Skip Navigation


Nucleic Acids Research Advance Access originally published online on May 21, 2007
Nucleic Acids Research 2007 35(Web Server issue):W633-W638; doi:10.1093/nar/gkm350
This Article
Right arrow Abstract Freely available
Right arrow Print PDF (3030K) Freely available
Right arrow Screen PDF (521K) Freely available
Right arrowOA All Versions of this Article:
35/suppl_2/W633    most recent
gkm350v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Chen, F.-C.
Right arrow Articles by Chuang, T.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, F.-C.
Right arrow Articles by Chuang, T.-J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 2007, Vol. 35, No. suppl_2 W633-W638
© 2007 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.


Articles

INDELSCAN: a web server for comparative identification of species-specific and non-species-specific insertion/deletion events

Feng-Chi Chen1, Chueng-Jong Chen2 and Trees-Juen Chuang2,*

1Division of Biostatistics and Bioinformatics, National Health Research Institute, Miaoli County 350, Taiwan and 2Genomics Research Center, Academia Sinica, Taipei 11529, Taiwan

*To whom correspondence should be addressed. Tel: +886 2 27898730 348; Fax: +886 2 27898757; Email: trees{at}gate.sinica.edu.tw

Received January 30, 2007. Revised April 12, 2007. Accepted April 23, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 WEB SEVER DESCRIPTION
 CONCLUSION
 REFERENCES
 
Insertion and deletion (indel) events usually have dramatic effects on genome structure and gene function. Species-specific indels have been demonstrated to be associated with species-unique traits. Currently, indel identifications mainly rely on pair-wise sequence alignments (the ‘pair-wise indels’), which suffer lack of discrimination of species specificity and insertion versus deletion. Also, there is no freely accessible web server for genome-wide identification of indels. Therefore, we develop a web server—INDELSCAN— to identify four types of indels using multiple sequence alignments that include sequences from one target, one subject and ≥1 out-group species. The four types of indels identified encompass target species-specific, subject species-specific, non-species-specific and target-subject pair-wise indels. Insertions and deletions are discriminated with reference to out-group sequences. The genomic locations (5'UTR, intron, CDS, 3'UTR and intergenic region) of these indels are also provided for functional analysis. INDELSCAN provides genomic sequences and gene annotations from a wide spectrum of taxa for users to select from, including nine target species (human (Homo sapiens), mouse (Mus musculus), rat (Rattus norvegicus), dog (Canis familiaris), opossum (Monodelphis domestica), chicken (Gallus gallus), zebrafish (Danio rerio), fly (Drosophila melanogaster) and yeast (Saccharomyces cerevisiae) and >35 subject/out-group species, ranging from yeasts to mammals. The server also provides analytic figures and supports indel identification from user-uploaded alignments/annotations. INDELSCAN is freely accessible at http://indelscan.genomics.sinica.edu.tw/IndelScan/.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 WEB SEVER DESCRIPTION
 CONCLUSION
 REFERENCES
 
Insertions and deletions (indels) represent a major force of genome evolution. It has been revealed that indels occur at a surprisingly high frequency and contribute to sequence divergence more than nucleotide substitutions do (1–4) between very closely related species, such as human and chimpanzee (3, 5–7). Indels that occur after speciation (i.e. species-specific indels) can lead to significant changes in phenotype (8–10) in light of their dramatic effects on genome structure and gene function (6). Therefore, genome-wide analysis of species-specific indels and non-species-specific indels (‘NSS’ indels, i.e. indels of which species specificity is not observed) may shed some light on the mechanisms of genome evolution and functional divergence. However, currently no freely accessible web-based server is available for genome-wide identification of such indels. Hence, it is essential to develop a computational platform for this purpose.

Here we develop a web sever (‘INDELSCAN’) to infer species-specific and NSS indels using multiple sequence alignments from at least three species. The compared species should include one target species, one subject species and at least one out-group species. Note that the selection of out-group species is important for the resolution of INDELSCAN to infer insertions and deletions. The differentiation between insertions and deletions is evolutionarily important, and is usually impossible in pair-wise genome comparisons. In general, the out-group species should be more distantly related to both the target and subject species than they are to each other. Yet, an out-group very distant from both compared species may yield minimal resolution in the comparison. The identified target species-specific indels (‘TSS’ indels, i.e. indels that are specific to the target species), which are supported by out-group sequences, should have considerably higher accuracy than indels inferred from target-subject pair-wise comparisons if the subject genome remains a draft. Moreover, by incorporating annotations of the target genome, the web server can display the distributions of indels in different genomic regions [including coding sequence (CDS), untranslated region (UTR), intron and intergenic region]. The genomic sequences and annotations of 9 target species and more than 35 subject/out-group species (see Table 1) are available for the current version of INDELSCAN for analysis. The server also provides the target-subject pair-wise indels for comparison.


View this table:
[in this window]
[in a new window]

 
Table 1. Currently available target, subject and out-group species at INDELSCAN (downloaded from the UCSC genome browser at http://hgdownload.cse.ucsc.edu/downloads.html.)

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 WEB SEVER DESCRIPTION
 CONCLUSION
 REFERENCES
 
Process flow of INDELSCAN
The system flow of TSS/NSS indel identification and categorization are stated below. First, the user can upload multiple sequence alignments of at least three species in the UCSC (University of California, Santa Cruz) multiple alignment format (described at http://genome.ucsc.edu/goldenPath/help/maf.html) and specify the target, subject and out-group species. The user can also select the compared species from the INDELSCAN-provided species list, which is linked to pre-stored genomic sequences downloaded from the UCSC genome browser (http://hgdownload.cse.ucsc.edu/downloads.html). To reduce potential errors, only indels that occur within continuously alignable sequences are considered. Second, overlapping alignments (i.e. one target sequence segment is aligned to two or more genomic sequences in the compared species) are filtered out in the system to eliminate potential spurious indels. Third, three indel types (also see Figure 1), TSS (Events 1 and 2), subject species-specific (‘SSS’; Events 3 and 4) and NSS (Events 5 and 6) indels, are identified. The TSS indels are classified into TSS insertions and TSS deletions based on comparison with the out-group genomic sequence(s) (described below). Fourth, using the user-input or INDELSCAN-provided annotations of the target genome, the genomic locations (i.e. 5'UTR, intron, CDS, 3'UTR and intergenic region) of the identified indels are determined. Finally, the system adjusts the UCSC pair-wise sequence alignments (described below) and provides pair-wise indels between the target and subject genomes for comparison. Analytic figures/tables that compare the numbers and rates of TSS, SSS, NSS and pair-wise indels are also provided.


Figure 1
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Three types of INDELSCAN-identified indels: TSS indels (Events 1 and 2), SSS indels (Events 3 and 4) and NSS indels (Events 5 and 6), with odd number events representing insertions and even number events, deletions.

 
Discrimination between TSS insertions and TSS deletions
As stated above (also see Figure 1), the inclusion of out-group genomic sequences enables the system to distinguish between insertions and deletions in TSS indels. Here, a TSS insertion is defined as a DNA segment (or a single base) of the target species genome that is not only absent in the orthologous genomic sequence of the subject species but also absent or partially absent in the out-group species (e.g. Event 1). A TSS deletion is defined in a similar way (e.g. Event 2). If the subject species genome compared is still in the draft stage, then many indels (especially one- or two-bp indels) inferred from target-subject pair-wise sequence alignments may be false positives that result from sequencing or assembling errors. The TSS indels identified by INDELSCAN are therefore more reliable than indels inferred from pair-wise comparisons because the former are supported by the genomic sequences of the out-group species.

Update of UCSC multiple sequence alignments of vertebrate genomes
The chimpanzee genome used in the current UCSC multiple alignments of vertebrate genomes is Build 1 Version 1 (or UCSC version panTro1). To include the up-to-date chimpanzee genome (Build 2 Version 1 or UCSC version panTro2), three processes were performed. First, in the UCSC human-genome-based (hg18) multiple alignments, we replaced panTro1 with panTro2 transplanted from the UCSC human–chimpanzee pair-wise alignments (hg18 versus panTro2). Second, we used the MUSCLE package (11,12) to realign the updated sequences. Finally, the new alignments were transformed to the UCSC multiple alignment format.

Justification of pair-wise sequence alignments
In the UCSC alignments, there exist a considerable number of potentially artificial alignment gaps,

e.g.

aagcatgcat—gaatcggata

aagcatg—agttgaatcggata

Such alignments might result in false indel inferences. To eliminate these gaps, we realigned and closed neighboring UCSC alignment gap pairs that satisfied both of these conditions: (i) one gap occurs in the subject genome and the other in the target genome and (ii) the distance between these two gaps is not larger than three bases. And the adjustment process continues until no gap pairs satisfy the conditions. The alignment shown above is adjusted as follows:

aagcatgcat-gaatcggata

aagcatgagttgaatcggata

Implementation and run time
Our server is implemented in ASP.NET on the server end and java script on the client end. There are four major steps in this program: scanning the multiple sequence alignments and filtering out overlapping alignments; inferring TSS, SSS and NSS indels from the multiple sequence alignments; determining the genomic locations of the identified indels and identifying target-subject pair-wise indels. As an example of run time, analysis of indels in the human chromosomes 21 and 22 using human as target, chimpanzee as subject and macaque, mouse and rat as out-group species takes approximately 3 min (see Figure 2).


Figure 2
View larger version (32K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. The INDELSCAN web sever. (A) Users can choose from pre-stored genomic sequences for comparison or (B) upload their own multiple sequence alignments and annotations. (C) The server will exhibit the time elapsing and request link after the job is submitted. (D) When the job is completed, the server gives the links from which the results can be downloaded. (E) Also provided are analytical figures that show the numbers of indels, indel rates and genomic distributions of indels (results in the human chromosome 22 are not shown in the figure).

 

    WEB SEVER DESCRIPTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 WEB SEVER DESCRIPTION
 CONCLUSION
 REFERENCES
 
Input
INDELSCAN supports two schemes for inputting multiple alignments and annotation information in the target genome: users can use the INDELSCAN-provided alignments/annotation (Figure 2A) or upload their own data (Figure 2B). For the former scheme, users can select one target, one subject and at least one out-group species in the system. The web server allows users to choose one out of nine target species, including human (Homo sapiens), mouse (Mus musculus), rat (Rattus norvegicus), dog (Canis familiaris), opossum (Monodelphis domestica), chicken (Gallus gallus), zebrafish (Danio rerio), fly (Drosophila melanogaster) and yeast (Saccharomyces cerevisiae). Table 1 lists the available subject and out-group species for each target species. As shown in Figure 2A, users can also choose to perform indel analysis for single or multiple chromosomes or only in user-specified region(s)/gene(s). For the latter scheme, users must upload three files to the system: description of compared species, multiple sequence alignments and target genome annotation (Figure 2)B. Note that INDELSCAN by default takes the first sequence in the uploaded multiple alignments as target species sequence, and the second as subject-species sequence, whereas the others are regarded as out-group sequences. Also note that only the species specified in the description file will be processed in the server. For each submitted job, INDELSCAN will automatically assign a request link for the user to retrieve the results (Figure 2C).

Output
When the submitted job is completed, users can use the request link to visualize or download their results. Two text outputs (indels inferred from multiple sequence alignments and pair-wise indels) are also downloadable from the system (Figure 2D), including the coordinates of the identified indels in the target and subject genomes, indel lengths, genomic locations of indels and the IDs of indel-affected genes. The result page also shows analytic figures for comparisons of the numbers and rates of TSS, SSS, NSS and pair-wise indels for each user-specified region (Figure 2E). The results of each query will be retained in the system for 48 h.


    CONCLUSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 WEB SEVER DESCRIPTION
 CONCLUSION
 REFERENCES
 
The INDELSCAN web interface identifies TSS, SSS and NSS indels using multiple sequence alignments. So far, such comparisons have remained scarce due to lack of suitable analysis tools and high-quality genomic sequences. With the rapidly increasing number of available genomes, multi-genome comparisons will soon become a norm. INDELSCAN will therefore, be helpful for analysis of species-specific and non-species-specific indels. Moreover, the server also detects the genomic locations of the identified indels, giving very useful information for biologists to functionally study these indels. Note that the web interface can identify indels on a genome-wide scale or in individual genes or shorter sequences of interest. Individual genes and sporadic sequences are more readily accessible than complete genome sequences. It is relatively easy to compare shorter homologous sequences of a large number of species for inference of species specificity, which would otherwise be limited to only a few compared species in genome-scale comparisons. Such large-number-species comparisons can provide high resolution for inference of species specificity and paths of indel evolution through the phylogenetic tree of the compared species. Currently, the INDELSCAN-provided multiple sequence alignments are downloaded from the UCSC genome browser, which deals with gaps by assigning gaps to branches in the phylogenetic tree using out-group information (13). For multiple sequence alignment tools, to measure the cost of a multiple alignment and to choose gap costs consistent with the measure chosen remain challenging (14–16). Many tools have been proposed and have performed well. For example, CLUSTALW (17) dynamically adjusts the gap penalties in a position- and residue-specific manner. T-Coffee (18) improves the accuracy but sacrifices the efficiency by first building a library of both local and global alignments for each pair of sequences and then using a library-based scoring scheme for progressive alignment. MUSCLE (11,12) and MAFFT (19) enhance both the accuracy and efficiency by initially building a progressive alignment and then horizontally refining the phylogenetic tree to improve the objective score. In our server, indel analyses will not be limited to the sequence alignments available from UCSC, but can be performed together with any multiple sequence alignment tools. Moreover, INDELSCAN can be applied to the detection of lineage-specific indels, such as primate-, rodent-, mammal-, avian- or fish-specific indels. Results thus obtained may bring functional and evolutionary insights and help focus experimental studies. Finally, analyses of indel events can be combined with other species-specific events, such as nucleotide substitutions, frame-shift mutations (20), duplications (21) and pseudogenizations (22), to further our understanding of the mechanisms of speciation and functional divergence.


    ACKNOWLEDGEMENTS
 
We thank Yao-Ting Huang for comments on the web server. This work is supported by the Genomics Research Center (GRC), Academia Sinica, Taiwan and the National Health Research Institutes (NHRI), Taiwan, under contract NHRI-EX95-9408PC (to TJC) and NHRI intramural grant (to FCC). Funding to pay the Open Access publication charge was provided by GRC, Academia Sinica, Taiwan (to TJC).

Conflict of interest statement. None declared.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 WEB SEVER DESCRIPTION
 CONCLUSION
 REFERENCES
 

  1. Britten RJ. Rates of DNA sequence evolution differ between taxonomic groups. Science (1986) 231:1393–1398.[Abstract/Free Full Text]

  2. Frazer KA, Chen X, Hinds DA, Pant PV, Patil N, Cox DR. Genomic DNA insertions and deletions occur frequently between humans and nonhuman primates. Genome Res (2003) 13:341–346.[Abstract/Free Full Text]

  3. Watanabe H, Fujiyama A, Hattori M, Taylor TD, Toyoda A, Kuroki Y, Noguchi H, BenKahla A, Lehrach H, et al. DNA sequence and comparative analysis of chimpanzee chromosome 22. Nature (2004) 429:382–388.[CrossRef][Medline]

  4. Anzai T, Shiina T, Kimura N, Yanagiya K, Kohara S, Shigenari A, Yamagata T, Kulski JK, Naruse TK, et al. Comparative sequencing of human and chimpanzee MHC class I regions unveils insertions/deletions as the major path to genomic divergence. Proc. Natl Acad. Sci. USA (2003) 100:7708–7713.[Abstract/Free Full Text]

  5. Chen FC, Chen CJ, Li WH, Chuang TJ. Human-specific insertions and deletions inferred from mammalian genome sequences. Genome Res (2006) 17:16–22.[CrossRef][Web of Science][Medline]

  6. The Chimpanzee Genome Sequencing and Analysis Consortium. Initial sequence of the chimpanzee genome and comparison with the human genome. Nature (2005) 437:69–87.[CrossRef][Medline]

  7. Newman TL, Tuzun E, Morrison VA, Hayden KE, Ventura M, McGrath SD, Rocchi M, Eichler EE. A genome-wide survey of structural variation between human and chimpanzee. Genome Res (2005) 15:1344–1356.[Abstract/Free Full Text]

  8. Stedman HH, Kozyak BW, Nelson A, Thesier DM, Su LT, Low DW, Bridges CR, Shrager JB, Minugh-Purvis N, et al. Myosin gene mutation correlates with anatomical changes in the human lineage. Nature (2004) 428:415–418.[CrossRef][Medline]

  9. Hayakawa T, Satta Y, Gagneux P, Varki A, Takahata N. Alu-mediated inactivation of the human CMP- N-acetylneuraminic acid hydroxylase gene. Proc. Natl Acad. Sci. USA (2001) 98:11399–11404.[Abstract/Free Full Text]

  10. Hamann J, Kwakkenbos MJ, de Jong EC, Heus H, Olsen AS, van Lier RA. Inactivation of the EGF-TM7 receptor EMR4 after the Pan-Homo divergence. Eur. J. Immunol (2003) 33:1365–1371.[CrossRef][Web of Science][Medline]

  11. Edgar RC. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics (2004) 5:113.[CrossRef][Medline]

  12. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res (2004) 32:1792–1797.[Abstract/Free Full Text]

  13. Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res (2004) 14:708–715.[Abstract/Free Full Text]

  14. Altschul SF. Gap costs for multiple sequence alignment. J. Theor. Biol (1989) 138:297–309.[CrossRef][Web of Science][Medline]

  15. Lipman DJ, Altschul SF, Kececioglu JD. A tool for multiple sequence alignment. Proc. Natl Acad. Sci. USA (1989) 86:4412–4415.[Abstract/Free Full Text]

  16. Chan SC, Wong AK, Chiu DK. A survey of multiple sequence comparison methods. Bull. Math. Biol (1992) 54:563–598.[Web of Science][Medline]

  17. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res (1994) 22:4673–4680.[Abstract/Free Full Text]

  18. Notredame C, Higgins DG, Heringa J. T-Coffee: A novel method for fast and accurate multiple sequence alignment. J. Mol. Biol (2000) 302:205–217.[CrossRef][Web of Science][Medline]

  19. Katoh K, Misawa K, Kuma K, Miyata T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res (2002) 30:3059–3066.[Abstract/Free Full Text]

  20. Hahn Y, Lee B. Identification of nine human-specific frameshift mutations by comparative analysis of the human and the chimpanzee genome sequences. Bioinformatics (2005) 21(Suppl. 1):i186–i194.[Abstract]

  21. Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, et al. Initial sequencing and comparative analysis of the mouse genome. Nature (2002) 420:520–562.[CrossRef][Medline]

  22. Wang X, Grus WE, Zhang J. Gene losses during human origins. PLoS Biol (2006) 4:e52.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Genome ResHome page
Y.-T. Huang, F.-C. Chen, C.-J. Chen, H.-L. Chen, and T.-J. Chuang
Identification and analysis of ancestral hominoid transcriptome inferred from cross-species transcript and processed pseudogene comparisons
Genome Res., July 1, 2008; 18(7): 1163 - 1170.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (3030K) Freely available
Right arrow Screen PDF (521K) Freely available
Right arrowOA All Versions of this Article:
35/suppl_2/W633    most recent
gkm350v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Chen, F.-C.
Right arrow Articles by Chuang, T.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, F.-C.
Right arrow Articles by Chuang, T.-J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?