available
Right arrow A corrigendum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Sulahian, R.
Right arrow Articles by Kodadek, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sulahian, R.
Right arrow Articles by Kodadek, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published online 3 March 2006

© The Author 2006. Published by Oxford University Press. All rights reserved
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions@oxfordjournals.org


Article

The proteasomal ATPase complex is required for stress-induced transcription in yeast

Rita Sulahian, Stephen Albert Johnston and Thomas Kodadek*

Department of Internal Medicine, Department of Molecular Biology and Department of Microbiology, University of Texas Southwestern Medical Center 5323 Harry Hines Boulevard, Dallas, TX 75390-8573, USA

*To whom correspondence should be addressed at Thomas Kodadek, Julie and Louis Beecherl, Jr Chair in Medical Science, Director, Division of Translational Research, Department of Internal Medicine, UT-Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390-9185, USA. Tel: +1 214 648 1239; Fax: +1 214 648 4156; Email: Thomas.Kodadek{at}utsouthwestern.edu

Received November 4, 2005. Revised January 25, 2006. Accepted February 13, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sug1 and Sug2 are two of six ATPases in the 19S regulatory particle of the 26S proteasome. We have shown previously that these proteins play a non-proteolytic role in the transcription of the GAL genes in yeast. In this study, we probe the requirement for these factors in stress-induced transcription in yeast. It is known that proteasomal proteolysis is not required for these events. Indeed, proteasome inhibitors strongly stimulate expression of these stress response genes. However, shifting strains carrying temperature-sensitive alleles of SUG1 and SUG2 to the restrictive temperature strongly inhibited the expression of HSP26, HSP104 and GAD1 in response to heat shock or treatment with menadione bisulfate. Furthermore, chromatin immunoprecipitation analysis revealed the recruitment of Sug1, Sug2 and Cim5 (another of the ATPases), but not 20S proteasome core proteins, to the promoters of these genes. These data show that the non-proteolytic requirement for the proteasomal ATPases extends beyond the GAL genes in yeast and includes at least the heat and oxidative stress-responsive genes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
It has long been known that the 26S proteasome regulates the levels of a number of transcription activators, thus affecting their potency. In the last few years however, several lines of investigation have revealed a number of more intimate, and mechanistically distinct, intersections between RNA polymerase II transcription and ubiquitin/proteasome pathway proteins (16). Of particular relevance to this study was our finding that the Sug1 protein [also called Rpt6 (7)], one of the six ATPases in the 19S regulatory particle of the 26S proteasome, was essential for efficient promoter escape and elongation in Gal4-VP16-activated transcription in vitro (8,9). When Sug1 activity was compromised by mutation or by the addition of a specific anti-Sug1 antibody, the production of very short transcripts (up to {approx} 50 nt) was unaffected, but production of longer molecules was crippled. The physiologic relevance of these results was supported by the fact that certain mutations in SUG1 and SUG2 (which encodes another proteasomal ATPase) confer sensitivity to 6-azauracil, a hallmark of elongation defects. Furthermore, chromatin immunoprecipitation (ChIP) experiments revealed recruitment of Sug1, Sug2 and the other proteasomal ATPases to the GAL1/10 promoter and the GAL1 gene upon induction of GAL gene expression with galactose (10). This recruitment was dependent on a functional Gal4 transactivator. Surprisingly, there was no evidence for recruitment of the 20S proteolytic core complex to the GAL1/10 promoter in these ChIP analyses (10), even though 20S-chromatin interactions can be detected by this technique elsewhere in the gene (6). In addition, there was no indication of the presence of the ‘lid’ sub-complex (11,12) of the 19S regulatory particle. This suggested that the Gal4 activator could recruit the ATPases separate from the rest of the proteasome. This model is supported by biochemical experiments, which reveal that a GST-Gal4 activation domain (AD) fusion protein binds, a complex binds the ATPases in a fashion that excludes the lid and 20S core (10). This is also consistent with the observation that in vitro elongation was unaffected by proteasome inhibitors or the absence of the 20S core complex (8,9). On the basis of these findings, we proposed that the Gal4 activator recruits a novel sub-complex containing the six proteasomal ATPases, Rpn1, Rpn2 and perhaps other proteins, but which lacks 20S core and lid factors (10).

An important question is whether these findings in the yeast GAL system are relevant to the mechanism of transcription of other genes in yeast and higher organisms. Here we begin to address this point by analyzing the role of the proteasomal ATPases in stress-induced gene transcription in Saccharomyces cerevisiae. We show that inactivation of temperature-sensitive mutants of Sug1 and Sug2 almost completely abolish transcription of several heat and oxidative stress-induced genes. However, the expression of these genes is not dependent on the proteolytic function of the proteasome. We also use ChIP analysis to show that the proteasomal ATPases are recruited rapidly to the promoters of stress-induced genes, but 20S proteins are not. These data, combined with the previous studies of the GAL system, suggest that the proteasomal ATPases may play an important role in the transcription of many inducible genes and perhaps others as well.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
S.cerevisiae strains
W303a (MATa ade2-1 ura3-1 his3-11, 15 trp1-1 leu2-3, 112 can1-100) was used as wild type. Sc658 (sug1-20) and Sc677 (sug2-13) strains are congenic to W303a. Strain (pre1-1 pre 4-1) is congenic to WCG4a (MATa ura3 leu2-3, 112 his3-11, 15 Cans Gal+) (13). Pre1-Flag (MATa his3-200 leu2-3,112 lys2-801 trp-63 PRE1 FLAG::YIplac211[URA3]) and Cim5-Flag strains (14) were a generous gift from Prof. Raymond Deshaies (California Institute of Technology). The strains expressing Flag-Rpb3 (6) and HA-Gal11 (15) have been reported previously and are congenic to W303a.

Growth conditions and stress experiments
Heat shock experiments: wild-type (wt) cells were grown to an OD600 of 0.6 and heat shocked by the addition of the appropriate volume of heated media (54°C) followed by incubation in a water bath shaker at 37°C for 5 or 20 min. Oxidative stress experiments: 1 mM of menadione bisulfate was added to wt cells at an OD600 of 0.6 for 1 h. For temperature-sensitive strains, cells were heat shocked first at 37°C for 90 min and then treated with 1 mM of menadione bisulfate for 1 h at 37°C.

RNA analysis
Cells were diluted into YEP-ADEN media and grown until an OD600 of 0.6 treated as necessary (heat shocked and so on), and washed twice with 1x ice-cold phosphate-buffered saline (PBS). Total RNA isolation was performed by suspending the cells in 400 µl of RNA extraction buffer A [0.1 M NaCl (DEPC treat) 10 mM EDTA (DEPC treat) 5% SDS (DEPC treat) 50 mM Tris–HCl, pH 7.5]. An equal volume of phenol was then added, and the samples were incubated at 65°C for 30 min. Following centrifugation, the RNA was back-extracted with phenol, followed by chloroform. The extracted supernatant was precipitated with Buffer B (1/10 vol of 3 M NaAc and 2 vol isopropanol). Pellets were washed subsequently with 80% ethanol and suspended in 100 µl DEPC-treated water. Finally, total RNA was reverse transcribed into cDNA using the Stratagene reverse transcriptase kit.

Chromatin immunoprecipitation assays
ChIP assays were performed as described previously (10). Cells were harvested at an OD600 of 0.6 and cross-linked with formaldehyde (final concentration 1%) for 25 min. The reaction was then stopped with the addition of 2.5 M of glycine.

Cells were pelleted and washed with 1x PBS and processed for spheroblasting. To spheroblast the cross-linked pellet, cells were resuspended in 0.1 M Tris, pH 9.4, and 10 mM DTT on ice for 20 min. Cells were pelleted and resuspended in HEPES Sorbitol (20 mM HEPES, pH 7.4, 1.2 M Sorbitol) with 2 mg zymolyase and incubated at 30°C for 30 min. To quench zymolyase activity, Pipes Sorbitol (20 mM PIPES, pH:6.8, 1 mM MgCl2, 1.2 M Sorbitol) was added followed by a spin and subsequent washes with PBS, TritonX HEPES (0.25% Triton X-100, 10 mM EDTA,10 mM HEPES, pH 6.5, 0.5 mM EGTA) and NaCl HEPES (200 mM NaCl, 1 mM EDTA, 10 mM HEPES, pH 6.5, 0.5 mM EGTA). For lysis, we resuspended the cell pellet in 1 ml SDS lysis buffer (1% SDS, 10 mM EDTA, 0.1% DOC, 20 mM Tris, pH 8.1) and incubated the cells on ice for 15 min. After lysis the suspension was sonicated for 15 s twice and for 10 s three times with 30 s intervals between each shear to obtain fragments with an average length of 500 bp. For immunoprecipitations, the chromatin solution was aliquoted in IP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris, pH:8.1 and 167 mM NaCl) and specific antibodies along with salmon sperm DNA (a non-specific competitor) were added for an overnight incubation at 4°C. The immunocomplexes were harvested with the addition of protein A (Pierce) and incubated at room temperature for 2 h. The beads were then sequentially washed with TSE150 (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris–HCl, pH 8 and 150 mM NaCl), TSE500 (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris–HCl, pH 8 and 500 mM NaCl), LiCl detergent (0.25 M LiCl, 1% NP40, 1% DOC, 1 mM EDTA and 10 mM Tris–HCl, pH 8) and TE (10 mM Tris, 1 mM EDTA) and eluted with 1% SDS/0.1 MNaCO3. Formaldehyde cross-linking was then reversed overnight at 65°C. The samples were then precipitated with the addition of 2 vol of absolute ethanol overnight at –20°C, followed by a proteinase kinase A treatement. DNA was then extracted with Phenol-chloroform-isoamyl (Roche) and precipitated overnight at –20°C. Ethanol pellets were spun down for 30 min, washed with 400 µl of 70% ethanol, dried briefly and resuspended in 100–150 µl of water, dissolved and processed for PCR. Data from three independent experiments were quantified using a densitometer. The value obtained for each band was corrected for the local background. The background corrected value was divided by the intensity of the input band normalizing the reading. Those values, reflecting protein occupancy, are expressed as the amount of DNA recovered relative to the input sample. The average values were plotted graphically using Microsoft Excel software.

Primers used for ChIP and RT–PCR (5'–3') were as follows. ALONG HSP104:A, forward GTACCATAAAAT ATACAGAATATATG, reverse GC TAGAATATGTATAGGTTGTAATTG; B, forward GCTTTGGA TTTAGTTG ATATTTCTTG, reverse CCAATTCTTCTTGCAA TGAAGCTTCC; C, forward GGC AGGTTATGTC GGGTACGATGAAG, reverse GGAAGTCATGAT GACAATACAA TTGG; D, forward CAA GGATAAGGAA ACTGTCAATG TCG, reverse CTAGG TCATCATCAATTTCCATA; Chromosome IV, forward GCTCTAAATAATATTTGGATGTTGC, reverse CGAATGGCATAATTCAATTGG; HSP26, forward GGC AGCAGCAACT CCGTGTGTAC CCC, reverse GC GAATACCTTACTGTTACGAGCACC; GAD1 PROMOTER, forward GTCAAT TTAGGCATTC TTGTGATTAT, reverse CCAGCGATA TTCTCGAAGT TCTTCTG; GAD1 END OF GENE, forward GTCCA AGAAATTCCA CGAAGAATAT C, reverse GA GATGCCAA TGCCAGCA ACATTTCG; PDR5 PROMOTER, forward GTGATGTGCATAACCTTATGGCTGTTCGC, reverse GTCTAAAGTCTTTCGAACGAGCGGATACG; and HSP82 PROMOTER, forward GTCACAGATGTTAAGAATTGAAGGG, reverse GCGTGTGATATATCACATTCCGGAGG.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sug1 and Sug2 are required for the efficient transcription of heat shock genes
To ask if proteasomal ATPases are essential for expression of heat shock genes, we employed yeast strains encoding temperature-sensitive sug1 or sug2 alleles [sug1-20 (16) and sug2-13 (17,18)] and compared the levels of HSP26 and HSP104 expression at 37°C (the restrictive temperature) with that observed in the wild-type strain. As shown in Figure 1, HSP26 and HSP104 are induced strongly in the wild-type cells with a maximal steady state of RNA achieved 60 min after heat shock. However, little or no detectable transcripts from HSP26 were produced in the sug1-20 strain. A small amount of HSP26 transcript was produced in the sug2-13 strain initially, but the level was much lower than that observed in the wild-type strain and the signal disappeared by 60 min after heat shock. These results demonstrate that Sug1 and Sug2 are important for HSP26 transcription. Of course, raising the temperature to 37°C results in both induction of the heat shock response and the inactivation of the temperature-sensitive Sug proteins. The modest level of HSP26 gene expression in the sug2-13 strain was most likely due to RNA produced prior to complete Sug2-13 inactivation. Apparently, Sug1-20 loses activity more quickly at the restrictive temperature than does Sug2-13.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
 
Figure 1 Sug1 and Sug2, but not the 20S proteasome core complex, are essential for efficient heat shock gene expression. Using the strains indicated at the bottom of the figure, mRNA was extracted from cells (OD600 = 0.6) at 25°C (time = 0 in each panel) or 37°C at 45, 60 and 120 min after shifting the temperature to 37°C (the restrictive temperature). Actin levels were monitored as a control.

 
Figure 1 also shows the effect of Sug1-20 and Sug2-13 inactivation on HSP104 gene expression. The sug mutations caused significant basal expression of the gene even at 25°C relative to the wild-type strain, possibly due to an effect of these mutations on proteasome-mediated proteolysis, which could trigger a partial unfolded protein response. When the temperature was increased to 37°C, strong induction of HSP104 was observed in the wild-type strain, but the level of HSP104 transcript did not increase in the sug1-20 and sug2-13 strains, indicating that little or no new RNA was made following heat shock and inactivation of the proteasomal ATPase.

To probe the role of the 20S proteolytic core complex in HSP26 and HSP104 transcription, we employed a strain that carries temperature-sensitive alleles in the PRE1 and PRE4 genes (pre1-1/4-1) (8,13). As shown in Figure 1, shifting these strains to the restrictive temperature did not reproduce the effects of inactivation of the sug1 or sug2 alleles. Expression of HSP104 was essentially identical to that seen in the wild-type strain. Expression of HSP26 appears to be reduced slightly, but is nonetheless much more robust than when activity of the ATPases is knocked out.

Sug1 and Sug2 are also required for efficient transcription of oxidative stress inducible genes
In order to study whether Sug1 and Sug2 affect the expression of other types of stress response genes, yeast were exposed to 1 mM of the oxidant menadione bisulfate, which triggers the oxidative stress response (19). Menadione-inducible stress was first evaluated in a wild-type strain at 25 and 37°C by monitoring GAD1 expression. As shown in Figure 2, GAD1 transcript was detected in the wild-type strain at 25 and 37°C after incubating the cells for 1 h with menadione. In sug1-20 and sug2-13, GAD1 transcript was also detected at 25°C. At 37°C however, the level of transcript was reduced by 8-fold relative to the wild-type strain in sug1-20 and by 3-fold in sug2-13, showing that the Sug proteins are important in GAD1 gene expression. As was the case for the heat shock genes, the pre1-1/4-1 strain exhibited robust GAD1 expression at 37°C, again indicating that the 20S proteasome complex is not required for gene transcription. Similarly, expression of PDR5, another inducible gene affected by drugs such as menadione bisulfate, was also reduced at 37°C relative to the level observed at 25°C in these strains (Figure 2).


Figure 2
View larger version (24K):
[in this window]
[in a new window]
 
Figure 2 Sug1 and Sug2, but not the 20S proteasome core complex, are essential for expression of the oxidative stress response gene GAD1 and PDR5. The strains indicated in the figure were incubated for 2 h at the non-permissive temperature before addition of 1 mM menadione for 1 h.

 
Physical association of the proteasomal ATPases with stress promoters
We employed ChIP analysis to probe for the physical presence of proteasomal proteins at the various stress response promoters. Primers were designed to amplify the heat shock factor-binding sites (heat shock elements) upstream of HSP104. As shown in Figure 3A and B, the proteasomal ATPases, Sug1, Sug2 and Cim5/Rpt1 are all recruited to the HSP104 promoter upon heat shock within 5 min, as is RNA polymerase II (Rpb3). Amplification of a transcriptionally silent portion of the yeast genome from chromosome IV showed no signal, which, in addition to the no antibody control, confirms the specificity of the interaction of the ATPases with the promoter of HSP104. We observed the same pattern of recruitment on HSP26 promoter (Figure 3B). In addition, when the ChIP assays were repeated using the sug1-20 strain, no signal was detected at 37°C on the HSP26 promoter, whereas a strong signal was observed in the wild-type strain under these conditions (Figure 3C). These results validate the specificity of our antibody and are consistent with the absence of HSP26 transcripts in sug1-20 strain at 37°C.


Figure 3
View larger version (27K):
[in this window]
[in a new window]
 
Figure 3 The proteasomal ATPases are recruited to heat shock promoters upon induction. (A) ChIP analysis using the anti-Flag antibody and yeast strains expressing the FLAG-tagged proteins indicated in the figure was employed to monitor the association of the tagged proteins with the HSP104 promoter region including the heat shock elements at 25°C and after 5 min of heat shock (37°C). (B) The same experiments were conducted with HSP104 and the HSP26 promoter using wild-type cells and antibodies against the native proteins indicated. (C) Comparison of ChIP analyses of Sug1 recruitment to the HSP 26 promoter at 25 and 37°C in a wild-type and a sug1-20 strain. The loss of the signal in the sug1-20 strain at the restrictive temperature argues that the signal seen in the wt strain is indeed due to Sug1-promoter association and not cross-reactivity of the antibody with some other protein.

 
In contrast to the results observed for the ATPases, no heat shock-dependent recruitment of core proteasomal proteins was evident (Figure 3A and B). When the Flag-tagged Pre1 strain was employed, a low-level signal was observed prior to heat shock, which then decreased to background levels upon induction. This might indicate the presence of the 26S proteasome on the promoter prior to hear shock. When a wild-type strain and polyclonal antibodies raised against the entire 20S complex were employed, only a background signal was detected under both conditions.

We also examined interaction of the proteasomal proteins with the oxidatively-inducible GAD1 promoter using ChIP analysis. The results showed induction-dependent recruitment of Cim5 and Rpb3 but not Pre1 (Figure 4A). We obtained the same recruitment pattern for Cim5 and Sug1 on the promoters of PDR5, YCF1 and TRX1, additional genes that are highly induced upon oxidative stress (Figure 4B).


Figure 4
View larger version (18K):
[in this window]
[in a new window]
 
Figure 4 The proteasomal ATPases are recruited to oxidative stress promoters upon induction. (A) ChIP assay using anti-Flag antibody in the three Flag-tagged strains indicated in the figure. (B) The same experiments were conducted with different oxidative stress promoters using wild-type cells and Sug1 antibody.

 
ATPase recruitment is not restricted to the promoter regions of stress-inducible genes
Previous work from our laboratory revealed an important role for the proteasomal ATPases in elongation (8,9) and ChIP assays revealed association of the ATPases throughout the transcriptionally active GAL1 gene (10). To determine if a similar situation exists in the stress response genes, we employed a variety of PCR primers to assess interactions of the proteasomal proteins and RNA polymerase II with the coding region of HSP104. These experiments employed strains that express Flag-tagged Cim5, Rpb3 or Pre1 and the anti-FLAG antibody. As is evident in Figure 5, we detected the recruitment of Cim5 and Rpb3 all along the gene after heat shock. The pattern of Flag-Pre1 association was quite different. No signal could be detected with primer pairs B and C at both time points (Figure 5). As mentioned above (Figure 3), a weak signal for Flag-Pre1 was detected on the promoter prior to induction that then faded after heat shock. Curiously however, the signal grew again in intensity 20 min after heat shock, a result that we currently do not understand. Finally, Flag-Pre1 was detected at the 3' end of the gene after induction. This was expected given our previous report that the proteasome co-localizes with stalled polymerase complexes, including those undergoing termination (6).


Figure 5
View larger version (27K):
[in this window]
[in a new window]
 
Figure 5 Analysis of the physical association of Cim5, Pre1 and Rpb3 with different regions of HSP104. ChIP assays were conducted in strains expressing Flag-tagged Cim5, Rpb3 or Pre1 using anti-Flag antibody at 25°C and following heat shock (37°C) for 5 and 20 min. The regions amplified are shown graphically at the top of the figure. The graphs show the quantification of the gel data.

 
Sug1 and PolII recruitment to the HSP82 promoter appear to be separable events
In higher organisms, several heat shock promoters have been shown to contain a fully assembled and engaged RNA polymerase II complex even prior to induction, with the rate-limiting step in expression of these genes being promoter escape and elongation (20,21). Most yeast heat shock promoters apparently have somewhat different kinetics of transcription factor recruitment since PolII is not resident on the uninduced promoter of many of these genes. However, the work of Sekinger and Gross (22) has shown that the yeast HSP82 promoter is apparently more akin to higher heat shock promoters in being primed for transcription. Consistent with this view, we found that this promoter is occupied significantly by PolII even in the uninduced state, as evidenced by the strong signal observed at 25°C in cells that express FLAG-tagged Rpb3 (Figure 6A). Under non-inducing conditions, only a low level of HSP82 transcription was apparent (Figure 6B), whereas HSP82 expression was strongly stimulated by heat shock (Figure 6B). The intensity of the FLAG-Rpb3-dependent chip signal increased only modestly (~2-fold) (Figure 6A). Previous studies by Park et al. (23) in Drosophila have shown that this type of modest increase reflects polymerase density on proximal sites in the coding sequence (recall that the chromatin fragments analyzed have an average length of 500 bp). Thus, we interpret the ChIP data obtained in the FLAG-Rpb3 strain as indicating that the yeast HSP82 promoter is largely occupied by a paused RNA polymerase II complex in the uninduced state, only a small fraction of which are able to transition into productive elongation complexes. HSF is also present in the uninduced state, with only a slight increase in signal intensity observed upon heat shock (Figure 6).


Figure 6
View larger version (19K):
[in this window]
[in a new window]
 
Figure 6 (A) The recruitment of polII, Sug1 and mediator to the HSP82 promoter are separable events. Strains expressing either Flag-tagged Rpb3 or HA-Gal11 expressing strain were heat shocked for 5 min at 39°C (HS) or kept at 25°C for the same period of time (C, control). Association of the proteins indicated with the HSE-containing region of the HSP82 promoter was assessed by ChIP analysis using the appropriate antibodies. (B) HSP82 expression at 25 and 37°C.

 
Based on these observations, it seems that S.cerevisiae HSP82 affords an opportunity to determine if the proteasomal ATPases were present in a transcriptionally silent, but primed complex. To address this question, a ChIP experiment was again carried out. As shown in Figure 6, whereas Sug1 was barely detectable on the HSP82 promoter at low temparature, heat shock strongly stimulated its recruitment (Figure 6A), as was also the case for the other heat shock promoters (Figures 35). This argues that the proteasomal ATPases are not part of the paused polymerase complex.

We also addressed mediator occupancy of the HSP82 promoter in the induced and uninduced cells, since Drosophila mediator was shown to load only after heat shock (23). As is shown in Figure 6, this was also the case for the yeast HSP82 promoter. We employed a strain expressing HA-tagged Gal11 (15,24,25), a mediator component (26,27). A ChIP assay using anti-HA monoclonal antibody revealed a low-level signal for HA-Gal11 in the uninduced state, presumably reflecting the low level of basal expression. Heat shock resulted in a 7- to 8-fold increase in this signal, indicating recruitment of the mediator to the promoter upon heat shock. We conclude that, as is also the case in Drosophila, the mediator is recruited subsequent to PolII itself, arguing against the existence of a monolithic RNA polymerase II holoenzyme (28) on the uninduced HSP82 promoter. Whether or not mediator and the proteasomal ATPases are recruited to the promoter simultaneously or sequentially cannot be determined from these data, but clearly neither is part of the paused polymerase complex.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study demonstrates that the proteasomal ATPases Sug1 and Sug2 are essential for efficient transcription of several stress-induced genes in yeast. These include both heat shock and oxidative stress-responsive genes. When Sug1 or Sug2 activity was abolished by shifting temperature-sensitive strains to the restrictive temperature, transcription of these genes was crippled (Figures 1 and 2). In contrast, inactivation of temperature-sensitive 20S core proteins had little or no detectable effect on expression of these genes. Furthermore, ChIP assays revealed the induction-dependent recruitment of the proteasomal ATPases, but not the 20S core complex, to these genes (Figures 36). These results parallel those obtained in our previous studies of the GAL1/10 promoter (10) and argue that the proteasomal ATPases act in a non-proteolytic fashion to stimulate transcription of these genes. In vitro studies have revealed that this complex is required for efficient elongation (8,9) and we speculate that this is also the step for which the complex is required in stress-induced transcription.

To extend our knowledge of the role of the proteasomal ATPase complex in transcription, we also used ChIP assays to probe the point at which it is recruited to the HSP82 promoter. This promoter, unlike other yeast heat shock promoters (Figure 3), but like many heat shock promoters in higher organisms (20,21), is occupied to a substantial extent by a stalled RNA polymerase complex even in the uninduced state when only a low level of basal transcription is observed (Figure 6). However, little or no Sug1 or Gal11, a mediator component, was found associated with the HSP82 promoter in this state (Figure 6). Both were recruited upon heat shock. This experiment separates the recruitment of the PolII core complex from that of the proteasomal ATPases and mediator. Since HSF clearly activates HSP82 transcription at the level of promoter escape and elongation, this finding is consistent with our previous in vitro finding that the Sug proteins stimulate elongation (8,9). Whether the proteasomal ATPases function in concert with mediator, or these complexes play completely different roles in the transcription cycle remains to be determined.

In summary, these experiments show that the proteasomal ATPases are essential for the efficient transcription of several stress response genes and that they associate physically with the promoter and the gene itself. These activities and associations appear to be independent of the 20S proteasome core complex. Combined with our earlier studies of the GAL system (6,8,10), these studies suggest that these proteins play a direct and non-proteolytic role in the transcription of many genes.


    ACKNOWLEDGEMENTS
 
This work was supported by the National Institutes of Health (GM-071833). Funding to pay the Open Access publication charges for this article was provided by the National Institutes of Health (GM-71833).

Conflict of interest statement. None declared.


    Footnotes
 
Present address: Stephen Albert Johnston Center for Innovations in Medicine, Biodesign institute, Arizona State University, 1001 S. McAllister Avenue, Tempe, AZ 85287-5001, USA


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Salghetti, S.E., Muratani, M., Wijnen, H., Futcher, B., Tansey, W.P. (2000) Functional overlap of sequences that activate transcription and signal ubiquitin-mediated proteolysis Proc. Natl Acad. Sci. USA, 97, 3118–3123[Abstract/Free Full Text] .

  2. Salghetti, S.E., Caudy, A.A., Chenoweth, J.G., Tansey, W.P. (2001) Regulation of transcriptional activation domain function by ubiquitin Science, 293, 1651–1653[Abstract/Free Full Text] .

  3. Kim, S.Y., Herbst, A., Tworkowski, K.A., Slaghetti, S.E., Tansey, W.P. (2003) Skp2 regulates Myc protein stability and activity Mol. Cell, 11, 1177–1188[CrossRef][ISI][Medline] .

  4. Métivier, R., Penot, G., Hübner, M.R., Reid, G., Brand, H., Ko, M., Gannon, F. (2003) Estrogen Receptor-a directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter Cell, 115, 751–763[CrossRef][ISI][Medline] .

  5. Reid, G., Hübner, M.R., Metivier, R., Brand, H., Denger, S., Manu, D., Beaudouin, J., Ellenberg, J., Gannon, F. (2003) Cyclic, proteasome-mediated turnover of unliganded and liganded ERa on responsive promoters is an intergral feature of estrogen signaling Mol. Cell, 11, 695–707[CrossRef][ISI][Medline] .

  6. Gillette, T.G., Gonzalez, F., Delahodde, A., Johnston, S.A., Kodadek, T. (2004) Physical and functional association of RNA polymerase II and the proteasome Proc. Natl Acad. Sci. USA, 101, 5904–5909[Abstract/Free Full Text] .

  7. Finley, D., Tanaka, K., Mann, C., Feldmann, H., Hochstrasser, M., Vierstra, R., Johnston, S., Hampton, R., Haber, J., Mccusker, J., et al. (1998) Unified nomenclature for subunits of the Saccharomyces cerevisiae proteasome regulatory particle Trends Biochem. Sci, . 23, 244–245[CrossRef][ISI][Medline] .

  8. Ferdous, A., Gonzalez, F., Sun, L., Kodadek, T., Johnston, S.A. (2001) The 19S regulatory particle of the proteasome is required for efficient transcription elongation by RNA polymerase II Mol. Cell, 7, 981–991[CrossRef][ISI][Medline] .

  9. Ferdous, A., Kodadek, T., Johnston, S.A. (2002) A nonprotelytic function of the 19S regulatory subunit of the 26S proteasome is required for efficient activated transcription by human RNA polymerase II Biochemistry, 41, 12798–12805[CrossRef][Medline] .

  10. Gonzalez, F., Delahodde, A., Kodadek, T., Johnston, S.A. (2002) Recruitment of a 19S proteasome subcomplex to an activated promoter Science, 296, 548–550[Abstract/Free Full Text] .

  11. Glickman, M.H., Rubin, D.M., Coux, O., Wefes, I., Pfeifer, G., Cjeka, Z., Baumeister, W., Fried, V.A., Finley, D. (1998) A subcomplex of the proteasome regulatory particle required for ubiquitin-conjugate degradation and related to the COP9-signalosome and eIF3 Cell, 94, 615–623[CrossRef][ISI][Medline] .

  12. Saeki, Y., Toh-e, A., Yokosawa, H. (2000) Rapid isolation and characterization of the yeast proteasome regulatory complex Biochem. Biophys. Res. Comm, . 273, 509–515[CrossRef][ISI][Medline] .

  13. Hilt, W., Enekel, C., Gruhler, A., Singer, T., Wolf, D.H. (1993) The PRE4 gene codes for a subunit of the yeast proteasome necessary for peptidylglutamyl-peptide-hydrolyzing activity J. Biol. Chem, . 268, 3479–3486[Abstract/Free Full Text] .

  14. Verma, R., Chen, S., Feldman, R., Schieltz, D., Yates, J., Dohmen, J., Deshaies, R.J. (2000) Proteasomal proteomics: Identification of nucleotide-sensitive proteasome-interacting proteins by mass spectrometric analysis of affinity-purified proteasomes Mol. Biol. Cell, 11, 3425–3439[Abstract/Free Full Text] .

  15. Jeong, C.-J., Yang, S.-H., Xie, Y., Zhang, L., Johnston, S.A., Kodadek, T. (2001) Evidence that Gal11 protein is one of two targets of the Gal4 activation domain in the mediator Biochemistry, 40, 9421–9427[CrossRef][Medline] .

  16. Xu, Q., Singer, R.A., Johnston, G.C. (1995) Sug1 modulates yeast transcription by Cdc68 Mol. Cell. Biol, . 15, 6025–6035[Abstract] .

  17. McCusker, J.H. and Haber, J.E. (1988) crl mutants of Saccharomyces cerevisiae resemble both mutants affecting general control of amino acid biosynthesis and omnipotent translational suppressor mutants Genetics, 119, 317–327[Abstract/Free Full Text] .

  18. McCusker, J.H. and Haber, J.E. (1988) Cycloheximide-resistant temperature-sensitive lethal mutations of Saccharomyces cerevisiae Genetics, 119, 303–315[Abstract/Free Full Text] .

  19. Rodríguez-Manzaneque, M.T., Ros, J., Cabiscol, E., Sorribas, A., Herrero, E. (1999) Grx5 Glutaredoxin plays a central role in protection against protein oxidative damage in Saccharomyces cerevisiae Mol. Cell. Biol, . 19, 8180–8190[Abstract/Free Full Text] .

  20. Gilmour, D.S. and Lis, J.T. (1986) RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster Mol. Cell. Biol, . 6, 3984–3989[Abstract/Free Full Text] .

  21. Lis, J. and Wu, C. (1993) Protien traffic on the heat shock promoter: parking, stalling and trucking along Cell, 74, 1–4[CrossRef][ISI][Medline] .

  22. Sekinger, E.A. and Gross, D.S. (2001) Silenced chromatin is permissive to activator binding and PIC recruitment Cell, 105, 403–414[CrossRef][ISI][Medline] .

  23. Park, J.M., Werner, J., Kim, J.M., Lis, J.T., Kim, Y.-J. (2001) Mediator, not holoenzyme, is directly recruited to the heat shock promoter by HSF upon heat shock Mol. Cell, 8, 9–19[CrossRef][ISI][Medline] .

  24. Suzuki, Y., Nogi, Y., Abe, A., Fukasawa, T. (1988) Gal11 protein, an auxiliary transcriptional activator for genes encoding galactose-metabolizing enzymes in Saccharomyces cerevisiae Mol. Cell. Biol, . 8, 4991–4999[Abstract/Free Full Text] .

  25. Lee, Y.C., Park, J.M., Min, S., Han, S.J., Kim, Y.-J. (1999) An activator binding module of yeast RNA polymerase II holoenzyme Mol. Cell. Biol, . 19, 2967–2976[Abstract/Free Full Text] .

  26. Kim, Y.-L., Bjorklund, S., Li, Y., Sayre, M.H., Kornberg, R.D. (1994) A multiprotein mediator of transcriptional activation and its interaction with the C-terminal repeat domain of RNA polymerase II Cell, 77, 599–608[CrossRef][ISI][Medline] .

  27. Li, Y., Bjorklund, S., Jiang, Y.W., Kim, Y.-J., Lane, W.S., Stillman, D.J., Kornberg, R.D. (1995) Yeast global transcriptional regulators Sin4 and Rgr1 are components of mediator complex/RNA polymerase II holoenzyme Proc. Natl Acad. Sci. USA, 92, 10864–10868[Abstract/Free Full Text] .

  28. Koleske, A.J. and Young, R.A. (1994) An RNA polymerase II holoenzyme responsive to activators Nature, 368, 466–469[CrossRef][Medline] .


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
O. I. Koues, R. K. Dudley, A. D. Truax, D. Gerhardt, K. P. Bhat, S. McNeal, and S. F. Greer
Regulation of Acetylation at the Major Histocompatibility Complex Class II Proximal Promoter by the 19S Proteasomal ATPase Sug1
Mol. Cell. Biol., October 1, 2008; 28(19): 5837 - 5850.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
D. Laporte, B. Salin, B. Daignan-Fornier, and I. Sagot
Reversible cytoplasmic localization of the proteasome in quiescent yeast cells
J. Cell Biol., May 28, 2008; 181(5): 737 - 745.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Liu, Z. Liu, Z. Xie, J. Pang, J. Yu, E. Lehmann, L. Huynh, T. Vukosavljevic, M. Takeki, R. B. Klisovic, et al.
Bortezomib induces DNA hypomethylation and silenced gene transcription by interfering with Sp1/NF-{kappa}B-dependent DNA methyltransferase activity in acute myeloid leukemia
Blood, February 15, 2008; 111(4): 2364 - 2373.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Yu and T. Kodadek
Dynamics of the Hypoxia-inducible Factor-1-Vascular Endothelial Growth Factor Promoter Complex
J. Biol. Chem., November 30, 2007; 282(48): 35035 - 35045.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Catlow, H. L. Ashurst, A. Varro, and R. Dimaline
Identification of a Gastrin Response Element in the Vesicular Monoamine Transporter Type 2 Promoter and Requirement of 20 S Proteasome Subunits for Transcriptional Activity
J. Biol. Chem., June 8, 2007; 282(23): 17069 - 17077.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. Ferdous, D. Sikder, T. Gillette, K. Nalley, T. Kodadek, and S. A. Johnston
The role of the proteasomal ATPases and activator monoubiquitylation in regulating Gal4 binding to promoters
Genes & Dev., January 1, 2007; 21(1): 112 - 123.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Agarwal, J. Harada, J. Schreifels, P. Lech, B. Nikolai, T. Yamaguchi, S. K. Chanda, and N. V. Somia
Isolation, characterization, and genetic complementation of a cellular mutant resistant to retroviral infection
PNAS, October 24, 2006; 103(43): 15933 - 15938.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Sikder, S. A. Johnston, and T. Kodadek
Widespread, but Non-identical, Association of Proteasomal 19 and 20 S Proteins with Yeast Chromatin
J. Biol. Chem., September 15, 2006; 281(37): 27346 - 27355.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (487K) Freely available
Right arrow Screen PDF (287K) Freely available
Right arrow A corrigendum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Sulahian, R.
Right arrow Articles by Kodadek, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sulahian, R.
Right arrow Articles by Kodadek, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?