Nucleic Acids Research Advance Access originally published online on October 4, 2007
Nucleic Acids Research 2007 35(19):6672-6680; doi:10.1093/nar/gkm567
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nucleic Acids Research, 2007, Vol. 35, No. 19 6672-6680
© 2007 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Nucleic Acid Enzymes |
Escherichia coli HU protein has a role in the repair of abasic sites in DNA
1Department of Radiation Oncology, Emory University School of Medicine, 2Department of Pathology, Clifton Road NE, Atlanta, GA 30322 and 3Division of Diagnostic Sciences and Department of Molecular and Computational Biology, University of Southern California, Los Angeles, CA 90089, USA
*To whom correspondence should be addressed. Tel: +1 404 778 5481; Fax: +1 404 778 3965; Email: ykow{at}emory.edu
Received June 4, 2007. Revised July 5, 2007. Accepted July 6, 2007.
| ABSTRACT |
|---|
|
|
|---|
HU is one of the most abundant DNA binding proteins in Escherichia coli. We find that it binds strongly to DNA containing an abasic (AP) site or tetrahydrofuran (THF) (apparent Kd
50 nM). It also possesses an AP lyase activity that cleaves at a deoxyribose but not at a THF residue. The binding and cleavage of an AP site was observed only with the HU
ß heterodimer. Site-specific mutations at K3 and R61 residues led to a change in substrate binding and cleavage. Both K3A(
)K3A(ß) and R61A(
)R61A(ß) mutant HU showed significant reduction in binding to DNA containing AP site; however, only R61A(
)R61A(ß) mutant protein exhibited significant loss in AP lyase activity. Both K3A(
)K3A(ß) and R61K(
)R61K(ß) showed slight reduction in AP lyase activities. The function of HU protein as an AP lyase was confirmed by the ability of hupA or hupB mutations to further reduce the viability of an E. coli dut(Ts) xth mutant, which generates lethal AP sites at 37°C; the hupA and hupB derivatives, respectively, had a 6-fold and a 150-fold lower survival at 37°C than did the parental strain. These data suggest, therefore, that HU protein plays a significant role in the repair of AP sites in E. coli. | INTRODUCTION |
|---|
|
|
|---|
Escherichia coli HU is a small, basic protein composed of two highly homologous subunits, HU
and HUß, encoded by hupA and hupB genes (1,2). It is one of the most abundant DNA binding proteins in E. coli, and plays a major role in the compaction of E. coli genome into tight chromosome-like structure (3,4). E. coli cells lacking hupA or hupB exhibit normal growth but show slightly increased sensitivity towards DNA damaging agents such as UV and ionizing radiation (5–7). Furthermore, cells lacking both hupA and hupB are more UV sensitive than either the hupA or hupB single mutant (5). The increased UV sensitivity of hupA hupB mutant was thought to be the result of decreased efficiency in recombination and not due to defects in nucleotide excision repair of UV cyclobutane dimers (5,6). Interestingly, hupA hupB double mutants appear to be less UV mutable as compared to the wild-type cell (6). E. coli hupA hupB also showed increased sensitivity towards ionizing radiation (7) and to cold or heat shock (2,8,9), as well as perturbed cell divisions that frequently produced anucleated cells (2,8).
During active and early growth phases of E. coli, HU exists predominantly as a mixture of
ß heterodimer and 
homodimer (10). Little or no ßß homodimers were observed (10) and then only in the late logarithmic stage of growth. The proportion of
ß heterodimer increases roughly from 50% during early growth to almost 100% when E. coli reaches stationary phase (10). Although HU
ß heterodimers bind non-specifically to native B form DNA, they have a much higher affinity towards DNA containing replicative and recombinational structures such as flaps, three- and four-way cruciform DNA structures (11,12). In addition, HU
ß also binds tightly to DNA containing nicks and small gaps, discriminating over duplex DNA by 1000 fold (13,14). Because DNA containing single-strand nicks is generated by many DNA damaging agents such as ionizing radiation and redox chemicals (15,16), HU protein might have a role in DNA repair.
The AP or abasic site is one of the most frequently encountered DNA lesions in cells. Although AP sites are generated via spontaneous hydrolysis of the N-glycosidic bond (15,17), they are produced at an elevated level when cells are under oxidative stress or exposed to different DNA damaging agent such as ionizing radiation, oxidants, or alkylating agents (15,17–19). Oxidation or alkylation of DNA bases can lead to decreased stability of the N-glycosidic bond as well as enzymatic hydrolysis by specific glycosylases, thereby producing AP sites in DNA (18,19).
The accumulation of AP sites can be lethal because they hinder DNA replication (18,20). Moreover, even when bypassed by DNA polymerases AP sites frequently lead to the insertion of mutagenic bases opposite them (18,20). AP sites are predominantly repaired via the base excision repair pathway (15), which is initiated by AP endonucleases or lyases, and often generates DNA containing a single-base gap or a nick structures that are known to be tightly bound by HU (13).
We have previously shown that the binding of HU
ß to DNA to a nick led to inhibition of endonuclease III activity on a dihydrouracil lesion located opposite the nick (21). Based on these data, we suggested that HU plays an indirect role in the repair of closely opposing lesions (21). In this work, we explore a possible direct role for HU proteins in DNA repair, specifically in the repair of AP sites.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA substrates
All oligonucleotides were obtained from Operon and purified by 15% polyacrylamide gel electrophoresis as described previously (22). Oligonucleotides (31-mers) containing 32P-labeled 5' ends were prepared by with T4 polynucleotide kinase and [
32P]ATP (Amersham Biosciences) (22). Double-stranded 32P-labeled DNA substrates containing base lesions were prepared by annealing a 32P-labeled oligomer containing the lesion with the appropriate complementary strand at a ratio of 1:1.5 in a buffer containing 10 mM Tris–HCl (pH 7.5), 0.1 M NaCl (22). DNA containing a unique AP site was prepared by incubating double-stranded DNA containing a unique uracil with an excess amount of uracil DNA glycosylase for 10 min. The DNA sequence for the 31-mer and 51-mer used for this study is as follows: 31-mer: 5' TGCAGGTCGACTXAGGAGGATCCCCGGGTAC
51-mer: 5'-AATTCGATATCAAGCTTGCTAGCTGAXACTGGATCCTCGAGGGCCCGGTAC
where X is uracil (31-mer-U and 51-mer-U), an AP site (31-mer-AP and 51-mer-AP), or tetrahydrofuran (THF) (31-mer-THF).
Bacterial strains
Escherichia coli strains used are listed in Table 1. E. coli mutants deficient in dUTP pyrophosphatase (dut-1) were propagated at 25°C in LB broth that was supplemented with thymidine at 125 µg/ml to minimize phenotypic reversion (23,24). Generalized transductions with P1 dam rev6 were as previously described (25). Chloramphenicol was used at 25 µg/ml and kanamycin at 30 µg/ml.
|
Enzymes and proteins
Hexa-histidine tagged E. coli formamidopyrimidine N-glycosylase, endonucleases III, IV, V, and VIII were repair proteins routinely prepared in our laboratory and were purified using the nickel-trinitrilotriacetic columns as described previously (22). C-Terminal hexa-histadine tagged HU
and HUß subunits were prepared separately from an E. coli BL21(pLysS) host harboring the overproducing plasmids pHU
or pHUß as described previously (21). Overproducing plasmids bearing specific mutations in HU
and HUß subunits were generated by using Quickchange mutagenesis kit (Stratagene), using pHU
and pHUß as source plasmids for site-specific mutagenesis. The following mutant plasmids bearing specific mutations in either HU
or HUß subunits were generated: pHU
(R65A), pHU
(R65K), pHU
(K3A), pHUß(R65A), pHUß(R65K), and pHUß(K3A). The wild-type and mutant HU
and HUß proteins were purified from E. coli strain harboring these overproducing plasmids, using nickel chelate columns as described previously (22). HU
ß heterodimers were prepared by mixing equal amount of HU
and HUß (21).
Electrophoretic mobility shift assays (EMSA)
Binding reactions were performed by either varying the substrate or the protein concentrations. The apparent equilibrium dissociation constants (Kd) were estimated at a fixed HU concentration (20 nM) in a reaction mix containing 10 mM Tris-HCl (pH 7.5), 100 mM NaCl, 5% glycerol, and increasing amount of 5'-32P-end labeled 31-mer containing either AP site or THF, respectively. A 8% non-denaturing polyacrylamide gel was prechilled and pre-run at 10°C for at least 2 h. Samples were electrophoresed at 20 V/cm (10°C) for 150 min in a cold room. Following electrophoresis, the gels were dried under vacuum, and the radioactive bands were scanned by BioRad Molecular Imager FX ProPlus (Hercules, CA). Quantification of shifted complexes was performed using with ImageQuant 5.0 software (Molecular Dynamics). GraphPad Prism v4.0 software was then used to determine Kd values.
Alternatively, the binding interaction of wild-type and various mutant HUs with DNA containing AP sites were examined at fixed substrate concentration and varying concentrations of HU proteins. Binding reaction mixture (10 µl) contained 10 mM Tris–HCl (pH.7.5), 100 mM NaCl, 5% glycerol, 50 fmol of 5'-end-labeled oligonucleotide duplex and varying amount of HU proteins. The reaction mixture was incubated at 10°C for 10 min and electrophoresed on a 10% non-denaturing polyacrylamide gel in the cold room as described previously (22). The gels were prechilled in the cold room before samples were applied, and electrophoresis was performed at 20 V/cm (10°C) for 150 min. Following electrophoresis, the gel was dried under vacuum, and the radioactive bands were quantified with a Storm PhosphoImager (Molecular Dynamics).
Enzyme assays
Endonuclease IV was assayed as previously described, using 5'-32P-labeled 31-mer containing an AP site or THF as substrates (26). To determine the effect of HU
ß protein on endonuclease IV activity, increasing amounts of HU proteins (100 nM, 200 nM, 400 nM and 800 nM) were added to the endonuclease IV reaction buffer. Reactions were stopped by adding 10 µl of loading buffer (90% formamide, 1 mM EDTA, 0.1% xylene cyanol, and 0.1% bromophenol blue) and heated at 90°C for 30 min. Three to five micro liters of the reaction mixture were then loaded onto a 12.5% denaturing polyacrylamide gel and electrophoresed at 2000 V for 1.5 h. The polyacrylamide gel was then dried under vacuum and analyzed by a Storm PhosphoImager (Molecular Dynamics).
The nature of the 5' and 3' termini generated by HU
ß on DNA containing an AP site were determined by comparing the electrophoretic mobililty of DNA cleavage products of HU with the cleavage products derived from endonucleases III, IV, VIII, and V and formamidopyrimidine N-glycosylase as previously described (22,27). Endonucleases III, V and VIII were assayed using reaction conditions as previously described (22,27). The AP lyase activity of HU protein was assayed in a 10 µl reaction mix containing 10 mM Tris–HCl (pH 7.5), 1 mM EDTA, 100 mM KCl, and 50 fmols of 5'-32P-labeled 31-mer-AP.
| RESULTS |
|---|
|
|
|---|
Inhibition of endonuclease IV activity by HU
ß proteinGiven that HU
ß has a high affinity for both single-base gaps and nicks, which are intermediates of AP site repair, we were interested in finding out whether HU would also bind to an AP site. As an initial step we determined if HU could block the activity of endonuclease IV on DNA containing a THF (an AP site analog). Under the reaction conditions used, endonuclease IV cleaved 90% of the 31-mer-THF in the absence of HU protein (Figure 1A, lane 2). In the presence of 50 nM, 100 nM, 200 nM, 400 nM, and 800 nM of HU, endonuclease IV cleaved 54, 47, 43, 32, and 23% of the 31-mer-THF, respectively (Figure 1A, lanes 3–7).
|
The results in Figure 1A thus suggested that HU
ß binds to DNA containing a THF lesion, and results in the inhibition of endonuclease IV activity on THF lesion. We then determined whether HU
ß would bind to DNA containing THF by EMSA. Isotopically end labeled 31-mer-THF were incubated with increasing concentrations of HU protein (from 25 to 400 nM). As the concentration of HU was raised, we observed an increasing amount of slower migrating labeled band that is indicative of a DNA–protein complex (Figure 1B, lanes 1–5) suggesting that HU
ß binds tightly to DNA containing THF. Under the same reaction conditions, no DNA-protein complex was observed for homoduplex 31-mer(data not shown).
In contrast, in determining whether HU
ß protein can bind similarly to DNA containing an AP site, we observed DNA cleavage. 5'-End 32P-labeled 31-mer containing an AP site were prepared by treating 5' end-32P labeled 31-mer containing uracil with excess amount of uracil DNA N-glycosylase. AP DNA was then treated with increasing amount of HU protein. Figure 1B showed that incubating with HU protein led to cleavage of the 31-mer-AP (Figure 1C) in a concentration dependent manner. Furthermore, the size of the DNA product is consistent with cleavage in the vicinity of the AP lesion. At 800 nM of HU, greater than 90% of the DNA containing an AP site was cleaved. Considering that HU
ß merely bound but did not cleave the THF containing substrate, suggests that HU also possesses an active enzymatic activity that can recognize and cleave DNA containing an AP site.
HU protein interacts with DNA containing an AP site or THF
Figure 1B clearly demonstrated that HU binds to DNA containing a THF and forms a stable complex. The apparent affinity of a HU
ß for DNA containing an AP site or THF was then determined by EMSA. In this case, the apparent Kd were determined at a fix HU concentration and varying concentrations of the substrate DNA; this strategy was employed to avoid multiple HU protomer binding and cooperative effects (Figure 6). Figure 2 showed that increasing concentrations of 31-mer-THF or 31-mer-AP led to increased amount of DNA-protein complex (Figure 2A and C). The amount of DNA-protein complex (as bound substrate) were then quantified and plotted against the amount of free substrate (Figure 2B and 2D). The apparent Kd were estimated from the hyperbola binding curve by using GraphPad Prism v4.0 software, and fitting the data to a single site binding model. The average Kd found for the AP site and THF were 47.8 ± 17.8 and 51.1 ± 17.7 nM (average of three experiments). Under similar conditions, HU protein exhibited no specific binding to DNA containing uracil, 5,6-dihydrouracil, 8-oxoG, hypoxanthine, etheno-dA, and etheno-dC (data not shown), indicating that HU has no apparent recognition for these base excision repair substrates, the repair of which generates AP sites.
|
HU protein is an AP lyase
HU did not cleave DNA containing THF (data not shown) but did cleave DNA containing an AP site even in the presence of EDTA (Figure 1C), suggesting that HU protein is potentially an AP lyase. To verify that the AP site cleavage activity of HU is an AP lyase, we characterized the 3' terminus of the cleavage products. It is well established that endonuclease III generates a 5'-cleavage product containing a 3' 4-hydroxy-2-pentenal residue [ß-elimination product; (27,28)], whereas endonuclease VIII generates a 3' phosphoryl group [ß,
-elimination product; (27,28)], as evidenced by the different mobilities of their products (Figure 3, lanes 2 and 5). Endonucleases IV and V are AP endonucleases that generate hydroxyl groups at the 3' termini of 5'-cleavage products (22,28). However, endonuclease V nicks DNA containing an AP site at the second phosphodiester bond 3' to an AP site, thus generating a labeled 5' cleavage product that is larger than that generated by endonuclease IV (Figure 3, lanes 3 and 4). Polynucleotide kinase has a 3' phosphatase activity that can convert the 3' terminus of the endonuclease VIII product to a 3'-OH group (Figure 3, lane 5). The electrophoretic mobility of the cleavage product generated by HU protein on DNA containing an AP site was compared with those generated by AP lyases and endonucleases (Figure 3). The 5'-labeled product generated by the HU protein (lanes 7 and 8) had the same mobility as that produced by endonuclease III (lane 2), slower than the products generated by endonuclease IV (lane 3), endonuclease VIII (lane 5) and endonuclease VIII plus polynucleotide kinase (lane 6) but slightly faster than the product of endonuclease V (lane 4). Note that only the HU
ß heterodimer is able to cleave DNA containing an AP site (lanes 7 and 8); the 
and ßß HU homodimers showed no appreciable cleavage activity even at 800 nM (Figure 3, lanes 9 and 10). It is known that AP lyases form a Schiff-base covalent intermediate at an AP site and the Schiff-base intermediate can be trapped with sodium cyanoborohydride, generating a covalently linked protein-DNA complex that can be detected by SDS-polyacrylamide gel electrophoresis (29). In the presence of sodium cyanoborohydride, HU
ß formed a stable covalent complex with 31-mer containing an AP site (Figure 4B) but not with an oligonucleotide containing a THF or with unmodified DNA (date not shown).
|
|
Properties of mutant HU proteins with mutation at R61 or K3
It is known that AP lyases employ predominantly lysine residues as nucleophiles for the formation of the Schiff-base intermediate and that mutant AP lyases that have the active site lysine substituted with alanine are inactive (29). HU is present in virtually all eubacteria and is highly conserved. As a DNA-binding protein, it has multiple basic amino acids that are involved in electrostatic interactions with the phosphate backbone of DNA. Among the most conserved are the lysine at residue 3 and an arginine at residue 61. Based on the published crystal structure of HU
ß, these two amino acids play different roles in the HU-DNA interface. Lysine-3 is highly conserved among all the HU and IHF family of DNA binding proteins from bacteria (30). The co-crystal structure of an HU
ß protein with DNA indicated that K3 is in contact with the DNA backbone in a nucleoprotein complex but is in a salt bridge with D26 in the absence of DNA (31–33). Replacing K3 with an alanine in HU
ß protein led to the disruption of the salt bridge and is expected to lead to significant reduction in DNA binding affinity (32). Arginine-61 of HU
ß has been shown to be in close proximity to proline-63, an amino acid residue that was demonstrated to be important for the binding of HU
ß to DNA (34). It was suggested that the insertion of proline-63 is crucial for DNA binding and the action of inserting proline-63 into the DNA helix places arginine-61 in contact with the phosphodiester backbone (34). It is interesting to note that in the ß-subunit of the E. coli IHF protein, a nucleoid protein that is highly homologous to HU, a mutation of the K65 residue (which corresponds to the R61 of HU
ß), severely compromises the survival of lambda phage in E. coli (35). Accordingly, we tested the effects of amino acid substitutions at positions 3 and 61 of the two HU subunits, which are highly homologous.
The following proteins were generated by mixing equal amounts of mutant HU
and mutant HUß subunits: K3A(
K3A(ß, R61A(
R61A(ß, R61K(
R61K(ß, R61A(
R61K(ß, and R61K(
)R61A(ß).
The substitution of R61 with a lysine residue in both the
and ß subunits of HU leads to only a slight reduction in its AP lyase activity (Figure 4, panel A, compare lanes 3 and 4). In contrast, substitution of R61 with alanine in both the
and ß subunits of HU leads to a severe inhibition of AP lyase activity (greater than 90% reduction in the AP lyase activity; lane 5). Schiff-base intermediates were trapped by reduction with sodium cyanoborohydride, and the resulting covalently crosslinked DNA-protein complexes were observed by SDS-PAGE (Figure 4, panel B). Two retarded bands were observed after the cyanoborohydride reaction for HU
ß protein with an AP lyase substrate (Figure 4B, lanes 3–6; arrows indicate the crosslinked products). These retarded band are attributed to the crosslinking of HU to both nicked and unnicked AP DNA substrates, as it was previouly demonstrated for the AP lyase activity of formaimdopyrimidne N-glycosylase (29). As expected, the R61K mutation did not lead to significant changes in the ability of R61K(
)R61K(ß) to form a Schiff-base intermediate with an AP site (Figure 4B, compare lane 3 with lane 6). In contrast, the ability of R61A(
)R61A(ß) to form a Schiff-base intermediate were severely inhibited (lane 5) consistent with DNA binding being required for AP site cleavage (Figure 4A, lane 5).
Despite the fact that K3 is highly conserved among all the HU
ß proteins, substitution of K3 with an alanine residue in both subunits only lead to a modest reduction in its AP lyase activity (Figure 4A, lane 6) and its ability to form a Schiff-base intermediate (Figure 4B, lane 4).
The AP lyase activities of various R61 mutant HU proteins were examined further in greater detail. As seen in Figure 4, substituting R61 with a lysine residue in both subunits did not lead to appreciable reduction in the cleavage activity of HU (Figure 5, compare panel A, lanes 4 and 3 with lanes 6 and 7 and panel B, lanes 3 and 4 with lanes 8 and 9), but substituting R61 by an alanine residue in both subunits led to a significant lost of the cleavage activity of HU on DNA containing an AP site (Figure 5, panel A, lanes 8 and 9; panel B, lanes 5 and 6). The cleavage activity of HU protein was only exhibited by
ß heterodimers; homodimers of the wild-type, R61K and R61A HU were inactive, even at 800 nM (panel A, lanes 10–13). As long as one of the subunits of the mutant heterodimer contained a wild-type arginine (R61) or a mutant lysine (K61), the protein was active as an AP lyase, albeit at a slightly reduced activity (Figure 5, panel B lanes 9–16). It must be pointed out that the product of a ß-AP lyase activity on DNA containing an AP site can sometimes appears as a single band (Figures 1B, 3 and 5b) or as a doublet (Figure 5A). This has been observed previously by us and other investigators (36,37).
|
For R61 mutant HU proteins, the cleavage activities correlated with their DNA binding affinities (Figure 6). Both the wild-type and R61K(
)R61K(ß) mutant proteins bind to DNA containing an AP site (Figure 6, panels A and B). The R61A(
)R61A(ß) mutant protein, which had substantially reduced AP lyase cleavage activity, also had a severely compromised DNA binding affinity (Figure 6, panel C). As had been noted for the cleavage activity, binding to DNA containing an AP site also required that at least one of the subunits of the heterodimer contained the wild-type R61 (data not shown) or a mutant K61 (Figure 5, panel B, lanes 9–16). It is also interesting to note that during EMSA both wild-type and the R61K(
)R61K(ß) mutant protein formed multiple slower migrating complexes with DNA containing an AP site, suggesting multiple HU
ß binding to the DNA substrate (Figure 6A and B). In contrast, both R61K(
)R61A(ß) and R61A(
)R61K(ß) apparently were unable to form these higher order complexes (Figure 6E, lanes 1–4).
|
Despite the fact that the K3A(
)K3A(ß) mutant exhibited a similar AP lyase activity as both the wild-type and R65K(
)R65K(ß) mutant HU protein, the binding affinity of K3A(
)K3A(ß) for the AP site was diminished. Figure 6D showed that K3A(
)K3A(ß) binds poorly to DNA containing an AP site suggesting that K3 is crucial for DNA binding.
Mutations affecting HU enhance the inviability of a dut xth (Ts) mutant at high temperature
To see if the HU protein plays a significant role in the repair of AP sites in vivo, hup mutations were transferred to dut and dut xth mutants, which produce a high frequency of AP sites at elevated temperatures. The dut-1 mutation affects dUTPase, the residual activity of which is temperature sensitive. At high temperatures, the dut-1 mutant incorporates increased levels of uracil into DNA in place of thymine, and the uracil is removed by uracil-DNA glycosylase to generate AP sites. The xthA3 mutation specifies a temperature-sensitive form of exonuclease III, the major AP endonuclease of E. coli. The dut-1 xthA3 combination is conditionally lethal at 37°C (23); and this lethality can be suppressed by an ung mutation, which affects uracil-DNA glycosylase, an enzyme that produces the AP sites by removing uracil from the DNA. Therefore, the lethality appears to be due to unrepaired AP sites. Introduction of an nfo (endonuclease IV mutation), which affects another AP endonuclease, further increases the temperature sensitivity of the dut-1 xthA3 double mutant, although it has little effect on the dut-1 single mutant (38). Thus dut-1 and dut-1 xthA3 mutants can be used to test the role that other genes may play in the repair of AP sites.
The hupA and hupB mutations were transduced into a dut and a dut xth mutant, and their temperature sensitivities were measured (Table 2). Derivatives carrying both hupA and hupB were not examined since they grew poorly and were unstable. Unlike the xth mutation, the hup mutations did not significantly affect the temperature sensitivity of the dut mutant (Table 2). However, the hupA and hupB mutations reduced the survival of the dut xth mutant, causing a further 6-fold and a 150-fold increase in temperature sensitivity, respectively. In this test the behavior of the hup mutants resembled that previously described for an nfo mutation in dut and dut xth strains (38). These results are therefore, consistent with a role for HU in the repair of AP sites in vivo and suggest that it has a level of importance that is comparable to that of endonuclease IV.
|
| DISCUSSION |
|---|
|
|
|---|
The AP lyase activity of HU
ß protein was established by three findings: (i) cleavage of DNA 3' to an AP site to yield a product of the same size as that produced by known AP lyases, (ii) inability to cleave at THF, which lacks the free aldehyde needed for a ß-elimation reaction, and (iii) the formation of a protein-DNA crosslink upon sodium cyanoborohydride treatment, which is consistent with the formation of the Schiff-base intermediate that is characteristic of many AP lyases (16,28,29). Mutant K61A(
)K61A(ß) bound to DNA containing an AP site poorly and exhibited a significant reduction in AP lyase activity. These data would suggest that stable binding to an AP site is a pre-requisite for the AP site cleavage activity. However, data obtained with K3A(
)K3A(ß) mutant HU suggest that efficient cleavage of AP site did not require as stable a complex as the wild-type. Considering that K3 is believed to release a salt bridge with the aspartate(
)/glutamate(ß)-26 residue when HU
ß binds and bends DNA, the binding and cleavage data of K3A and R61A mutant proteins suggest that the initial binding of HU
ß to DNA constitutes the most crucial step in AP site recognition. The initial interaction of proline-63 of HU
ß with DNA helix positions R61 to come in contact with the phosphodiester backbone (31,34). However, the initial contact of R61 with the backbone is not sufficient for HU
ß to generate a stable complex with DNA containing an AP site. Substitution of lysine-3 with alanine was shown to lead to the disruption of a salt bridge between a HU
ß and DNA (32,33); apparently, this also led to the disruption of a stable complex of HU
ß to DNA containing an AP site as indicated by the poor binding of K3A mutant HU. The cleavage data observed with the various mutant HU proteins also suggest that the active site nucleophile is probably not R61 or K3A, since both mutant proteins still retain AP lyase activities, even though it was substantially reduced for the R61A mutant HU. However, it is very possible that there is a second site suppression by another primary amine (e.g., the amino terminus which is a close neighbor of K3).
In the study of the repair of AP sites in vivo, hupA and hupB deletion mutants were used, each of which should be able to form HU homodimers but not heterodimers. The data suggest, therefore, that it is the HU heterodimer in the hup+ cell that helps the partial survival of the dut xth mutants under non-permissive conditions, when they accumulate unrepaired AP sites. Although both the heterodimers and homodimers can bind non-specifically to undamaged DNA, only the heterodimer possesses AP lyase activity. Therefore, it is likely to be the lyase activity of HU
ß protein that is functioning in the repair of AP sites in vivo. However, mutations in other enzymes with AP lyase activities, such as endonuclease III or formamidopyrimidine N-glycosylase, did not lead to increased lethality in a dut xth strain (Weiss,B. unpublished). One possible explanation lies in differences in protein levels. In E. coli, endonuclease III and formamidopyrimidine N-glycosylase are each estimated to be present at roughly about 200 molecules per cell (Kow, unpublished data), whereas HU
ß protein is present in the range of 20 000–50 000 molecules per cell, or up to about 40 µM (39). Therefore, HU
ß may play a greater role than either of these other enzymes in the in vivo repair of AP sites, at least those not produced during their coupled glycosylase/lyase reactions.
Because HU is a nucleoid protein, it might be important for the repair of AP sites that might not be readily accessible to the housekeeping repair enzymes such as endonuclease IV and exonuclease III. The single turnover kinetics that was observed for the AP lyase reaction is consistent with the HU protein remaining bound to the resulting nick (13,21). This binding protects the site from digestion by exonuclease III (40), but it will not impede the action of DNA polymerase I and DNA ligase (21). It seems likely that HU
ß might play a role similar to that of mammalian poly (ADP-ribose) polymerase, which binds to single-strand breaks (41) and not only protects them from excessive digestion by exonucleases but may also help to recruit other repair proteins to the site (42).
| ACKNOWLEDGEMENTS |
|---|
This work was supported by grants from NIH CA90860 (YWK), NIEHS PO1 ES011163 (YWK and BW) NIDCR R01 DE13965 (SDG). Funding to pay the Open Access publication charges for this article was provided by NIEHS.
Conflict of interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Yamazaki K, Nagata A, Kano Y, Imamoto F. Isolation and characterization of nucleoid proteins from Escherichia coli. Mol. Gen. Genet (1984) 196:217–224.[CrossRef][ISI][Medline]
- Wada M, Kano Y, Ogawa T, Okazaki T, Imamoto F. Construction and characterization of the deletion mutant of hupA and hupB genes in Escherichia coli. J. Mol. Biol (1988) 204:581–591.[CrossRef][ISI][Medline]
- Rouviere-Yaniv J, Yaniv M, Germond JE. E. coli DNA binding protein HU forms nucleosomelike structure with circular double-stranded DNA. Cell (1979) 17:265–270.[CrossRef][ISI][Medline]
- Kano Y, Ogawa T, Ogura T, Hiraga S, Okazaki T, Imamoto F. Participation of the histone-like protein HU and of IHF in minichromosomal maintenance in Escherichia coli. Gene (1991) 103:25–30.[CrossRef][ISI][Medline]
- Li S, Waters R. Escherichia coli strains lacking protein HU are UV sensitive due to a role for HU in homologous recombination. J. Bacteriol (1998) 180:3750–3756.
[Abstract/Free Full Text] - Miyabe I, Zhang Q-M, Kano Y, Yonei Y. Histone-like protein HU is required for recA gene-dependent DNA repair and SOS induction pathways in UV-irradiated Escherichia coli. Int. J. Radiat. Biol (2000) 76:43–49.[CrossRef][ISI][Medline]
- Boubrik F, Rouviere-Yaniv J. Increased sensitivity to gamma irradiation in bacteria lacking protein HU. Proc. Natl Acad. Sci. U.S.A (1995) 92:3958–3962.
[Abstract/Free Full Text] - Huisman O, Faelen M, Girard D, Jaffé A, Toussaint A, Rouvière-Yaniv J. Multiple defects in Escherichia coli mutants lacking HU protein. J. Bacteriol (1989) 171:3704–3712.
[Abstract/Free Full Text] - Jaffé A, Vinella D, D'Ari R. The Escherichia coli histone-like protein HU affects DNA initiation, chromosome partitionning via MukB, and cell division via MinCDE. J. Bacteriol (1997) 179:3494–3499.
[Abstract/Free Full Text] - Claret L, Rouviere-Yaniv J. Variation in HU composition during growth of Escherichia coli: the heterodimer is required for long term survival. J. Mol. Biol (1997) 273:93–104.[CrossRef][ISI][Medline]
- Bonnefoy E, Takahashi M, Rouviere-Yaniv J. DNA-binding parameters of the HU protein of Escherichia coli to cruciform DNA. J. Mol. Biol (1994) 242:116–129.[CrossRef][ISI][Medline]
- Pontiggia A, Negri A, Beltrame M, Biachi ME. Protein HU binds specifically to kinked DNA. Mol. Microbiol (1993) 7:343–350.[CrossRef][ISI][Medline]
- Castaing B, Zelwer C, Laval J, Boiteux S. HU protein of Escherichia coli binds specifically to DNA that contains single-strand breaks or gaps. J. Biol. Chem (1995) 270:10291–10296.
[Abstract/Free Full Text] - Pinson V, Takahashi M, Rouviere-Yaniv J. Differential binding of the Escherichia coli HU, homodimeric forms and heterodimeric form to linear, gapped and cruciform DNA. J. Mol. Biol (1999) 287:485–497.[CrossRef][ISI][Medline]
- Friedberg EC, Walker GC, Siede W, Wood RD, Schultz RA, Ellenberger T. DNA Repair and Mutagenesis (2006) 2nd. Washington, DC: ASM Press.
[Abstract/Free Full Text] - Kow YW. Repair of oxidized bases. In: DNA Damage Recognition—Siede W, Kow YW, Doetsch PW, eds. (2006) New York, London: Taylor & Francis. 323–338.[CrossRef][ISI][Medline]
- Kow YW, Dare A. Detection of abasic sites and oxidative DNA base damage using an ELISA-like assay. Methods (2000) 22:164–169.[CrossRef][ISI][Medline]
- Loeb LA, Preston BD. Mutagenesis by apurinic/apyrimidinic sites. Annu. Rev. Genet (1986) 20:201–230.[CrossRef][ISI][Medline]
- Lindahl T. Instability and decay of the primary structure of DNA. Nature (1993) 362:709–715.[CrossRef][Medline]
- Bockrath R, Kow YW, Wallace SS. Chemically altered apurinic sites in phi X174 DNA give increased mutagenesis in SOS-induced. E. coli. Mutat. Res (1993) 288:207–214.
- Hashimoto M, Imhoff B, Ali MM, Kow YW. HU protein of Escherichia coli has a role in the repair of closely opposed lesions in DNA. J. Biol. Chem (2003) 278:28501–28507.
[Abstract/Free Full Text] - Yao M, Kow YW. Further characterization of Escherichia coli endonuclease V. Mechanism of recognition for deoxyinosine, deoxyuridine, and base mismatches in DNA. J. Biol. Chem (1997) 272:30774–30779.
[Abstract/Free Full Text] - Taylor AF, Weiss B. Role of exonuclease III in the base excision repair of uracil-containing DNA. J. Bacteriol (1982) 151:351–357.
[Abstract/Free Full Text] - Miller JH. A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria (1992) Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.[Abstract]
- Sternberg NL, Maurer R. Bacteriophage-mediated generalized transduction in Escherichia coli and Salmonella typhimurium. Methods Enzymol (1991) 204:18–23.[ISI][Medline]
- Wilson DM 3rd, Takeshita M, Grollman AP, Demple B. Incision activity of human apurinic endonuclease (Ape) at abasic site analogs in DNA. J. Biol. Chem (1995) 270:16002–16007.
[Abstract/Free Full Text] - Venkhataraman R, Donald CD, Roy R, You HJ, Doetsch PW, Kow YW. Enzymatic processing of DNA containing tandem dihydrouracil by endonucleases III and VIII. Nucleic Acids Res (2001) 29:407–414.
[Abstract/Free Full Text] - Purmal AA, Rabow LE, Lampman GW, Cunningham RP, Kow YW. A common mechanism of action for the N-glycosylase activity of DNA N-glycosylase/AP lyases from E. coli and T4. Mutat. Res (1996) 364:193–207.[ISI][Medline]
- Rabow LE, Kow YW. Mechanism of action of base release by Escherichia coli Fpg protein: role of lysine 155 in catalysis. Biochemistry (1997) 36:5084–5096.[CrossRef][Medline]
- Swinger KK, Rice PA. IHF and HU: flexible architects of bent DNA. Curr. Opin. Struct. Biol (2004) 14:28–35.[CrossRef][ISI][Medline]
- Swinger KK, Lemberg KM, Zhang Y, Rice PA. Flexible DNA bending in HU-DNA cocrystal structures. EMBO J (2003) 22:3749–3760.[CrossRef][ISI][Medline]
- Grove A, Saavedra TC. The role of surface-exposed lysines in wrapping DNA about the bacterial histone-like protein HU. Biochemistry (2002) 41:7597–7603.[CrossRef][Medline]
- Kamau E, Tsihlis ND, Simmons LA, Grove A. Surface salt bridges modulate the DNA site size of bacterial histone-like HU proteins. Biochem. J (2005) 390:49–55.[CrossRef][ISI][Medline]
- Rice PA. Making DNA do a U-turn: IHF and related proteins. Curr. Opin. Struct. Biol (1997) 7:86–93.[CrossRef][ISI][Medline]
- Mengeritsky G, Goldenberg D, Mendelson I, Giladi H, Oppenheim AB. Genetic and biochemical analysis of the integration host factor of Escherichia coli. J. Mol. Biol. 231:646–657. 0000.
[Abstract/Free Full Text] - Purmal AA, Rabow LE, Lampman GW, Cunningham RP, Kow YW. A common mechanism of action for the N-glycosylase activity of DNA N-glycosylase/AP lyases from E. coli and T4. Mutat. Res (1996) 364:193–207.[ISI][Medline]
- Mazumder A, Gerlt JA, Absalon MJ, Stubbe J, Cunningham RP, Withka J, Bolton PH. Stereochemical studies of the beta-elimination reactions at aldehydic abasic sites in DNA: endonuclease III from Escherichia coli, sodium hydroxide, and Lys-Trp-Lys. Biochemistry (1991) 30:1119–1126.[CrossRef][Medline]
- Cunningham RP, Saporito SM, Spitzer SG, Weiss B. Endonuclease IV (nfo) mutant of Escherichia coli. J. Bacteriol (1986) 168:1120–1127.
[Abstract/Free Full Text] - Rouviere-Yaniv J. Cold Spring Harbor Symp. Quant. Biol (1978) 42:439–447.
- Kamashev D, Rouviere-Yaniv J. The histone-like protein HU binds specifically to DNA recombination and repair intermediates. EMBO J (2000) 19:6527–6535.[CrossRef][ISI][Medline]
- Zahradka P, Ebisuzaki K. A shuttle mechanism for DNA-protein interactions. The regulation of poly(ADP-ribose) polymerase. Eur. J. Biochem (1982) 127:579–585.[ISI][Medline]
- Prasad R, Lavrik OI, Kim SJ, Kedar P, Yang XP, Vande Berg BJ, Wilson SH. DNA polymerase beta -mediated long patch base excision repair. Poly(ADP-ribose)polymerase-1 stimulates strand displacement DNA synthesis. J. Biol. Chem (2001) 276:2411–32414.
[Abstract/Free Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





