Skip Navigation


Nucleic Acids Research Advance Access originally published online on January 23, 2007
Nucleic Acids Research 2007 35(3):902-911; doi:10.1093/nar/gkl1116
This Article
Right arrow Abstract Freely available
Right arrow Print PDF (6884K) Freely available
Right arrow Screen PDF (473K) Freely available
Right arrowOA All Versions of this Article:
35/3/902    most recent
gkl1116v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Farge, G.
Right arrow Articles by Falkenberg, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Farge, G.
Right arrow Articles by Falkenberg, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 2007, Vol. 35, No. 3 902-911
© 2007 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.


Nucleic Acid Enzymes

The accessory subunit B of DNA polymerase {gamma} is required for mitochondrial replisome function

Géraldine Farge, Xuan Hoi Pham, Teresa Holmlund, Ivan Khorostov and Maria Falkenberg*

Division of Metabolic Diseases, Karolinska Institutet, Novum, SE-141 86 Stockholm, Sweden

*To whom correspondence should be addressed. Tel: +46 8 58583730; Fax: +46 8 779 5383; E-mail: maria.falkenberg{at}ki.se

Received October 9, 2006. Revised November 16, 2006. Accepted December 6, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The mitochondrial replication machinery in human cells includes the DNA polymerase {gamma} holoenzyme and the TWINKLE helicase. Together, these two factors form a processive replication machinery, a replisome, which can use duplex DNA as template to synthesize long stretches of single-stranded DNA. We here address the importance of the smaller, accessory B subunit of DNA polymerase {gamma} and demonstrate that this subunit is absolutely required for replisome function. The duplex DNA binding activity of the B subunit is needed for coordination of POL{gamma} holoenzyme and TWINKLE helicase activities at the mtDNA replication fork. In the absence of proof for direct physical interactions between the components of the mitochondrial replisome, these functional interactions may explain the strict interdependence of TWINKLE and DNA polymerase {gamma} for mitochondrial DNA synthesis. Furthermore, mutations in TWINKLE as well as in the catalytic A and accessory B subunits of the POL{gamma} holoenzyme, may cause autosomal dominant progressive external ophthalmoplegia, a disorder associated with deletions in mitochondrial DNA. The crucial importance of the B subunit for replisome function may help to explain why mutations in these three proteins cause an identical syndrome.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The molecular mechanisms by which mitochondrial DNA (mtDNA) is replicated in mammalian cells are of fundamental biological interest. Saccharomyces cerevisiae has served as a model system for studies of mammalian mtDNA replication, but there are significant differences between yeast and mammalian cells (1). Replication of the S. cerevisiae mtDNA is initiated from multiple sites of the ~86 kb genome and the mtDNA molecules frequently undergo recombination. In contrast, the smaller mammalian mtDNA (~16 kb) initiates DNA replication from two specific origins of replication, oriH and oriL, and recombination is a rare or possibly even non-existent phenomenon (2). The replicative DNA polymerase {gamma} (POL{gamma}) has been characterized in many species. In animal cells, the POL{gamma} holoenzyme consists of a catalytic subunit (POL{gamma}A) and an accessory subunit (POL{gamma}B). POL{gamma}A has a molecular weight of 140 kDa, and harbors polymerase and 3'-5' exonuclease activities. POL{gamma}B is present in Homo sapiens, Mus musculus, Drosophila melanogaster and Xenopus laevis (3,4), but is notably absent in S. cerevisiae. POL{gamma}B acts as a processivity factor (5), which increases the affinity of the polymerase for DNA and promotes tighter nucleotide binding, thereby increasing the polymerization rate (5,6). The crystal structures of both mouse and human POL{gamma}B have revealed the protein as a dimer with high similarities to aminoacyl tRNA synthetases (7,8). Molecular modeling using the POL{gamma}B structure and the bacteriophage T7 DNA polymerase ternary complex, has shown that POL{gamma}B together with POL{gamma}A may encircle the double-stranded DNA (dsDNA), thereby tethering the enzyme to the DNA substrate and increasing processivity (8). POL{gamma}B also binds non-specifically to stretches of duplex DNA longer than 45 bp, but the functional importance of this activity remains unclear (6).

The mitochondrial DNA helicase TWINKLE displays sequence similarity to the bacteriophage T7 gene 4 protein, a helicase-primase required at the phage DNA replication fork (9). TWINKLE displays distinct substrate requirements and can only unwind short stretches (<20 bp) of dsDNA in the 5' to 3' direction (10). In a related way, the POL{gamma} holoenzyme is unable to use dsDNA as template for DNA synthesis. However, when the POL{gamma} holoenzyme and TWINKLE are combined, they form a processive replication machinery, a replisome, which can utilize duplex DNA as template to synthesize ssDNA molecules of about 2 kb. Addition of the mitochondrial single-stranded DNA-binding protein (mtSSB) stimulates the reaction further, generating DNA products of about 16 kb, the size of the mammalian mtDNA molecule (11). A close functional interaction between the mitochondrial replication factors is also demonstrated by the many different mutations in both TWINKLE and POL{gamma}A, which cause autosomal dominant progressive external ophthalmoplegia (adPEO) (9), a human disorder associated with deletions in mitochondrial DNA. Recently a mutation in POL{gamma}B was also shown to cause the same disorder (12).

Here we demonstrate that POL{gamma}B and its dsDNA-binding activity are absolutely required for the function of the mitochondrial DNA replisome. The dsDNA-binding activity of POL{gamma}B is not required to stimulate the DNA synthesis rate or the processivity of the POL{gamma}A, but is instead needed for functional interactions between the POL{gamma} holoenzyme and TWINKLE at the mtDNA replication fork. In the absence of proof for direct physical interactions between the components of the mtDNA replisome, this functional interaction may explain the strict interdependence of TWINKLE and the POL{gamma} holoenzyme for DNA synthesis on a duplex DNA template.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Recombinant proteins
TWINKLE, mtSSB, POL{gamma}A and POL{gamma}B were expressed and purified as described previously (11), with the following modifications. The peak fractions of POL{gamma}A from the Hi-trap Heparin column was diluted to 100 mM NaCl with buffer B (20 mM Tris-HCl [pH 8.0], 0.5 mM EDTA [pH 8.0], 10% glycerol and 1 mM DTT) and loaded on a 1-ml Mono Q column (Amersham Biosciences) equilibrated in buffer B (0.1 M NaCl). The column was washed with three column volumes of buffer B (0.1 M NaCl) and then eluted with a linear gradient (10 ml) of buffer B (0.1 – 1.0 M NaCl). POL{gamma}A eluted at 400 mM NaCl and the yield from 800 ml of culture was about 1 mg POL{gamma}A protein. The peak fractions of POL{gamma}B eluted from the Hi-trap Heparin column was dialyzed against buffer C (50 mM NaPO4 [pH 7.0], 0.5 mM EDTA [pH 8.0], 10% glycerol and 1 mM DTT) containing 0.1 M NaCl. POL{gamma}B was further purified on a 1-ml Hi-Trap SP column (Amersham Biosciences) equilibrated in buffer C (0.1 M NaCl). After washing the column with three column volumes of buffer C (0.1 M NaCl), POL{gamma}B was eluted with a linear gradient (10 ml) of buffer C (0.1 – 1.0 M NaCl) and the peak of protein eluted at 300 mM NaCl. A 6xHis-tagged version of POL{gamma}B cloned into pBacPAK9 (11) was used for PCR-based mutagenesis, as previously described (13). Plasmids containing the RK, RKK, IF and VV mutations were sequenced and used to prepare Autographa California nuclear polyhedrosis virus recombinant for the proteins as described in the BacPAK manual (Clontech). The mutant versions of POL{gamma}B were purified following the same protocol used for the wt, with the exception that the RK and RKK mutant did not bind to the heparin and SP columns, but eluted in the flow through fractions from both these columns. The proteins were concentrated on centricon 30 (Amicon). We estimated the purity of the proteins to be at least 95% by SDS-PAGE with Coomassie blue staining (Figure 1A).


Figure 1
View larger version (43K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Purification and characterization of the recombinant POL{gamma}B proteins (A), Purified recombinant wt and mutant versions of POL{gamma}B (0.5 µg) were separated by SDS–PAGE (12.5%) and revealed with Coomassie brilliant blue staining. lane 1, size marker; lane 2, wt POL{gamma}B; lane 3, RK mutant; lane 4, RKK mutant; lane 5, IF mutant; lane 6, VV mutant. (B) DNA binding affinity of POL{gamma}B mutants was determined by EMSA using a P32-labeled 50-bp dsDNA probe (10 fmol/reaction). The reactions were performed as described in experimental procedures in the presence of increasing amount of the indicated POL{gamma}B versions (0.2, 0.4 and 0.8 pmol). After incubation for 10 min at RT the protein-DNA complexes were analyzed on a 0.8% native agarose gel. (C) Interactions between the POL{gamma}B mutants and the catalytic POL{gamma}A subunit were determined by EMSA using a P32-labeled primed DNA template (10 fmol). The template was incubated with POL{gamma}A (0.5 pmol) and increasing amounts of POL{gamma}B (0, 0.5 and 1 pmol) for 10 min at RT. The protein–DNA complexes were immediately analyzed on a native 0.8% agarose gel.

 
In vitro DNA replication
The mini-circle template for rolling-circle DNA replication was generated as previously described (14). The mini-circle template (10 fmol) was added to a reaction mixture (20 µl) containing 25 mM Tris-HCl (pH 7.5), 10 mM magnesium chloride, 1 mM DTT, 100 µg/ml BSA, 4 mM ATP, 10% glycerol, 250 µM dATP, 250 µM dTTP, 250 µM dGTP, 10 µM dCTP, 2 µCi [{alpha}-32P] dCTP, and the indicated amounts of the different replication factors. The reaction was incubated at 37°C and stopped at the times indicated by adding 200 µl of stop buffer (10 mM Tris-HCl [pH 8.0], 0.2 M NaCl, 1 mM EDTA and 0.1 mg/ml glycogen). The samples were then treated with 0.5% SDS and 100 µg/ml proteinase K for 45 min at 42°C, and precipitated by adding 0.6 ml of ice-cold 95% ethanol. The pellets were dissolved in 10 µl of gel-loading buffer (98% formamide, 10 mM EDTA [pH 8.0], 0.025% xylene cyanol FF, 0.025% bromophenol blue). The samples were heated at 95°C for 5 min and separated on a 10% denaturing polyacrylamide gel in 1 X TBE buffer. For analysis of longer replication products, the pellets were dissolved in denaturing agarose buffer and separated on a 0.75% denaturing agarose gel as described previously (11). The gels were dried onto DE81 (Whatman) and visualized by autoradiography overnight at –80°C with an intensifying screen.

Electrophoresis mobility shift assay
The dsDNA-binding affinity of POL{gamma}B was assayed by an electrophoresis mobility shift assay (EMSA) using a double-stranded probe (5' GGCGTATATCCAAATTAAAAGCATTTTTGATTGCATATATATCATCAGCT 3') labeled with [{alpha}-32P] dCTP using the Klenow fragment of DNA polymerase I. Reactions were carried out in 15 µl volumes containing 10 fmol DNA template, 20 mM Tris-HCl [pH 7.5], 1 mM DTT, 0.1 mg/ml bovine serum albumin, 10 mM MgCl2, 10% glycerol, 2 mM ATP, and the protein concentrations indicated in the figure legend. DNA binding affinity of POL{gamma}A to a primer-template was assayed using a 35-mer oligonucleotide (5' TTTTTTTTTTATCCGGGCTCCTCTAGACTCGACCG 3') labeled in the 5' end with [{gamma}-32P] ATP and annealed to a 20-mer complementary oligonucleotide (5'CGGTCGAGTCTAGAGGAGCC3') to produce a primed-template with a 15 bases single-stranded 5'-tail. The reactions were carried out as with the dsDNA but 0.3 mM ddGTP and 3 mM dCTP were added to the reaction mixture. Proteins were added as indicated in the figure legends and reactions were incubated at RT for 10 min before separation on a 0.8% agarose gel in 1 X TBE for 2 h at 100 V.

DNA synthesis assay
A 60-mer oligonucleotide (5'GGCCCCCTAGGTGATCAAGACACATAATTATTCTTATAAGAACATGTTCATGCCGAGGTT3') was annealed to single-stranded pBluescript II KS+, which had been isolated according to the manufacturer's protocol (Stratagene). The template formed contains a 20-bp duplex region and a 40-bases single-stranded 5'-tail. Reactions were carried out in 20 µl volumes containing 10 fmol template DNA, 10 mM Tris-HCl [pH 7.5], 1 mM DTT, 0.1 mg/ml BSA, 10 mM MgCl2, 10% glycerol, 2 mM ATP, 10 µM dCTP, 100 µM dATP, 100 µM dTTP, 100 µM dGTP, 2 µCi [{alpha}-32P] dCTP. Reactions were incubated at 37°C for the indicated times and separated on a 0.8% agarose gel at 120 V for 2 h in 1 X TBE.

Polymerase/3'-5' exonuclease coupled assay
A 35-mer oligonucleotide (5'TTTTTTTTTTATCCGGGCTCCTCTAGACTCGACCG3') was annealed to a 20-mer complementary oligonucleotide (5'CGGTCGAGTCTAGAGGAGCC3') labeled in 5'-end with [{gamma}-32P] ATP to produce a primed-template that can be used as a substrate for both DNA polymerization and 3'-5' exonuclease activity. The reaction mixture contained 10 fmol of the DNA template, 25 mM Tris-HCl [pH 7.5], 10% glycerol, 1 mM DTT, 10 mM MgCl2, 100 µg/ml BSA, 60 fmol of POL{gamma}A and 120 fmol of either wild-type or mutant POL{gamma}B and the indicated concentrations of the four dNTPs. The reaction was incubated at 37°C for 15 min and stopped by the addition of 10 µl of gel-loading buffer. The samples were analyzed on a 15% denaturing polyacrylamide gel in 1 X TBE buffer. Polymerization or 3'-5' exonuclease activity are detected by, respectively, an increase or a decrease in the size (20-mer) of the 5' labeled primer.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Purification and initial characterization of mutant POL{gamma}B proteins
We wanted to study the role of POL{gamma}B in mtDNA replication and therefore made a series of mutant constructs based on information from the crystal structure of POL{gamma}B (7). We constructed the POL{gamma}B-IF mutant by changing two conserved hydrophobic residues (I442F448 to A442D448) in a region required for interactions with POL{gamma}A. In the crystal structure of POL{gamma}B, two Na+ ions are buried in the dimer interface. The role of these metal-binding sites is not known, but the regular coordination geometry suggests that in vivo this could be a binding site for a divalent cation, e.g. magnesium. To address the functional importance of the metal-binding site for POL{gamma}B activity, we mutated two of the three amino acids involved in metal ion coordination (V119V125 to A119A125) to construct the POL{gamma}B-VV mutant. Finally, we made the POL{gamma}B-RK mutant by changing positions R328K329 into A328A329 and the POL{gamma}B-RKK mutant by changing positions R363K364K365 into A363A364A365. Others have shown that the RK and RKK mutations abolish the dsDNA-binding activity of POL{gamma}B (6).

We expressed the mutant versions of POL{gamma}B in insect cells and the proteins were purified to near homogeneity (Figure 1A). To verify the properties of our mutant POL{gamma}B proteins, we first investigated the dsDNA-binding activity (Figure 1B). Wild-type POL{gamma}B, as well as the IF and VV mutants bound duplex DNA in a gel-shift assay. In contrast, the RK and RKK mutants had lost the dsDNA-binding activity and failed to interact with the radioactively labeled probe.

We also investigated the ability of the mutant POL{gamma}B versions to interact with POL{gamma}A in a gel retardation assay. POL{gamma}A forms a distinct complex with a primed DNA substrate. POL{gamma}B alone does not bind the substrate, but can super-shift a POL{gamma}A–DNA complex, thereby revealing direct POL{gamma}A–POL{gamma}B interactions (15). All the mutants, except the IF mutant super-shifted the POL{gamma}A–DNA complex (Figure 1C). We could therefore conclude that the IF mutation impairs POL{gamma}B interaction with POL{gamma}A.

The dsDNA-binding activity of POL{gamma}B is not required to stabilize POL{gamma}A interactions with a primed DNA substrate
POL{gamma}B has been shown to stabilize POL{gamma}A interactions with a primed DNA substrate and we wanted to monitor the effects of our POL{gamma}B mutations on this activity (15). We formed the template by annealing a 35-mer oligonucleotide to a complementary 20-mer oligonucleotide, to produce a primed-template with a 15 bases single-stranded 5'-tail. We added POL{gamma}A in combination with POL{gamma}B to the radioactively labeled substrate (Figure 2A). Following 10 min of incubation, we added a 1000-fold excess of cold primed DNA substrate to the reactions and withdrew aliquots at the times indicated. POL{gamma}A alone dissociates from the template immediately after addition of competing primed DNA substrate (Figure 2A, lane 3). The addition of wt POL{gamma}B had a strong stabilizing effect on POL{gamma}A interactions with the primed DNA substrate (Figure 2A, lanes 8–12). To our surprise, the RK and RKK mutants behaved as the wt protein and stabilized POL{gamma}A binding to the primed DNA substrate (Figure 2A, lanes 14–24). Hence, the dsDNA-binding activity of POL{gamma}B is not required to stabilize POL{gamma}A interactions with a primed DNA substrate.


Figure 2
View larger version (71K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. POL{gamma}B mutations have distinct effects on POL{gamma}A activities. (A) The binding stability of POL{gamma}A alone or together with the different POL{gamma}B mutants was investigated by a challenging experiment as described in experimental procedures. POL{gamma}A (100 fmol) and the indicated POL{gamma}B mutants (300 fmol) were incubated with a P32-labeled primed DNA template (10 fmol). After 10 min of incubation an excess of the unlabeled primed DNA template (1000 X) was added and samples were taken at the times indicated. (B) DNA synthesis rate was measured using a primed circular single-stranded DNA template (~3000 bases). POL{gamma}A (150 fmol) and the indicated POL{gamma}B mutants (300 fmol) were incubated with the primed template (10 fmol) at 37°C. Samples were taken at the times indicated, and analyzed on a 1% native agarose gel. (C) DNA polymerase/exonuclease coupled assay. The reaction was carried out as described in materials and methods using a primed DNA template, 60 fmol of POL{gamma}A, 120 fmol of the indicated POL{gamma}B versions and an increasing concentration of dNTPs (0, 1, 10, 100 and 1000 nM). The positions of the non-elongated primer (20-mer), the elongated primer (35-mer) and the degraded primer (10-mer) are indicated. lane 22 is a DNA size marker (SM).

 
POL{gamma}B dsDNA-binding activity is not required for DNA synthesis on an ssDNA template
We examined how the individual POL{gamma}B mutants affected DNA synthesis rate on a primed ssDNA template. We hybridized a 60-nt oligonucleotide to a single-stranded pBluescript II KS+ plasmid and incubated this template with the POL{gamma} holoenzyme. All the POL{gamma}B mutants, except the IF mutant (which does not interact with POL{gamma}A) were able to support the same rate of DNA synthesis as the wt POL{gamma}B protein (Figure 2B). We also monitored effects on POL{gamma}A processivity (data not shown). POL{gamma}A in isolation displays low processivity on a single-stranded DNA template, but becomes more processive when wt POL{gamma}B is added to the reaction (5). The RK, RKK and VV mutants stimulated the processivity of POL{gamma}A to the same extent as wt POL{gamma}B which is in agreement with previous reports that the dsDNA-binding activity is not required for this function (6). Therefore, the dsDNA-binding activity of POL{gamma}B is not required to stimulate POL{gamma}A processivity or DNA synthesis rate on an ssDNA template.

POL{gamma}B inhibits the POL{gamma}A exonuclease activity
Many DNA polymerases display a delicate balance between the 3' to 5' exonuclease and the polymerase activities. This balance is affected by the dNTP concentration. We monitored the ability of POL{gamma}B to influence this balance in a polymerase/exonuclease assay (Figure 2C). First, we added POL{gamma}A in isolation to a radioactively labeled primed DNA substrate in the presence of different dNTP concentrations. In the absence of dNTP, the exonuclease/polymerase balance shifted in favor of the exonuclease activity, but with increasing amounts of dNTP the balance changed in favor of polymerization (Figure 2C, lanes 2–6). Our experiments revealed that POL{gamma}A alone required a nucleotide concentration of about 1 µM for net polymerization (Figure 2C, lane 6). Interestingly, addition of POL{gamma}B blocked the exonuclease activity of POL{gamma}A (Figure 2C, compare lanes 2 and 7), but did not change the dNTP concentration required for net polymerization (Figure 2C, compare lanes 6 and 11). This observation is in agreement with previous reports that the excision rate of the POL{gamma} holoenzyme is slower than for POL{gamma}A alone (16). We also monitored the ability of POL{gamma}B mutants RK and RKK to influence the exonuclease/polymerase balance. These mutants blocked the exonuclease activity of POL{gamma}A to the same extent as the wt POL{gamma}B protein (Figure 2C, lanes 12–22). Therefore, POL{gamma}B inhibits the POL{gamma}A exonuclease activity and the POL{gamma}B dsDNA-binding activity is not required for this inhibition.

POL{gamma}B is required for mtDNA replisome function
All our experiments so far had been performed on single-stranded DNA templates. Our assays had revealed some novel aspects of POL{gamma}B function, but we had not been able to identify a functional role for the dsDNA-binding activity. We decided to investigate the role of POL{gamma}B for DNA synthesis on a duplex DNA template. To this end, we formed a template for DNA replication by annealing a 90-nt oligonucleotide to a 70-nt ssDNA mini-circle (Figure 3A). The template contained a replication fork for loading the replication machinery, a 50-bp dsDNA region and a free 3'-hydroxyl terminus that could act as a primer for DNA synthesis. Once initiated, leading-strand DNA synthesis coupled to continuous unwinding of the double-stranded template could in principle progress indefinitely. We have previously reported that the POL{gamma} holoenzyme can utilize the 3'-hydroxyl terminus on this mini-circle template and initiate DNA synthesis, but that the enzyme fails to elongate through double-stranded regions and only forms a 110-nt product. To elongate through the dsDNA region, the POL{gamma} holoenzyme requires the DNA strand unwinding activity of the TWINKLE helicase (11). In agreement with these previous studies of the POL{gamma} holoenzyme, we found that the POL{gamma}A subunit in isolation could initiate DNA synthesis on the mini-circle template, but failed to elongate through double-stranded regions (Figure 3B, lane 2). In contrast to our previous observations with the POL{gamma} holoenzyme, the TWINKLE helicase was unable to stimulate POL{gamma}A elongation through dsDNA (Figure 3B, lane 3). Addition of increasing amounts of POL{gamma}B to the reaction restored TWINKLE-dependent stimulation of POL{gamma}A and allowed for rolling-circle DNA synthesis on the dsDNA template. Our experiments therefore revealed that POL{gamma}B is absolutely required for mtDNA replisome function. In the absence of POL{gamma}B, TWINKLE cannot stimulate POL{gamma}A dependent DNA synthesis on a duplex template. Addition of mtSSB did not overcome this absolute requirement for POL{gamma}B (Figure 3C, lane 1).


Figure 3
View larger version (51K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. POL{gamma}B is required for rolling-circle DNA synthesis by POL{gamma}A and TWINKLE. (A) The mini-circle template was prepared as described in experimental procedures. DNA synthesis is initiated at the 3'-hydroxy terminus and proceeds 20 nt before it encounters the dsDNA region of the template. The template can be efficiently replicated by the POL{gamma} holoenzyme (white) and TWINKLE helicase (grey). (B) Increasing amounts of POL{gamma}B together with constant amounts of TWINKLE (200 fmol) and POL{gamma}A (150 fmol) were incubated with the mini-circle template (10 fmol) for 90 min at 37°C as indicated. lane 4, 10 fmol POL{gamma}B; lane 5, 25 fmol POL{gamma}B; lane 6, 50 fmol POL{gamma}B; lane 7, 100 fmol POL{gamma}B; lane 8, 150 fmol POL{gamma}B; lane 9, 300 fmol POL{gamma}B. The products were analyzed on a 10% denaturing polyacrylamide gel as described in materials and methods. (C) The same experiment as in panel B was performed in the presence of mtSSB (5 pmol). lane 2, 10 fmol POL{gamma}B; lane 3, 25 fmol POL{gamma}B; lane 4, 50 fmol POL{gamma}B; lane 5, 100 fmol POL{gamma}B; lane 6, 150 fmol POL{gamma}B; lane 7, 300 fmol POL{gamma}B. (D) Rolling-circle DNA synthesis in the presence of different POL{gamma}B mutants. Constant amounts of TWINKLE (200 fmol), POL{gamma}A (100 fmol), and the indicated version of POL{gamma}B (200 fmol) were added to the mini-circle template (10 fmol). The reaction was allowed to proceed at 37°C for the indicated times. The products were analyzed on a 10% denaturing polyacrylamide gel.

 
POL{gamma}B dsDNA-binding activity is needed for mtDNA replisome function
We next investigated the ability of the different POL{gamma}B mutants to support rolling circle DNA replication (Figure 3D). Only wt POL{gamma}B and the VV mutant protein could support DNA synthesis on the dsDNA template. The RK, RKK and IF mutants did not affect the ability of POL{gamma}A to initiate DNA synthesis from the 3'-hydroxyl terminus, but failed to support elongation through double-stranded regions and only allowed formation of the 110-nt product. The outcome of the experiment was not affected by addition of mtSSB to the reactions (data not shown). We could conclude that both the ability of POL{gamma}B to interact with POL{gamma}A and the dsDNA-binding activity are essential for mtDNA replisome function.

The functional role of the POL{gamma}B dsDNA-binding activity remained unclear. One explanation could be that this activity was required to stimulate the catalytic activity of POL{gamma}A on a duplex DNA template. Alternatively, the POL{gamma}B dsDNA-binding activity may be required for functional interactions with the TWINKLE helicase at the replication fork. To distinguish between these two possibilities, we utilized an exonuclease deficient version of POL{gamma}A in which a single amino acid substitution had abolished the 3' to 5' exonuclease activity. Similar mutations in other DNA polymerases confer a strand displacement activity that allows the polymerases to use duplex DNA as a template for DNA synthesis even in the absence of a DNA helicase (17,18). Wild type POL{gamma} holoenzyme lacks strand displacement activity, but the impairment of the exonuclease activity allowed the polymerase to use dsDNA as template in the absence of TWINKLE (Figure 4A). Strand displacement DNA synthesis required the presence of POL{gamma}B (data not shown). In contrast, the dsDNA-binding activity was not required, since POL{gamma}B–RK (Figure 4A) and POL{gamma}B–RKK (data not shown) were both able to support DNA synthesis by POL{gamma}A-exo on a duplex DNA template. We could therefore conclude that the POL{gamma}B dsDNA binding is not required to stimulate the catalytic activity of POL{gamma}A on a duplex DNA template.


Figure 4
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. POL{gamma}B dsDNA-binding activity is required for TWINKLE stimulation of DNA synthesis. (A) Rolling-circle DNA synthesis without TWINKLE on the duplex DNA mini-circle template. The ability of wild-type and exonuclease deficient POL{gamma}A (150 fmol) to use this template for DNA synthesis were analyzed in the presence of either wild-type or RK mutant POL{gamma}B (450 fmol). The experiment was performed as described in materials and methods. Samples were taken at the times indicated and analyzed on a 10% denaturing polyacrylamide gel. (B) Constant amounts of TWINKLE (100 fmol), exonuclease-deficient POL{gamma}A (75 fmol), mtSSB (5 pmol), wild-type POL{gamma}B (150 fmol) and RK-mutant POL{gamma}B (150 fmol) were added as indicated. The proteins were incubated with the mini-circle template (10 fmol) at 37°C for 60 min as described in materials and methods. The replication products were analyzed on a 0.7% denaturing agarose gel.

 
POL{gamma}B dsDNA-binding activity is required for TWINKLE stimulation of DNA synthesis
We next monitored the ability of TWINKLE to stimulate the exonuclease deficient POL{gamma} holoenzyme (Figure 4B). TWINKLE could stimulate DNA synthesis by the exo POL{gamma} holoenzyme and this stimulatory effect required the presence of POL{gamma}B. Notably, TWINKLE-dependent stimulation was impaired in the presence of either the POL{gamma}B–RK (Figure 4B) or POL{gamma}B–RKK mutant (data not shown). In the presence of these dsDNA-binding mutants, the amount of DNA synthesized was lower and the average length of the ssDNA molecules synthesized was shorter than with wt POL{gamma}B. Addition of mtSSB made the difference between wt and mutant POL{gamma}B even more striking (Figure 4B). We conclude that the dsDNA-binding activity of POL{gamma}B is required for TWINKLE-dependent stimulation of the POL{gamma} holoenzyme.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The mtDNA replication machinery is related to the machinery found in bacteriophage T7. The TWINKLE helicase displays high primary sequence similarity to the gene 4 helicase-primase. Furthermore the T7 DNA polymerase and POL{gamma}A are both classified as family A DNA polymerases (5,9). Studies of bacteriophage DNA replication may therefore provide essential insights into the mechanisms of mammalian mitochondrial DNA replication. The replisome of bacteriophage T7 consists of four proteins: the gene 2.5 ssDNA binding protein, the gene 4 helicase-primase, the T7 DNA polymerase and the processivity factor thioredoxin. Similar to the situation in the mitochondrial replisome, the T7 DNA polymerase/thioredoxin complex can catalyze processive DNA synthesis on ssDNA templates, but it cannot use duplex DNA as a template in the absence of the gene 4 helicase-primase (19,20). The T7 replication machinery can perform coordinated leading and lagging DNA synthesis. The gene 4 helicase-primase plays an essential role for the coordinated synthesis, since it provides binding sites for the two T7 DNA polymerases present at the fork, one on the leading strand and one on the lagging strand. A deletion of the 17 C-terminal residues of gene 4 helicase-primase results in an inability to physically interact with T7 DNA polymerase. This mutation does not affect DNA-dependent nucleotide hydrolysis, helicase and primase activities, but impairs the coupling of polymerase activity to the helicase activity. The C-terminally truncated helicase-primase is at least 10-fold less effective in stimulating DNA synthesis than the wild-type gene 4 protein (21,22).

The mitochondrial minimal replisome can perform leading strand DNA synthesis in vitro on a mini-circle template, but no lagging DNA synthesis is observed. Compared to the related T7 replisome, the mitochondrial replisome must have lost some key features, which are absolutely needed for coordinated leading and lagging strand DNA synthesis. In agreement with this notion, there is no primase activity present in the mitochondrial replisome and such an activity would be necessary for lagging strand DNA synthesis to occur (11). TWINKLE lacks an essential zinc-finger motif that is required for the primase activity of the related gene 4 protein (23,24). Furthermore, the physical interactions necessary for coordinated leading and lagging strand DNA synthesis in the phage T7 system are missing in the mitochondrial replisome. Even if we cannot formally exclude the possibility of transient interactions between TWINKLE and the POL{gamma} holoenzyme during ongoing DNA synthesis, we have so far not observed direct protein–protein contacts between these two enzymes using an array of techniques, including surface plasmon resonance, gel filtration, and the yeast 2-hybrid system (data not shown). In spite of the absence of detectable protein–protein interactions with the TWINKLE helicase, the POL{gamma} holoenzyme cannot be replaced by the T4 or T7 DNA polymerase at the reconstituted mtDNA replication fork (11). The absence of detectable interactions may suggest that the POL{gamma} holoenzyme contributes to replisome function with specific molecular functions that are not present in the phage DNA polymerases. The ability of POL{gamma}B to bind dsDNA is such a unique feature that is not found in thioredoxin, the accessory subunit of the T7 DNA polymerase.

The accessory POL{gamma}B subunit increases both the processivity and polymerization rate of the POL{gamma} holoenzyme on an ssDNA template. As demonstrated elsewhere and here, the dsDNA-binding activity of POL{gamma}B is not required for this stimulatory effect (6). A requirement for the dsDNA-binding activity is only observed on a duplex DNA template. The observed requirement is not due to effects on the catalytic activity of the POL{gamma} holoenzyme. To demonstrate this point, we used an exonuclease deficient POL{gamma} holoenzyme that is capable of strand displacement DNA synthesis in the absence of TWINKLE. This mutant requires POL{gamma}B for DNA synthesis, but is not affected by mutations that abolish the dsDNA-binding activity. Instead, the absolute requirement of the dsDNA-binding activity is only seen when the POL{gamma} holoenzyme functions together with TWINKLE at the mtDNA replication fork.

On an ssDNA template the DNA synthesis rate of the POL{gamma} holoenzyme is about 360 nt/s, whereas the mitochondrial replisome synthesizes DNA at a rate of about 180 nt/s on a duplex template. The slower rate observed for the replisome, may suggest that the TWINKLE helicase dictates the speed of the mtDNA replication fork and that the trailing POL{gamma} holoenzyme is slowed down by the TWINKLE helicase ahead. A DNA polymerase trailing behind a slower DNA helicase will ensure that the two factors stay together at the replication fork. The POL{gamma}B subunit may have two crucial roles in this process. First, as mentioned above there is a delicate balance between the polymerase and exonuclease mode in the POL{gamma} holoenzyme. If the polymerase is tailgating a slow moving DNA helicase, it could be stimulated to enter the exonuclease mode. The POL{gamma}B subunit effectively prevents this by inhibiting the POL{gamma}A exonuclease activity. Second, the dsDNA-binding capacity of POL{gamma}B may be required to ensure that the POL{gamma} holoenzyme stays bound to the template behind the slow-moving TWINKLE helicase. This idea is seemingly in contrast to findings by others and us, showing that the dsDNA-binding activity of POL{gamma}B is not required to stabilize interactions with a primed ssDNA template. However, one must remember that these investigations of primed ssDNA template interactions were done in the presence of ddNTP in order to trap the polymerase gamma in a ternary complex. These experiments are based on the knowledge that DNA polymerases form stable complex with a primed DNA template, provided that the primer template is terminated by a ddNTP and that the next dNTP specified by the template is simultaneously present. At the actual replication fork, the polymerase may instead be idling between the polymerase and exonuclease mode behind the slow-moving TWINKLE helicase. Under these conditions, the polymerase may be much more prone to leave the template and dsDNA-binding activity could be of crucial importance. In future work, we will address this and related possibilities to further clarify the molecular function of the dsDNA-binding activity of POL{gamma}B.


    Acknowledgements
 
This work was supported by grants to M.F. from the Swedish Research Council, Åke Wiberg foundation, The Swedish Society of Medicine, the Emil and Wera Cornell's foundation and European Commission (fp6 EUMITOCOMBAT). Funding to pay Open Access publication charge was provided by the Swedish Research Council.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Shadel, GS and Clayton, DA. (1997) Mitochondrial DNA maintenance in vertebrates Annu. Rev. Biochem, 66, 409–435[CrossRef][Web of Science][Medline] .

  2. Zhang, H, Barcelo, JM, Lee, B, Kohlhagen, G, Zimonjic, DB, Popescu, NC, Pommier, Y. (2001) Human mitochondrial topoisomerase I Proc. Natl. Acad. Sci. U.S.A, 98, 10608–10613[Abstract/Free Full Text] .

  3. Wang, Y, Farr, CL, Kaguni, LS. (1997) Accessory subunit of mitochondrial DNA polymerase from Drosophila embryos. Cloning, molecular analysis, and association in the native enzyme J. Biol. Chem, 272, 13640–13646[Abstract/Free Full Text] .

  4. Carrodeguas, JA, Kobayashi, R, Lim, SE, Copeland, WC, Bogenhagen, DF. (1999) The accessory subunit of Xenopus laevis mitochondrial DNA polymerase gamma increases processivity of the catalytic subunit of human DNA polymerase gamma and is related to class II aminoacyl-tRNA synthetases Mol. Cell. Biol, 19, 4039–4046[Abstract/Free Full Text] .

  5. Kaguni, LS. (2004) DNA polymerase gamma, the mitochondrial replicase Annu. Rev. Biochem, 73, 293–320[CrossRef][Web of Science][Medline] .

  6. Carrodeguas, JA, Pinz, KG, Bogenhagen, DF. (2002) DNA binding properties of human pol gammaB J. Biol. Chem, 277, 50008–50014[Abstract/Free Full Text] .

  7. Carrodeguas, JA, Theis, K, Bogenhagen, DF, Kisker, C. (2001) Crystal structure and deletion analysis show that the accessory subunit of mammalian DNA polymerase gamma, Pol gamma B, functions as a homodimer Mol. Cell, 7, 43–54[CrossRef][Web of Science][Medline] .

  8. Fan, L, Kim, S, Farr, CL, Schaefer, KT, Randolph, KM, Tainer, JA, Kaguni, LS. (2006) A novel processive mechanism for DNA synthesis revealed by structure, modeling and mutagenesis of the accessory subunit of human mitochondrial DNA polymerase J. Mol. Biol, 358, 1229–1243[CrossRef][Web of Science][Medline] .

  9. Spelbrink, JN, Li, FY, Tiranti, V, Nikali, K, Yuan, QP, Tariq, M, Wanrooij, S, Garrido, N, Comi, G, Morandi, L, et al. (2001) Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria Nat. Genet, 28, 223–231[CrossRef][Web of Science][Medline] .

  10. Korhonen, JA, Gaspari, M, Falkenberg, M. (2003) TWINKLE has 5' ->3' DNA helicase activity and is specifically stimulated by mitochondrial single-stranded DNA-binding protein J. Biol. Chem, 278, 48627–48632[Abstract/Free Full Text] .

  11. Korhonen, JA, Pham, XH, Pellegrini, M, Falkenberg, M. (2004) Reconstitution of a minimal mtDNA replisome in vitro EMBO J, 23, 2423–2429[CrossRef][Web of Science][Medline] .

  12. Longley, MJ, Clark, S, Yu Wai Man, C, Hudson, G, Durham, SE, Taylor, RW, Nightingale, S, Turnbull, DM, Copeland, WC, Chinnery, PF. (2006) Mutant POLG2 disrupts DNA polymerase gamma subunits and causes progressive external ophthalmoplegia Am. J. Hum. Genet, 78, 1026–1034[CrossRef][Web of Science][Medline] .

  13. Gaspari, M, Falkenberg, M, Larsson, NG, Gustafsson, CM. (2004) The mitochondrial RNA polymerase contributes critically to promoter specificity in mammalian cells EMBO J, 23, 4606–4614[CrossRef][Web of Science][Medline] .

  14. Falkenberg, M, Lehman, IR, Elias, P. (2000) Leading and lagging strand DNA synthesis in vitro by a reconstituted herpes simplex virus type 1 replisome Proc. Natl. Acad. Sci. U.S.A, 97, 3896–3900[Abstract/Free Full Text] .

  15. Yakubovskaya, E, Chen, Z, Carrodeguas, JA, Kisker, C, Bogenhagen, DF. (2006) Functional human mitochondrial DNA polymerase gamma forms a heterotrimer J. Biol. Chem, 281, 374–382[Abstract/Free Full Text] .

  16. Johnson, AA and Johnson, KA. (2001) Exonuclease proofreading by human mitochondrial DNA polymerase J. Biol. Chem, 276, 38097–38107[Abstract/Free Full Text] .

  17. Zhu, Y, Trego, KS, Song, L, Parris, DS. (2003) 3' to 5' exonuclease activity of herpes simplex virus type 1 DNA polymerase modulates its strand displacement activity J. Virol, 77, 10147–10153[Abstract/Free Full Text] .

  18. Tabor, S and Richardson, CC. (1987) DNA sequence analysis with a modified bacteriophage T7 DNA polymerase Proc. Natl. Acad. Sci. U.S.A, 84, 4767–4771[Abstract/Free Full Text] .

  19. Huber, HE, Russel, M, Model, P, Richardson, CC. (1986) Interaction of mutant thioredoxins of Escherichia coli with the gene 5 protein of phage T7. The redox capacity of thioredoxin is not required for stimulation of DNA polymerase activity J. Biol. Chem, 261, 15006–15012[Abstract/Free Full Text] .

  20. Nakai, H and Richardson, CC. (1988) The effect of the T7 and Escherichia coli DNA-binding proteins at the replication fork of bacteriophage T7 J. Biol. Chem, 263, 9831–9839[Abstract/Free Full Text] .

  21. Hamdan, SM, Marintcheva, B, Cook, T, Lee, SJ, Tabor, S, Richardson, CC. (2005) A unique loop in T7 DNA polymerase mediates the binding of helicase-primase, DNA binding protein, and processivity factor Proc. Natl. Acad. Sci. U.S.A, 102, 5096–5101[Abstract/Free Full Text] .

  22. Notarnicola, SM, Mulcahy, HL, Lee, J, Richardson, CC. (1997) The acidic carboxyl terminus of the bacteriophage T7 gene 4 helicase/primase interacts with T7 DNA polymerase J. Biol. Chem, 272, 18425–18433[Abstract/Free Full Text] .

  23. Shutt, TE and Gray, MW. (2006) Bacteriophage origins of mitochondrial replication and transcription proteins Trends Genet, 22, 90–95[CrossRef][Web of Science][Medline] .

  24. Shutt, TE and Gray, MW. (2006) Twinkle, the mitochondrial replicative DNA helicase, is widespread in the eukaryotic radiation and may also be the mitochondrial DNA primase in most eukaryotes J. Mol. Evol, 62, 588–599[CrossRef][Web of Science][Medline] .


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Print PDF (6884K) Freely available
Right arrow Screen PDF (473K) Freely available
Right arrowOA All Versions of this Article:
35/3/902    most recent
gkl1116v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Farge, G.
Right arrow Articles by Falkenberg, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Farge, G.
Right arrow Articles by Falkenberg, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?