Nucleic Acids Research Advance Access originally published online on May 21, 2007
Nucleic Acids Research 2007 35(11):3784-3796; doi:10.1093/nar/gkm340
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nucleic Acids Research, 2007, Vol. 35, No. 11 3784-3796
© 2007 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Molecular Biology |
Sp1 and Sp3 regulate basal transcription of the human APOBEC3G gene
Division of Medical Biotechnology, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, D-63225 Langen, Germany
*To whom correspondence should be addressed. Tel: +49 6103 77 4000; Fax: +49 6103 77 1255; Email: floeg{at}pei.de Correspondence may also be addressed to Carsten Münk. Tel: +49 6103 77 4002; Fax: +49 6103 77 1255; Email: mueca{at}pei.de
Received March 28, 2007. Revised April 19, 2007. Accepted April 19, 2007.
| ABSTRACT |
|---|
|
|
|---|
APOBEC3G (A3G), a member of the recently discovered family of human cytidine deaminases, is expressed in peripheral blood lymphocytes and has been shown to be active against HIV-1 and other retroviruses. To gain new insights into the transcriptional regulation of this restriction factor, we cloned and characterized the promoter region of A3G. Transcriptional start sites were identified by 5'-rapid amplification of cDNA ends analysis. Luciferase reporter assays demonstrated that a 1025 bp A3G promoter sequence (from 959 to +66 relative to the major transcriptional start site) displayed constitutive promoter activity. In T cells, the A3G promoter was not inducible by mitogenic stimulation, interferon treatment or expression of HIV-1 proteins. Using a series of 5' deletion promoter constructs in luciferase reporter assays, we identified a 180 bp region that was sufficient for full promoter activity. Transcriptional activity of this A3G core promoter was dependent on a GC-box (located at position 87/78 relative to the major transcriptional start site) and was abolished after mutation of this DNA element. Electrophoretic mobility shift assays and chromatin immunoprecipitation assays demonstrated that the identified GC-box represented a binding site for the ubiquitous transcription factors specificity protein (Sp) 1 and Sp3.
| INTRODUCTION |
|---|
|
|
|---|
The recently discovered APOBEC3 family of cytidine deaminases is considered to play an important role in antiviral intrinsic immunity (1,2). In primates, the seven paralogs APOBEC3A, B, C, DE, F, G, H (A3A-H) have been described (3), and they appear to fulfill individual functions. Human APOBEC3G (A3G), the most prominent member of the APOBEC3 family has been identified as the cellular restriction factor that is responsible for inhibition of virion infectivity factor (Vif)-deleted human immunodeficiency virus-1 (HIV-1) replication in non-permissive cells (4). A3G is packaged into HIV-1
vif particles and causes C-to-U deaminations on the single-stranded viral DNA during reverse transcription (58). This leads to degradation of the uracile-containing DNA by cellular repair mechanisms or to hypermutation of the viral genome (5,6). As a result, only a marginal fraction of the A3G-containing HIV-1 particles is able to complete the replication cycle. In addition to the inhibition of HIV-1, A3G restricts replication of other lentiviruses, gammaretroviruses, deltaretroviruses, spumaviruses, long-terminal-repeat (LTR)-retrotransposons, orthohepadnaviruses and avihepadnaviruses (921). Interestingly, deamination seems not to be the only A3G-mediated antiviral mechanism; in the case of hepatitis B virus (HBV) and human T cell leukemia virus type 1 (HTLV-1), A3G was shown to restrict virus replication by deamination-independent mechanisms (12, 13, 19, 2225). Another member of the APOBEC3 family, APOBEC3F (A3F), appears to have similar activities like A3G (26,27). A3F is also packaged into HIV-1
vif particles and induces similar C-to-U deaminations, although the proteins differ in their target sequences specificity (26,28). Furthermore, A3F proteins were detected in many tissues that express A3G and are able to form heteromultimers with A3G (26,29,30). Both proteins localize to mRNA processing (P) bodies, cytoplasmic compartments involved in the degradation and storage of non-translating mRNAs (30,31). A3G has been shown to be expressed in T cells, a relevant cell target for HIV-1 in vivo, but little is known about its regulation (4,29,32). There is a report describing that mitogenic stimulation of T cells upregulates A3G mRNA levels, but this was not analyzed on the transcriptional level (33). Since the A3G promoter has not been systematically analyzed so far, our aim was to clone the A3G promoter and characterize its regulation in T cells. In our study, we observed that A3G uses multiple transcriptional start sites (TSS). By generating a series of 5' deletions of the A3G promoter, we identified a 180 bp region that mediated basal transcription. In T cells, transcriptional activity of this core promoter was not inducible by mitogenic stimulation or interferon treatment, but was dependent on a GC-box which was recognized by Sp (specificity protein) 1 and Sp3 transcription factors.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture
The human T cell lines A3.01 and PM1 (NIBSC, UK) and the human myeloid cell line U937 (NIBSC, UK) were grown in complete RPMI 1640 medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine and 100 U/ml penicillinstreptomycin. The human hepatic cell lines HepG2 and Huh7 (kindly provided by Dr Thomas Pietschmann, Department of Molecular Virology, University of Heidelberg) as well as HeLa cells were maintained in Dulbecco's high glucose modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM L-glutamine and 100 U/ml penicillinstreptomycin. Cells lines were incubated at 37°C with 100% humidity in 57% CO2 and passaged using standard cell culture techniques.
Plasmids
For cloning of an APOBEC3G promoter-driven reporter plasmid, genomic DNA was prepared from the T cell line PM1 using the DNeasy Kit (Qiagen). The DNA sequence ranging from positions 959 to +66 relative to the identified transcription start was amplified via PCR using the primers 3Gprom1025 (5'-TGTGAACGCGTTGCTGCAGGCCATCTGGATGTATATG-3') and 3Gpromreverse (5'-ACAGCAGATCTAGGGACCTCTGATAAAGACAGG-3'). PCR reactions were performed with Pwo DNA Polymerase (Roche) using the following cycle conditions: one cycle 94°C for 2 min; 30 cycles 94°C for 30 s, 58°C for 60 s, 72°C for 60 s; one cycle 72°C for 7 min. The amplicon was ligated into the promoterless luciferase reporter plasmid pGL3-Basic (Promega) via MluI and BglII restriction sites, which were introduced by the primers. The resulting construct contained 1025 bp of the A3G promoter and was designated pGL3-APOprom1025. Reporter plasmids containing shorter fragments of the APOBEC3G promoter were constructed using pGL3-APOprom1025 as template and the following forward primers: for plasmid pGL3-APOprom502 (containing sequence 436/+66): 3Gprom502 (5'-TGTGAACGCGTTCCATAACATGGGGACAAGA-3'); for plasmid pGL3-APOprom225 (containing sequence 159/+66): 3Gprom225 (5'-TGTGAACGCGTCGAGGGCAGGATCCGGGAGT-3'); for plasmid pGL3-APOprom180 (containing sequence 114/+66): 3Gprom180 (5'-TGTGAACGCGTTCTTGATGGTGGAGAGGAGG-3'); for plasmid pGL3-APOprom150 (containing sequence 84/+66): 3Gprom150 (5'-TGTGAACGCGTGCGGGACCACCAGGGGAGGGGCTT-3'); for plasmid pGL3-APOprom120 (containing sequence 54/+66): 3Gprom120 (5'-TGTGAACGCGTTGCTGGCTCAGCCTGGTGTG-3'); for plasmid pGL3-APOprom60 (containing sequence +7/+66): 3Gprom60 (5'-TGTGAACGCGTCCCTTTGCAATTGCCTTG-3'); each in combination with the reverse primer 3Gpromreverse (described above). PCR reactions were performed with Pfu Ultra Hotstart (Stratagene) using the following cycle conditions: one cycle 94°C for 2 min; 30 cycles 94°C for 45 s, 58°C for 45 s, 72°C for 60 s; one cycle 72°C for 7 min. As for pGL3-APOprom1025, MluI and BglII restriction sites were introduced via the primers and PCR products were ligated into pGL3-Basic (Promega) via these restriction sites. pGL3-APOprom180mut carries two point mutations (bold) and was generated using the primer 3GProm180mut (5'-TGTGAACGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGTTCGGGACCACCAG-3') in combination with primer 3Gpromreverse. This PCR was performed with an annealing temperature of 65°C. pGL3promE1 (containing nucleotides 114/85) and pGL3promE2 (containing nucleotides 92/63) were constructed by annealing the following single-stranded oligonucleotides: 114_85Plus (5'- CGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGGA-3') and 114_85Minus (5'- GATCTCCAGCTGGAGCCTCCTCTCCACCATCAAGAA-3') or 92-63Plus (5'-CGCGTCCAGCTGGGCGGGACCACCAGGGGAGGGGCA-3') and 92_63Minus (5'-GATCTGCCCCTCCCCTGGTGGTCCCGCCCAGCTGGA-3'). After annealing, the double-stranded oligonucleotides which contained the respective 30 bp of the APOBEC3G promoter and sticky ends compatible with MluI and BglII restriction sites were ligated into the pGL3-Promoter (Promega) vector. The sequences of all constructed plasmids were verified by sequence analysis. Nucleotide 219 of the cloned APOBEC3G promoter differs from the sequence in the database (GenBankTM accession number DQ147772
[GenBank]
). An A-to-C substitution is present at this position. Numbering is relative to the major transcriptional start site we identified.
The reporter plasmids pGL3-Control and phRG-TK were purchased from Promega. pGL2-CVX contains two repeats of the IFN-responsive GAS (gamma activated sequence) elements (GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG) of the guanylate-binding protein (GBP) gene in front of a CMV minimal promoter and was kindly provided by Ute Pägelow and Mario Köster from the Helmholtz-Zentrum für Infektionsforschung. Plasmid pNL4-3 (NIBSC, UK) contains the full-length HIV-1NL4-3 genome and has been described previously (34). pcDNA3.1Vif was generously provided by Nathaniel R. Landau from the Salk Institute, La Jolla. It was generated by amplifying the Vif gene from pNL4-3 and ligating it into the pcDNA3.1 vector via BamHI and XhoI restriction sites. A 3'-WPRE element was included into the XhoI site. pBS-kRSPA-TatHIV-1(NL4-3) was constructed by amplifying the two exons of Tat via PCR reaction using the molecular clone pNL4-3 as template and the following primer sets: exon1, 5ÜXho1HIV-Tat1Plus (5'-GCATGCTCGAGATGGAGCCAGTAGATCCTAG-3') and HIV-Tat1Minus (5'-TGCTTTGATAGAGAAGCTTGATG-3'); exon2, 15FHIV-Tat2Plus (5'-TTCTCTATCAAAGCAACCCACCTCCCAATCCCG-3') and 5ÜSpe1HIV-Tat2Minus (5'-GACGTACTAGTCTATTCCTTCGGGCCTGTC-3'). XhoI and SpeI restriction sites were introduced via the primers. The sense-primer of exon2 starts with a 15-mer which is homologous to the 3' end of exon1 and necessary for fusion of both exons. PCRs were performed with Expand High Fidelity PCR System (Roche) using the following conditions: one cycle 94°C for 3 min; 35 cycles 94°C for 45 s, 55°C for 45 s, 68°C for 45 s; one cycle 68°C for 7 min. For fusion of both exons, the following PCR conditions were applied: one cycle 94°C for 3 min; 35 cycles 94°C for 45 s, 58°C for 45 s, 68°C for 60 s. After 10 cycles without primers, the sense-primer of exon1 and the antisense-primer of exon2 were added for the remaining cycles. The resulting amplicon was ligated into the pBS-kRSPA vector (35) via XhoI and SpeI restriction sites.
5'-Rapid amplification of cDNA ends analysis (RACE)
Total RNA was isolated from A3.01 T cells using RNeasy mini kit (Qiagen). The transcriptional start sites of A3G were identified using the 5'/3' RACE Kit, 2nd Generation (Roche) according to the manufacturer's instructions. The following primers were used: RACE-APO3G1 (5'-TATCCCTTGTACACTTTGT-3') for cDNA synthesis, RACE-APO3G2 (5'-CATACTCCTGGTCACGAT-3') for the first PCR and RACE-APO3Gnest (5'-GAATACACCTGGCCTCGAA-3') for the nested PCR. Reaction products were analyzed by agarose gel electrophoresis, purified using QIAquick gel extraction kit (Qiagen), T/A-cloned into vector pCR4-TOPO (Invitrogen) and sequenced.
Luciferase assay
For transient transfection of A3.01 and U937 cells, DMRIE-C transfection reagent (Life Technologies) was used (36). Cells were seeded in 6-well tissue culture plates (5 x 105 cells per well) in 1.5 ml Opti-MEM (Life Technologies) containing 0.5 µg firefly luciferase reporter plasmid and 3.5 µl DMRIE-C. After 45 h of incubation, 1.5 ml complete RPMI medium were added. HepG2 and Huh7 cell lines were transfected using LipofectAMINE Plus as recommended by the manufacturer (Life Technologies). Briefly, exponential growing cells (1.5 x 106) were transfected with 5 µl LipofectAMINE, 6 µl PLUS reagent and the required amount of plasmid DNA in a final volume of 1 ml Opti-MEM. Following 4 h of incubation, cells were washed in PBS and 3 ml of complete DMEM medium were added.
For cotransfection of reporter plasmids and siRNA into HeLa cells, HiPerfect transfection reagent (Qiagen) was used according to the manufacturer's protocol for cotransfection of adherent cells with siRNA and plasmid DNA.
Two days after transfection of the respective cell lines, cells were harvested in 100 µl (suspension cells) or 300 µl (adherent cells) of Passive Lysis Buffer (Promega) and luciferase assay was performed using the Dual Luciferase Assay System (Promega) according to the manufacturer's instructions. As an internal control, 50 ng (adherent cells) or 100 ng (suspension cells) of ph-RG-TK plasmid (Promega), which constitutively expresses renilla luciferase was cotransfected in every sample and firefly luciferase activities were normalized to renilla luciferase activities. Mean values (±SD) of a representative experiment performed in triplicate are shown in the figures. For stimulation of cells, final concentrations of 20 ng/ml TPA (Sigma) or 30 ng/ml IFN-
or 30 ng/ml IFN-
(Tebu-Bio) were applied approximately 15 h before harvesting for luciferase assay.
Electrophoretic mobility shift assay (EMSA)
For preparation of nuclear extracts, 5 x 106 A3.01 T cells were washed in cold PBS and resuspended in 500 µl buffer A (10 mM HEPES pH7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM PMSF). After incubation for 15 min on ice, swollen cells were pressed 10 times through a syringe with a 26G needle and centrifuged at 5000 r.p.m. for 5 min. Pellets contained the nuclei and were washed in buffer A for two times and resuspended in 50 µl buffer C (20 mM HEPES pH 7.9, 400 mM NaCl, 1 mM EDTA, 1 mM EGTA 1 mM DTT, 1 mM PMSF). After shaking for 30 min at 4°C and centrifugation for 10 min at 13 000 r.p.m., supernatants were used as nuclear extracts.
EMSA probes were generated by annealing the following complementary oligonucleotides: APO-Sp1/3, 5'- CCAGCTGGGCGGGACCACCAGGGGAGGGGC-3' and 5'-GCCCCTCCCCTGGTGGTCCCGCCCAGCTGG-3'; APO-Sp1/3mut, 5'- CCAGCTGTTCGGGACCACCAGGGGAGGGGC-3' and 5'- GCCCCTCCCCTGGTGGTCCCGAACAGCTGG-3' according to standard procedures. Nucleotides differing from the original promoter sequence are shown in bold type. A commercially available Sp1 probe (sc-2502, referred to as Sp1cons) was purchased from Santa Cruz Biotechnology. The double-stranded oligonucleotides were 5' end-labeled using T4 polynucleotide kinase (New England Biolabs) and [
-32P]ATP (3000 Ci/mmol, Amersham) and purified by using Nick G50 columns (Amersham).
For EMSA, 5 µg of nuclear proteins were preincubated on ice with 2 µg of poly(dI-dC) (Roche) as an unspecific competitor and 1 µg of bovine serum albumin in band shift buffer (50 mM Tris, 150 mM KCl, 5 mM EDTA, 2.5 mM dithiothreitol, 20% Ficoll) for 15 min. 32P-labeled oligonucleotides (50 000 c.p.m.) were added in a total volume of 20 µl, incubated on ice for 20 min and loaded onto 5% native polyacrylamide gels in 0.5xTris-borate-EDTA buffer. Upon fractionation, gels were dried and exposed for autoradiography. For competition experiments, 1- or 30-fold molar excess of the unlabeled APO-Sp1/3 or APO-Sp1/3mut oligonucleotides was added to the preincubation mixture. For supershift experiments, 2 µg Sp1 antibody (sc-59x, Santa Cruz Biotechnology) or Sp3 antibody (sc-644x, Santa Cruz Biotechnology) were added to the preincubation mixture and preincubation time was extended to 30 min.
Chromatin immunoprecipitation (ChIP) assay
A3.01 cells were treated with RPMI culture medium containing 1% formaldehyde for 10 min. at 37°C. Cells were washed twice with ice-cold PBS and incubated for 10 min. on ice after resuspension in SDS lysis buffer (ChIP Assay Kit, Upstate). After centrifugation, pellets were resuspended in MNase reaction buffer (10 mM Tris-HCl pH 7.5, 10 mM NaCl, 3 mM MgCl2, 1 mM CaCl2, 4% NP-40). DNA digestion was performed using 50 U Micrococcal Nuclease (Fermentas) and 1 x 107 cells per tube in a volume of 1.5 ml. After 2 min, reaction was stopped by adding 30 µl 200 mM EGTA. Further steps were performed using the Chromatin Immunoprecipitation Assay Kit (Upstate) according to the manufacturer's instructions. 1 x 107 cells and 2 µg antibody (Sp1(Pep2) sc-59, Sp3(D-20) sc-644 or actin(H-196) sc-7210, Santa Cruz Biotechnology) were used for each immunoprecipitation. All buffers were freshly supplied with protease inhibitors. After phenol/chloroform extraction and ethanol precipitation, DNA was resolved in 16 µl H2O. Immunoprecipitated DNA was detected by nested PCR using 4 µl of the resolved DNA in the first PCR, and 1 µl for the nested PCR. For amplification of the A3G promoter, the following primers were used: ChIP3Gplus 5'-ccacggtggcctccgagggtga-3' and ChIP3Gminus: 5'-ctctccaccatcaagacagac-3' (1. PCR); ChIP3G2plus: 5'-tactctccctccctgtcccca-3' and ChIP3G nested minus: 5'-aggctgatgcctccgcag-3' (nested PCR). Taq polymerase (Qiagen) was used together with the following cycle conditions: one cycle 94°C for 2 min; 30 cycles 94°C for 30 s, 60°C for 60 s, 72°C for 2 min; one cycle 72°C for 10 min. As a negative control, a region in the A3G gene was targeted using the primers ChIP3Gneg_plus: 5'-taagtaccacccagagatgag-3' and ChIP3Gneg_minus: 5'-catgatcttcatggtggcacg-3' for both PCR steps. PCR conditions were the same as for the A3G promoter sequence, with the exception that annealing temperature was decreased to 55°C.
RNA interference and western blot analysis
Sp1 and Sp3 translation was silenced in HeLa cells using the siRNA duplexes Hs_SP1_1_HP and Hs_SP3_1_HP (Qiagen). A nonspecific siRNA (Qiagen) was used as control. HeLa cells were transfected with 150 or 300 ng siRNA per 6-well, using the HiPerfect transfection reagent (Qiagen) according to the manufacturer's protocol for reverse transfection of adherent cells in 6-well plates.
Forty-eight hours after transfection, HeLa cells were harvested for detection of Sp1 and Sp3 proteins. Cells were washed in PBS, lysed in RIPA (25 mM Tris pH 8.0, 137 mM NaCl, 1% Glycerol, 0.5% sodium deoxycholate, 1% NP-40, 2 mM EDTA pH 8, 0.1% SDS and protease inhibitors) and lysates were cleared by centrifugation. After boiling with Laemmli's buffer, samples were subjected to SDSpolyacrylamide gel electrophoresis followed by transfer to a nitrocellulose membrane. Sp1 and Sp3 proteins were detected using
-Sp1(Pep2) antibody (sc-59, Santa Cruz) or
-Sp3(D-20) antibody (sc-644, Santa Cruz) followed by incubation with
-rabbit-HRP (Amersham Biosciences). For detection of tubulin,
-tubulin (B5-1-2, Sigma) and
-mouse-HRP (Amersham Biosciences) antibodies were used. Signals were visualized by enhanced chemiluminescence (ECL, Amersham Biosciences).
| RESULTS |
|---|
|
|
|---|
Characterization of the transcriptional start sites of APOBEC3G by 5'-RACE
To identify the transcriptional start sites (TSS) of APOBEC3G (A3G) in A3.01 T cells, we performed 5'-rapid amplification of cDNA ends analysis (RACE) with A3G-specific primers (see Figure 1). Agarose gel electrophoresis resolved the nested PCR products into three bands of different electrophoretic mobility with a dominant middle band (Figure 2). For each band, the DNA was cloned and sequence analysis of six or seven individual transformants was performed. We observed that the transcriptional start sites of the A3G gene were located between 58 and 361 nt upstream of the ATG start codon (Figure 1). Although TSS were variable and most sites were only detected once among the 19 clones analyzed, one TSS was identified in six individual clones. This TSS was located 66 nt upstream of the start of the published A3G mRNA sequence (GenBankTM accession number NM021822) and we defined this position as the major transcriptional start site of the A3G gene.
|
|
The core promoter of A3G is located within the region 114/+66 relative to the TSS
For characterization of the A3G promoter, we cloned the 1025 bp located at position 959/+66 relative to the identified transcription start into the promoterless pGL3-Basic luciferase reporter plasmid and designated the plasmid pGL3-Basic-APOprom1025. Similarly, pGL3-APOprom502 (containing sequence 436/+66), pGL3-APOprom225 (containing sequence 159/+66) and further 5' deletion reporter constructs containing 180, 150, 120 or 60 bp upstream of position +65 were generated (Figure 3A). In order to analyze transcriptional activity, the luciferase reporter plasmids were transiently transfected into A3.01 T cells. Luciferase assays revealed a
20-fold increased transcriptional activity of the 1025 bp sequence as compared to the empty vector, indicating that we had identified an active A3G promoter sequence (Figure 3B). This transcription rate was not significantly altered by the 5' deletions leading to the 502, 225 and 180 bp fragments (Figure 3B). In contrast, a drop in luciferase activity was observed in the case of the 150 bp fragment. This construct only retained 28% of the transcriptional activity of the 180 bp promoter in A3.01 T cells and activity of the 120 bp fragment was further reduced. Comparable reductions relative to the activity of 180 bp fragment were observed in the myeloid cell line U937 and the hepatic cell lines HepG2 and Huh7 (Figure 3C), indicating that the core promoter of A3G is located within the region 114/+66 relative to the TSS.
|
The A3G promoter is not inducible in T cells
According to the current knowledge, APOBEC3G plays a role in the innate defence against pathogens like HIV-1. The latter has evolved a mechanism to counteract A3G activity by expressing the regulatory protein Vif (4). Vif induces proteasomal degradation of A3G and additionally inhibits A3G activity by further mechanisms (8, 3743). To investigate whether the overexpression of HIV-1 proteins also influences A3G promoter activity, we either expressed HIV-1 Vif or the HIV-1 Tat protein, the latter has been shown to activate different viral and cellular promoters (44,45). In addition, increasing amounts of the plasmid pNL4-3, containing the full-length genome of HIV-1, were transfected. These constructs or the empty vector pcDNA3.1 were cotransfected with the 1025 bp construct into A3.01 T cells. Luciferase assays showed that the transcriptional activity of the A3G promoter was not significantly altered in the presence of Vif, Tat or HIV-1NL4-3 (Figure 4A), suggesting that HIV-1 is not modulating A3G expression on the transcriptional level.
|
It has been shown that the amount of A3G mRNA in T cells is increased in response to mitogenic stimulation with phorbol ester (4648). In addition, interferons have been described to upregulate A3G expression in hepatocytes and macrophages (46,48). To investigate whether these stimuli interfere with A3G promoter activity in T cells, we transfected A3.01 T cells with the 1025 bp promoter or the empty vector pGL3-Basic (vector) and treated the cells with phorbol ester (TPA). The luciferase assay showed that the
15-fold increased transcriptional activity of the 1025 bp promoter relative to the empty vector was not further enhanced by TPA treatment (Figure 4B), although the functional activity of TPA was confirmed by induction of the SV40 promoter-containing reporter plasmid pGL3-Control (data not shown). Similarly, treatment of A3.01 T cells transfected with the A3G promoter deletion constructs with IFN-
or IFN-
showed no effect (Figure 4C). Interestingly, a control plasmid (pGL2-CVX) containing two IFN-responsive GAS (gamma activated sequence) elements upstream of the luciferase reporter gene was only induced by IFN-
in these cells (Figure 4C). Since two reports describe A3G upregulation by interferons in hepatocytes (47,48), we additionally performed the experiment in the hepatic cell line HepG2. In line with these publications, we observed an induction of the A3G promoter by approximately 2-fold after IFN-
or IFN-
stimulation (Figure 4D) with IFN-
being slightly more potent. For both interferon types, induction of A3G promoter activity was observed for all deletion constructs except for the 60 bp fragment, indicating that the responsible region is located within the 60 nt present in the 120 bp, but not in the 60 bp fragment.
A GC-box located at position 87/78 of the A3G promoter is important for transcriptional activity
The reporter studies shown in Figure 3 had demonstrated a drop in luciferase activity after deletion of the 30 nt at the 5' end of the 180 bp core promoter. We therefore inspected the 30 bp sequence deleted in the 150 bp fragment and identified a GC-box at position 87/78 (see Figure 1). The sequence TGGGCGGGAC, which is interrupted in the 150 bp fragment, represents a variant of the (G/T)GGGCGG(G/A)(G/A)(C/T) consensus motif recognized by Sp1 and Sp3 transcription factors. To analyze whether this putative Sp1/Sp3-binding site mediates transcriptional activity of the 180 bp core promoter, we introduced two point mutations which changed the sequence from TGGGCGGGAC to TGTTCGGGAC (mutations shown in bold). This resulted in a 71% reduction of the transcriptional activity compared to the unmodified 180 bp promoter (Figure 5A) and this value was only marginally higher than the luciferase activity of the 150 bp fragment, indicating that the identified motif is essential for basal activity of the A3G core promoter. To further examine the transcriptional potency of the 30 nt present in the 180 bp promoter, we cloned the region 114/85 (containing all nucleotides which are deleted in the 150 bp fragment, designated E1) or the region 92/63 (containing the putative Sp1/Sp3 motif, designated E2) into the vector pGL3-Promoter (see Figure 1). This vector contains a luciferase reporter gene under the control of an SV40 promoter without enhancer sequences, and putative transcriptionally active sequences can be cloned upstream of the SV40 promoter. Luciferase assays showed that the E1 element increased SV40 promoter activity only by
2-fold (Figure 5B). In contrast, the 30 nt of E2 enhanced the transcriptional activity of the SV40 promoter by
4.3-fold, indicating that the intact GC-box present in the E2 element was responsible for the strongly enhanced transcriptional activity of the SV40 promoter.
|
Sp1 and Sp3 transcription factors bind to the GC-box at position 87/78 of the A3G promoter
To investigate whether the GC-box represents a binding site for the transcription factors Sp1 and Sp3, we performed EMSA analyses with nuclear extracts isolated from A3.01 T cells. As probes, we radioactively labeled the unmodified E2 sequence (nucleotides 92/63 of the A3G promoter, probe designated APO-Sp1/3) or the same region carrying the two point mutations described above (probe designated APO-Sp1/3mut). As control, we used a commercially available Sp1 consensus oligonucleotide (Sp1cons), which is known to be recognized by Sp1 transcription factors. Four DNAprotein complexes were observed in the presence of the APO-Sp1/3 probe (Figure 6A). The upper two complexes were specific since they disappeared in the presence of a 30-fold molar excess of unlabeled APO-Sp1/3 probe (Figure 6A, lane 7). Further confirmation of the specificity of these DNAprotein complexes was demonstrated by the inability of the unlabeled APO-Sp1/3mut probe to abolish binding (Figure 6A, lanes 12 and 13). As expected, the two specific complexes were also present in the case of the Sp1cons control probe (Figure 6A, lanes 2 and 3). In contrast, none of these specific complexes was observed when the mutated probe was used (Figure 6A, lanes 10 and 11), confirming that protein binding was dependent on the identified GC-box. In order to characterize the complexes, we performed supershift experiments using Sp1- and Sp3-specific antibodies. The upper of the complexes that appeared in combination with the Sp1cons or APO-Sp1/3 probes, shifted in the presence of the Sp1 antibody (Figure 6B, lanes 3 and 7), whereas the lower complex shifted in the presence of the Sp3 antibody (Figure 6B, lanes 4 and 8). Taken together, the EMSA demonstrated that the GC-box located on the A3G core promoter serves as a binding site for Sp1 and Sp3.
|
To show binding of Sp1 and Sp3 factors also in the context of the endogenous A3G promoter, a chromatin immunoprecipitation (ChIP) assay was performed. Sp1 and Sp3 antibodies, but not an actin antibody, immunoprecipitated the A3G promoter in A3.01 T cells (Figure 6C, upper panel). In contrast, no PCR signal was received with a primer pair recognizing a region in the A3G gene
4000 bp downstream of the Sp1/Sp3binding site (Figure 6C, lower panel). Only the positive controls showed a DNA band, with an A3G expression plasmid or the sheared and cross-linked input DNA used as template. This demonstrates the binding of Sp1 and Sp3 transcription factors to the endogenous A3G promoter.
Silencing of Sp1 and Sp3 reduces A3G promoter activity
To confirm the role of Sp1 and Sp3 in regulation of A3G promoter activity, we silenced their translation via RNA interference. Functionality of the siRNAs directed against Sp1 or Sp3 was confirmed by western blot analysis: protein levels of Sp1 as well as the long and short isoforms of Sp3 were strongly reduced in the presence of 150 or 300 ng specific siRNA (Figure 7A). An unspecific control siRNA had no influence (Figure 7A). We then cotransfected the luciferase reporter plasmid containing the 180 bp A3G promoter together with 100 ng siRNA using an optimized protocol for the cotransfection of plasmid plus siRNA. This resulted in a 3143% reduction of luciferase activity in the presence of Sp1- or Sp3-specific siRNA compared to the control siRNA. In contrast, no influence on transcriptional activity of the 150 bp fragment, which does not contain the Sp1/Sp3-binding motif, was observed. Thus, both Sp1 and Sp3 factors are mediating transcriptional activity of the A3G promoter.
|
| DISCUSSION |
|---|
|
|
|---|
Shortly after the discovery of APOBEC3G, it became clear that this human gene plays an important role in antiretroviral defense (4). Originally identified as a restriction factor of HIV-1 infection, expression of APOBEC3G was found in human peripheral blood lymphocytes and macrophages, which represent the main target cells for HIV-1 (32). In addition, the protein was detected in lung, liver, spleen, testis and ovary, but little is known about its transcriptional regulation (29,32,47). To address this question, we cloned the human APOBEC3G promoter and analyzed its regulation in T cells. Applying 5'-RACE, we identified multiple start sites for transcription of the A3G gene. This observation is consistent with the fact that the gene appears to lack canonical CCAAT and TATA boxes (32), a condition often associated with multiple transcriptional start sites (4951). However, one single start site was detected in 6 of 19 clones and was designated as +1. This TSS is located 66 bp upstream of the start of the published mRNA sequence (GenBankTM NM021822).
We cloned a 1025 bp promoter, which ranges from position 959/+66 relative to the identified TSS. Luciferase reporter assays showed that this promoter was transcriptionally active in A3.01 T cells. Treatment with the phorbol ester TPA did not further enhance transcriptional activity, although upregulation of A3G mRNA levels in T cells by TPA has been described (33). Rose et al. used actinomycin D to block further transcription and did not find evidence for enhanced mRNA stability. Therefore, the authors suggested that an enhanced transcription rate could be responsible for the increased amount of A3G mRNA after TPA treatment. However, the promoter analysis we performed indicates a different mechanism that is independent of transcriptional regulation. In addition, we observed that the A3G promoter was not inducible by IFN-
or IFN-
in A3.01 T cells, whereas in the hepatic cell line HepG2, a moderate induction was measured. It has been described previously that A3G gene expression is upregulated by interferons in hepatocytes and macrophages (4648, 52). In this context, two interferon-responsive elements have been identified at the positions 6/+9 and +1/+15 relative to the TSS (48). Consistent with this data, we observed an interferon induction in hepatocytes for the fragments ranging between 1025 and 120 bp length. The activity of the 60 bp fragment that does not contain these motifs was not affected. Thus, the induction we observed was most likely mediated by the described interferon-responsive elements. However, according to our results, these motifs can enhance transcription in hepatic cells, but not in T cells. This is surprising, since IFN-
-inducible signaling cascades are present in A3.01 T cells: we showed that the control plasmid harboring interferon-responsive GAS elements was markedly induced by IFN-
treatment. In contrast, the GAS element was not responsive to IFN-
treatment in these cells, suggesting that our T cell line was not able to mediate IFN-
-induced signals. So far, enhanced A3G promoter activity by interferons is clearly described in hepatocytes and macrophages, whereas the situation in T cells is still unclear. A recent study found no influence of IFN-
or IFN-
on A3G expression in resting primary blood lymphocytes (52). Another publication describes an enhanced expression of A3G after IFN-
treatment in resting primary CD4 T cells, but not in activated T cells (53). This observation is not contradictory to our results since T cell lines are mitotically active and therefore rather in an activated than in a resting state. In conclusion, the current data suggests that regulation of the A3G promoter activity by interferons is dependent on the cell type and possibly also from the cellular activation status.
We additionally analyzed the influence of HIV-1 proteins on A3G promoter activity. The HIV-1 Vif protein is neutralizing the antiviral function of A3G by a multitude of ways. Targeting the A3G protein for proteasomal degradation is considered to be the main mode of action (3741), but it becomes more and more clear that other mechanisms are also involved. There is evidence that Vif also promotes exclusion of A3G from the virus particles and an influence on the A3G translation process is discussed (8,42,43). The question whether Vif alters transcription controlled by the A3G promoter has not been analyzed so far. Our analysis indicates that transcription from the A3G promoter is unaffected by Vif or other HIV-1 proteins. Taken together, in T cell lines, the A3G promoter appears constitutively active.
By generating a series of 5' deletions, we showed that the core promoter is located within the region 114/+66 relative to the TSS. This 180 bp promoter was transcriptionally active in the lymphoid, myeloid and hepatic cell lines we tested, indicating that ubiquitous transcription factors are involved in regulation of A3G gene transcription. A GC-box with the sequence TGGGCGGGAC was identified at position 87/78 of the A3G promoter. This GC-box is essential for basal promoter activity, since changing the motif to TGTTCGGGAC by introducing two point mutations strongly reduced A3G promoter activity. The transcriptional potency of the GC-box was further demonstrated by cloning it upstream of an SV40 promoter. This resulted in a 4-fold enhanced transcription rate. The hypothesis that a general transcription factor is involved in regulation of A3G transcription was confirmed by EMSA. Supershift analysis showed that the transcription factors Sp1 and Sp3 which are ubiquitously expressed in mammalian cells, bind specifically to the identified motif. In addition, the binding of Sp1 and Sp3 to the endogenous A3G promoter was demonstrated by a chromatin immunoprecipitation assay. This observation is consistent with the results of the 5'-RACE, since Sp1 is known to play an important role for RNA polymerase II to bind to the transcription initiation site in TATA-boxless promoters and is associated with multiple transcription initiation sites (5456). We also tested whether overexpression of Sp1 or Sp3 proteins had an influence on A3G promoter activity. Luciferase assays revealed that A3G promoter activities remained unchanged (data not shown), most probably due to the high basal expression level of the endogenous Sp1 and/or Sp3 proteins. The Sp family of transcription factors is involved in transcriptional regulation of many housekeeping, tissue-specific, viral and inducible genes (57). Whereas Sp1 typically acts as an activator, Sp3 can serve as a repressor or activator (57). However, in the context of the A3G promoter, both transcription factors serve as activators, as shown by siRNA-mediated silencing of the single factors. Although siRNAs directed against Sp1 or Sp3 significantly reduced transcription controlled by the 180 bp promoter, transcriptional activity was not reduced to the level of the 150 bp fragment. This can be explained by the remaining low amounts of Sp1/Sp3 proteins which can be seen in the western blot analysis. Alternatively, other transcription factors could be involved in A3G regulation.
Our results also provide information about the regulation of APOBEC3F (A3F), another member of the human APOBEC3 family. A3F is expressed in many human tissues that also express A3G and both proteins have been shown to form heteromultimers, which are most likely generated through binding to an RNA intermediate (26,29,30). A3F only differs in 16 nt from the 560 nt upstream of the TSS of A3G (GenBankTM DQ146365 [GenBank] and DQ147772 [GenBank] ). The 180-bp core promoter region, which we identified for A3G has 100% identity with the A3F sequence. Therefore, Sp1/Sp3 transcription factors are most likely also mediating basal transcription of the A3F gene.
Our study revealed that the human A3G gene is controlled by a promoter with multiple transcriptional start sites. In A3.01 T cells, the A3G promoter appears constitutively active and is not inducible by TPA, type I or II interferons or by HIV-1 proteins. The core promoter is located within a region of 180 bp at position 114/+66 relative to the TSS. A GC-box is crucial to the function of the core promoter and represents a binding site for Sp1 and Sp3 transcription factors. Our results can serve as a basis for future studies aimed at understanding how A3G and A3F expression is controlled in different tissues and how these restriction factors can be used to develop novel therapeutic strategies against HIV-1 infection.
| ACKNOWLEDGEMENTS |
|---|
We thank Thomas Pietschmann for providing HepG2 and Huh7 cell lines, Ute Pägelow and Mario Köster for providing the pGL2-CVX plasmid and Nathaniel R. Landau for providing the plasmid pcDNA3.1Vif. Many thanks to Andre Berger and Matthias Hamdorf for technical and IT support. Funding to pay the Open Access publication charges for this article was provided by the Paul Ehrlich Institut.
Conflict of interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Baumann JG. Intracellular restriction factors in mammalian cells An ancient defense system finds a modern foe. Curr. HIV. Res (2006) 4:141168.[CrossRef][Web of Science][Medline]
- Chiu YL, Greene WC. APOBEC3 cytidine deaminases: distinct antiviral actions along the retroviral life cycle. J. Biol. Chem (2006) 281:83098312.
[Abstract/Free Full Text] - Bieniasz PD. Intrinsic immunity: a front-line defense against viral attack. Nat. Immunol (2004) 5:11091115.[CrossRef][Web of Science][Medline]
- Sheehy AM, Gaddis NC, Choi JD, Malim MH. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature (2002) 418:646650.[CrossRef][Medline]
- Zhang H, Yang B, Pomerantz RJ, Zhang C, Arunachalam SC, Gao L. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature (2003) 424:9498.[CrossRef][Medline]
- Mangeat B, Turelli P, Caron G, Friedli M, Perrin L, Trono D. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature (2003) 424:99103.[CrossRef][Medline]
- Bishop KN, Holmes RK, Sheehy AM, Davidson NO, Cho SJ, Malim MH. Cytidine deamination of retroviral DNA by diverse APOBEC proteins. Curr. Biol (2004) 14:13921396.[CrossRef][Web of Science][Medline]
- Mariani R, Chen D, Schrofelbauer B, Navarro F, König R, Bollman B, Münk C, Nymark-McMahon H, Landau NR. Species-specific exclusion of APOBEC3G from HIV-1 virions by Vif. Cell (2003) 114:2131.[CrossRef][Web of Science][Medline]
- Doehle BP, Schafer A, Wiegand HL, Bogerd HP, Cullen BR. Differential sensitivity of murine leukemia virus to APOBEC3-mediated inhibition is governed by virion exclusion. J. Virol (2005) 79:82018207.
[Abstract/Free Full Text] - Russell RA, Wiegand HL, Moore MD, Schafer A, McClure MO, Cullen BR. Foamy virus Bet proteins function as novel inhibitors of the APOBEC3 family of innate antiretroviral defense factors. J. Virol (2005) 79:87248731.
[Abstract/Free Full Text] - Löchelt M, Romen F, Bastone P, Muckenfuss H, Kirchner N, Kim YB, Truyen U, Rosler U, Battenberg M, Saib A, et al. The antiretroviral activity of APOBEC3 is inhibited by the foamy virus accessory Bet protein. Proc. Natl Acad. Sci. USA (2005) 102:79827987.
[Abstract/Free Full Text] - Sasada A, Takaori-Kondo A, Shirakawa K, Kobayashi M, Abudu A, Hishizawa M, Imada K, Tanaka Y, Uchiyama T. APOBEC3G targets human T-cell leukemia virus type 1. Retrovirology (2005) 2:32.[CrossRef][Medline]
- Rosler C, Kock J, Kann M, Malim MH, Blum HE, Baumert TF, von Weizsacker F. APOBEC-mediated interference with hepadnavirus production. Hepatology (2005) 42:301309.[CrossRef][Web of Science][Medline]
- Schumacher AJ, Nissley DV, Harris RS. APOBEC3G hypermutates genomic DNA and inhibits Ty1 retrotransposition in yeast. Proc. Natl Acad. Sci. USA (2005) 102:98549859.
[Abstract/Free Full Text] - Delebecque F, Suspene R, Calattini S, Casartelli N, Saib A, Froment A, Wain-Hobson S, Gessain A, Vartanian JP, et al. Restriction of foamy viruses by APOBEC cytidine deaminases. J. Virol (2006) 80:605614.
[Abstract/Free Full Text] - Dutko JA, Schafer A, Kenny AE, Cullen BR, Curcio MJ. Inhibition of a yeast LTR retrotransposon by human APOBEC3 cytidine deaminases. Curr. Biol (2005) 15:661666.[CrossRef][Web of Science][Medline]
- Esnault C, Heidmann O, Delebecque F, Dewannieux M, Ribet D, Hance AJ, Heidmann T, Schwartz O. APOBEC3G cytidine deaminase inhibits retrotransposition of endogenous retroviruses. Nature (2005) 433:430433.[CrossRef][Medline]
- Turelli P, Mangeat B, Jost S, Vianin S, Trono D. Inhibition of hepatitis B virus replication by APOBEC3G. Science (2004) 303:1829.
[Free Full Text] - Rosler C, Kock J, Malim MH, Blum HE, von Weizsacker F. Comment on "Inhibition of hepatitis B virus replication by APOBEC3G". Science (2004) 305:1403.[CrossRef][Medline]
- Gaddis NC, Sheehy AM, Ahmad KM, Swanson CM, Bishop KN, Beer BE, Marx PA, Gao F, Bibollet-Ruche F, et al. Further investigation of simian immunodeficiency virus Vif function in human cells. J. Virol (2004) 78:1204112046.
[Abstract/Free Full Text] - Harris RS, Bishop KN, Sheehy AM, Craig HM, Petersen-Mahrt SK, Watt IN, Neuberger MS, Malim MH. DNA deamination mediates innate immunity to retroviral infection. Cell (2003) 113:803809.[CrossRef][Web of Science][Medline]
- Shindo K, Takaori-Kondo A, Kobayashi M, Abudu A, Fukunaga K, Uchiyama T. The enzymatic activity of CEM15/Apobec-3G is essential for the regulation of the infectivity of HIV-1 virion but not a sole determinant of its antiviral activity. J. Biol. Chem (2003) 278:4441244416.
[Abstract/Free Full Text] - Noguchi C, Ishino H, Tsuge M, Fujimoto Y, Imamura M, Takahashi S, Chayama K. G to A hypermutation of hepatitis B virus. Hepatology (2005) 41:626633.[CrossRef][Web of Science][Medline]
- Newman EN, Holmes RK, Craig HM, Klein KC, Lingappa JR, Malim MH, Sheehy AM. Antiviral function of APOBEC3G can be dissociated from cytidine deaminase activity. Curr. Biol (2005) 15:166170.[CrossRef][Web of Science][Medline]
- Strebel K. APOBEC3G & HTLV-1: inhibition without deamination. Retrovirology (2005) 2:37.[CrossRef][Medline]
- Liddament MT, Brown WL, Schumacher AJ, Harris RS. APOBEC3F properties and hypermutation preferences indicate activity against HIV-1 in vivo. Curr. Biol (2004) 14:13851391.[CrossRef][Web of Science][Medline]
- Zheng YH, Irwin D, Kurosu T, Tokunaga K, Sata T, Peterlin BM. Human APOBEC3F is another host factor that blocks human immunodeficiency virus type 1 replication. J. Virol (2004) 78:60736076.
[Abstract/Free Full Text] - Hache G, Liddament MT, Harris RS. The retroviral hypermutation specificity of APOBEC3F and APOBEC3G is governed by the C-terminal DNA cytosine deaminase domain. J. Biol. Chem (2005) 280:1092010924.
[Abstract/Free Full Text] - Wiegand HL, Doehle BP, Bogerd HP, Cullen BR. A second human antiretroviral factor, APOBEC3F, is suppressed by the HIV-1 and HIV-2 Vif proteins. EMBO J (2004) 23:24512458.[CrossRef][Web of Science][Medline]
- Wichroski MJ, Robb GB, Rana TM. Human retroviral host restriction factors APOBEC3G and APOBEC3F localize to mRNA processing bodies. PLoS Pathog (2006) 2:e41.[CrossRef][Medline]
- Gallois-Montbrun S, Kramer B, Swanson CM, Byers H, Lynham S, Ward M, Malim MH. Antiviral protein APOBEC3G localizes to ribonucleoprotein complexes found in P bodies and stress granules. J. Virol (2007) 81:21652178.
[Abstract/Free Full Text] - Jarmuz A, Chester A, Bayliss J, Gisbourne J, Dunham I, Scott J, Navaratnam N. An anthropoid-specific locus of orphan C to U RNA-editing enzymes on chromosome 22. Genomics (2002) 79:285296.[CrossRef][Web of Science][Medline]
- Rose KM, Marin M, Kozak SL, Kabat D. Transcriptional regulation of APOBEC3G, a cytidine deaminase that hypermutates human immunodeficiency virus. J. Biol. Chem (2004) 279:4174441749.
[Abstract/Free Full Text] - Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, Martin MA. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol (1986) 59:284291.
[Abstract/Free Full Text] - Hoffmeyer A, Grosse-Wilde A, Flory E, Neufeld B, Kunz M, Rapp UR, Ludwig S. Different mitogen-activated protein kinase signaling pathways cooperate to regulate tumor necrosis factor alpha gene expression in T lymphocytes. J. Biol. Chem (1999) 274:43194327.
[Abstract/Free Full Text] - Flory E, Weber CK, Chen P, Hoffmeyer A, Jassoy C, Rapp UR. Plasma membrane-targeted Raf kinase activates NF-kappaB and human immunodeficiency virus type 1 replication in T lymphocytes. J. Virol (1998) 72:27882794.
[Abstract/Free Full Text] - Sheehy AM, Gaddis NC, Malim MH. The antiretroviral enzyme APOBEC3G is degraded by the proteasome in response to HIV-1 Vif. Nat. Med (2003) 9:14041407.[CrossRef][Web of Science][Medline]
- Marin M, Rose KM, Kozak SL, Kabat D. HIV-1 Vif protein binds the editing enzyme APOBEC3G and induces its degradation. Nat. Med (2003) 9:13981403.[CrossRef][Web of Science][Medline]
- Conticello SG, Harris RS, Neuberger MS. The Vif protein of HIV triggers degradation of the human antiretroviral DNA deaminase APOBEC3G. Curr. Biol (2003) 13:20092013.[CrossRef][Web of Science][Medline]
- Mehle A, Strack B, Ancuta P, Zhang C, McPike M, Gabuzda D. Vif overcomes the innate antiviral activity of APOBEC3G by promoting its degradation in the ubiquitin-proteasome pathway. J. Biol. Chem (2004) 279:77927798.
[Abstract/Free Full Text] - Yu X, Yu Y, Liu B, Luo K, Kong W, Mao P, Yu XF. Induction of APOBEC3G ubiquitination and degradation by an HIV-1 Vif-Cul5-SCF complex. Science (2003) 302:10561060.
[Abstract/Free Full Text] - Kao S, Khan MA, Miyagi E, Plishka R, Buckler-White A, Strebel K. The human immunodeficiency virus type 1 Vif protein reduces intracellular expression and inhibits packaging of APOBEC3G (CEM15), a cellular inhibitor of virus infectivity. J. Virol (2003) 77:1139811407.
[Abstract/Free Full Text] - Stopak K, de Noronha C, Yonemoto W, Greene WC. HIV-1 Vif blocks the antiviral activity of APOBEC3G by impairing both its translation and intracellular stability. Mol. Cell (2003) 12:591601.[CrossRef][Web of Science][Medline]
- Dandekar DH, Ganesh KN, Mitra D. HIV-1 Tat directly binds to NFkappaB enhancer sequence: role in viral and cellular gene expression. Nucleic Acids Res (2004) 32:12701278.
[Abstract/Free Full Text] - Ott M, Emiliani S, Van Lint C, Herbein G, Lovett J, Chirmule N, McCloskey T, Pahwa S, Verdin E. Immune hyperactivation of HIV-1-infected T cells mediated by Tat and the CD28 pathway. Science (1997) 275:14811485.
[Abstract/Free Full Text] - Peng G, Lei KJ, Jin W, Greenwell-Wild T, Wahl SM. Induction of APOBEC3 family proteins, a defensive maneuver underlying interferon-induced anti-HIV-1 activity. J. Exp. Med (2006) 203:4146.
[Abstract/Free Full Text] - Bonvin M, Achermann F, Greeve I, Stroka D, Keogh A, Inderbitzin D, Candinas D, Sommer P, Wain-Hobson S, et al. Interferon-inducible expression of APOBEC3 editing enzymes in human hepatocytes and inhibition of hepatitis B virus replication. Hepatology (2006) 43:13641374.[CrossRef][Web of Science][Medline]
- Tanaka Y, Marusawa H, Seno H, Matsumoto Y, Ueda Y, Kodama Y, Endo Y, Yamauchi J, Matsumoto T, et al. Anti-viral protein APOBEC3G is induced by interferon-alpha stimulation in human hepatocytes. Biochem. Biophys. Res. Commun (2006) 341:314319.[CrossRef][Web of Science][Medline]
- Swick AG, Blake MC, Kahn JW, Azizkhan JC. Functional analysis of GC element binding and transcription in the hamster dihydrofolate reductase gene promoter. Nucleic Acids Res (1989) 17:92919304.
[Abstract/Free Full Text] - Gross P, Oelgeschlager T. Core promoter-selective RNA polymerase II transcription. Biochem. Soc. Symp (2006) 225236.
- Azizkhan JC, Jensen DE, Pierce AJ, Wade M. Transcription from TATA-less promoters: dihydrofolate reductase as a model. Crit. Rev. Eukaryot. Gene Expr (1993) 3:229254.[Medline]
- Stopak KS, Chiu YL, Kropp J, Grant RM, Greene WC. Distinct patterns of cytokine regulation of APOBEC3G expression and activity in primary lymphocytes, macrophages, and dendritic cells. J. Biol. Chem (2007) 282:35393546.
[Abstract/Free Full Text] - Chen K, Huang J, Zhang C, Huang S, Nunnari G, Wang FX, Tong X, Gao L, Nikisher K, et al. Alpha interferon potently enhances the anti-human immunodeficiency virus type 1 activity of APOBEC3G in resting primary CD4 T Cells. J. Virol (2006) 80:76457657.
[Abstract/Free Full Text] - Melton DW, Konecki DS, Brennand J, Caskey CT. Structure, expression, and mutation of the hypoxanthine phosphoribosyltransferase gene. Proc. Natl Acad. Sci. USA (1984) 81:21472151.
[Abstract/Free Full Text] - Reynolds GA, Basu SK, Osborne TF, Chin DJ, Gil G, Brown MS, Goldstein JL, Luskey KL. HMG CoA reductase: a negatively regulated gene with unusual promoter and 5' untranslated regions. Cell (1984) 38:275285.[CrossRef][Web of Science][Medline]
- Valerio D, Duyvesteyn MG, Dekker BM, Weeda G, Berkvens TM, van der Voorn L, van Ormondt H, van der Eb AJ. Adenosine deaminase: characterization and expression of a gene with a remarkable promoter. EMBO J (1985) 4:437443.[Web of Science][Medline]
- Li L, He S, Sun JM, Davie JR. Gene regulation by Sp1 and Sp3. Biochem. Cell Biol (2004) 82:460471.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
G. Mercenne, S. Bernacchi, D. Richer, G. Bec, S. Henriet, J.-C. Paillart, and R. Marquet HIV-1 Vif binds to APOBEC3G mRNA and inhibits its translation Nucleic Acids Res., November 12, 2009; (2009) gkp1009v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Perkovic, S. Schmidt, D. Marino, R. A. Russell, B. Stauch, H. Hofmann, F. Kopietz, B.-P. Kloke, J. Zielonka, H. Strover, et al. Species-specific Inhibition of APOBEC3C by the Prototype Foamy Virus Protein Bet J. Biol. Chem., February 27, 2009; 284(9): 5819 - 5826. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








