Nucleic Acids Research Advance Access originally published online on November 19, 2007
Nucleic Acids Research 2008 36(1):263-283; doi:10.1093/nar/gkm969
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nucleic Acids Research, 2008, Vol. 36, No. 1 263-283
© 2007 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Molecular Biology |
SUMO1 negatively regulates BRCA1-mediated transcription, via modulation of promoter occupancy
1Department of Biological Sciences & Department of Molecular Science and Technology Ajou University, Suwon and 2Seoul National University, Seoul, Korea
*To whom correspondence should be addressed. Tel: 82 31 219 1886; Fax: 82 31 219 1615; Email: jsjlee{at}ajou.ac.kr
Received March 22, 2007. Revised October 17, 2007. Accepted October 19, 2007.
| ABSTRACT |
|---|
|
|
|---|
BRCA1, a tumor suppressor gene, is implicated in the repression and activation of transcription via interactions with a diverse range of proteins. The mechanisms regulating the action of BRCA1 are not fully understood. Here, we use the promoters of Gadd45
, p27KIP1 and p21WAF1/CIP1 to demonstrate that SUMO1 represses transactivation potential of BRCA1 by causing BRCA1 to be released from the promoters and augmenting histone deacetylation via recruitment of histone deacetylase (HDAC) activity. Consistently, silencing of SUMO1 led to recruitment of BRCA1 and release of HDAC1 at the BRCA1 target promoters, and subsequent transcriptional activation of the BRCA1 target genes. Furthermore, a sumoylation-incompetent mutant missing the sumoylation donor site suppressed BRCA1-induced activation of transcription, whereas E2 UBC9 or the dominant-negative mutant UBC9 had no effect, implying that repression of BRCA1-mediated activation of transcription by SUMO1 is independent of sumoylation. Repression of BRCA1-mediated activation of transcription by SUMO1 was reversed by DNA damage by inducing the release of SUMO1 from the Gadd45
promoter and the recruitment of BRCA1, along with increased histone acetylation, to enhance activation of transcription. Together, our data provide evidence that SUMO1 plays a role in the activation-repression switch of BRCA1-mediated transcription via modulation of promoter occupancy. | INTRODUCTION |
|---|
|
|
|---|
Functional loss of BRCA1 causes defective transcription-coupled or recombination-mediated DNA repair, deregulated proliferation and predisposition to familial breast cancers (1–2), suggesting a role of BRCA1 in tumor suppression via a diversity of functions including transcription, DNA repair and cell cycle. Biochemical studies on proteins that interact with BRCA1 also provide evidence for the various roles of BRCA1 (2,3). BRCA1 interacts with transcription and chromatin-remodeling proteins, including CtIP/CtBP, RbAp46/48, RNA polymerase II, histone deacetylases (HDACs), histone acetyl transferases (HATs), c-myc, JunB, p53, Rb, estrogen receptor, androgen receptor and ZBRK1, suggesting that BRCA1 is involved in transcription and modulation of chromatic structure (2–7). The interaction of BRCA1 with a diversity of transcriptional regulators is consistent with the observed physiological actions of BRCA1 and supports the function of BRCA1 as a tumor suppressor via regulation of transcriptional activity (2,3).
BRCA1 forms both transcriptional activator- and repressor-complexes with a variety of proteins that regulate transcription, and activates or suppresses the transcription of genes involved in the cell cycle, control of growth and response to DNA damage (6,8–12). The interaction of BRCA1 with HDAC1 and 2 (13), RNA helicase (14), CBP and p300 (5,15), and the BRG1 subunit of the SWI/SNF complex (16,17), implies a critical role for BRCA1 in chromatin remodeling. It has been shown that the transactivation potential of BRCA1 is enhanced by the binding of CBP and p300 in a phosphorylation-independent manner (5). Together with RNA helicase A, BRCA1 is a component of the SWI/SNF complex, a large ATP-dependent chromatin remodeling complex, aiding the access of transcriptional machinery and transcription-coupled DNA repair proteins to DNA (17). The interaction of BRCA1 with HDAC1 and 2 mediates repression of transcription via the induction of histone deacetylation (4,6,18). In summary, results from these studies provide support for the involvement of BRCA1 in a variety of processes including transcription, DNA repair and recombination by control of chromatin remodeling.
The SUMO pathway is known to mediate repression of transcription by chromatin remodeling (19,20). Many transcription factors, including HDAC1 (21), p300/CBP (22), CtBP (23), STAT-1 (24) and BKLF (25), are subject to SUMO-mediated repression of transcription that is accompanied by histone deacetylation. Interestingly, histone 4 (H4) is sumoylated and leads to gene silencing through recruitment of the HDAC complex (19). Growing evidence highlights the widespread role of SUMO in repression of transcription.
In the present study, we have identified and characterized SUMO1 as a negative regulator of BRCA1-mediated activation of transcription. We find that SUMO1 induces the recruitment of HDAC activity to the BRCA1-regulated promoters of Gadd45
, p27KIP1 and p21WAF1/CIP1 genes, leading to reduced histone acetylation and subsequent repression of transcription. Furthermore, SUMO1 appears to suppress BRCA1-mediated activation of transcription by releasing BRCA1 and recruiting HDAC1, in a sumoylation-independent manner. Taken together, our findings suggest that SUMO1 modulates transcription by repressing BRCA1-mediated activation of transcription by chromatin remodeling involving deacetylation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid construction
To generate baits using BRCA1, four overlapping BRCA1 truncated fragments, #1 (1–324), #2 (260–553), #3 (502–802) and #4 (758–1064) were generated from pGex-BRCA1 vectors (26,27) and subcloned into pLexA (Clontech). BRCA1 V122A, V412A, V412A/V415A, I769A, V772A, I783A/V788A and V412A/I783A/V788A were constructed from the cloned BRCA1#1 to #4-pLexA plasmids and pcDNA-HA-BRCA1 (26,27) by using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). To construct the SUMO-pLexA fusion bait vector, SUMO1 cDNA fragment was generated by RT-PCR from RNA obtained from 293T cells. The BRCA1 C-terminal #5 (1005–1313) and #6 (1314–1863) fragments were generated by PCR from pGex-BRCA1 vectors (26,27) and the fragments were inserted into pB42AD (Clontech). Recombinant histidine-tagged human SUMO1 (His-SUMO1) protein vector was generated by inserting the corresponding cDNA containing the entire open reading frame into a pET28a vector (Novagen, San Diego, CA). Mammalian expression vectors for SUMO1 and SUMO1
GG were generated by inserting full-length cDNA fragments, generated by PCR from pET28a-SUMO1 using the following primers: SUMO1 (5'-GGAAGATCTATGTCTGACCAGGAGGCAAA-3' and 5'-TCCCCGCGGCTAAACCGTCGAGTGACCCC-3') and SUMO1
GG (5'-GGAAGATCTATGTCTGACCAGGAGGCAAA-3' and 5'-CCGCTCGAGCTACGTTTGTTCCTGATAAACTTCAA-3'), into pDsRed (Clontech). To generate mammalian expression vectors for Ubc9, HDAC1/2, p300 and BARD1, cDNAs containing the entire open reading frame of each gene were produced by RT-PCR of 293T or MCF7 mRNAs. The fragments were inserted into a pCDNA3 vector (Invitrogen, Carlsbad, California) hooked to the HA or FLAG epitope. Double-stranded siRNA for BRCA1 and SUMO1 were generated using the pSUPER vector (28). The sequences used for siRNA are as follows: BRCA1 (5'-GATCCCCTCTGTCTGGAGTTGATCAATTCAAGAGATTGAT CAACTCCAGACAGATTTTTGGAAA-3' and 5'-AGT TTTTCCAAAAATCTGTCTGGAGTTGATCAATCTC TTGAATTGATCAACTCCAGACAGAGGG-3'), SUMO1 (5'-GATCCCCTGGTGATAAATAAGATCGA TTCAAGAGATCGATCTTATTTATCACCATTTTTG GAAA-3' and 5'-AGCTTTTCCAAAAATGGTGATAA ATAAGATCGATCTCTTGAATCGATCTTATTTATC ACCAGGG-3'), and HDAC1 (5'-GATCCCCTGTCA AGAGCTTTAACCTGTTCAAGAGACAGGTTAAAG CTCTTGACATTTTTGGAAA-3' and 5'-AGCTTTT CCAAAAATGTCAAGAGCTTTAACCTGTCTCTTG AACAGGTTAAAGCTCTTGACAGGG-3').
Yeast two-hybrid assay
Yeast two-hybrid assays were carried out according to the manufacturer's protocol (Clontech). β-Galactosidase activity was measured in duplicate from three independent clones. This assay was performed using pLexA or pB42AD in the yeast strain EGY48 (Clontech). Sequencing of the library inserts of clones interacting with fragments #1 to #4 of BRCA1, was performed using Software (ABI. Foster City, CA).
Pull-down analysis
The histidine-tagged recombinant SUMO1 (His-SUMO1) and SUMO1
GG (His-SUMO1
GG) proteins were expressed and purified using pET-SUMO1 and SUMO1
GG in Escherichia coli BL21 (DE3) cells (Stratagene). The expression and purification of glutathione S-transferase (GST) fusion proteins and GST pull-down assays were carried out as described previously (27). Following incubation of approximately equal amounts of different purified GST fusion BRCA1 fragment proteins mixed with His-SUMO1 and His-SUMO1
GG proteins in the presence of glutathione-Sepharose 4B beads (Amersham Biosciences, Sweden), bound proteins were probed with anti-SUMO1 (Zymed, Carlsbad, California) antibody.
Cell cultures and transfection
U2OS, 293T and HeLa cells were grown in DMEM (HyClone, Logan, UT) supplemented with 10% fetal bovine serum (HyClone) and 1% penicillin–streptomycin (GIBCO, Gaithersgurg, MD). Transfection was performed with the Effectene transfection kit (Qiagen Inc, Valencia, CA).
Immunoblotting and coimmunoprecipitation
Cells were suspended in lysis buffer containing 17 mM Tris pH 8.0, 50 mM NaCl, 0.3% Triton X-100, 0.3% NP-40 and a protease inhibitor cocktail tablet (Roche, Switzerland). BRCA1, UBC9 and SUMO1 were detected with anti-BRCA1 (Santa Cruz Biotechnology, Santa Cruz, CA), anti-UBC9 (BD Biosciences), anti-SUMO1 (Santa Cruz Biotechnology and Zymed), anti-FLAG (Sigma, St. Louis, MO) and anti-LexA (Invitrogen) antibodies, respectively. For coimmunoprecipitation experiments, cell lysates were subjected to immunoprecipitation and the resulting immunoprecipitates were analyzed by immunoblotting with the indicated antibodies.
Reporter assay
U2OS, 293T or HeLa cells were incubated in 24-well plates, 1 day before transfection. Transfections were performed in quadraplicate using 1–200 ng of expression vector for pcDNA-HA-BRCA1 (wild type or mutants, V122A, V412A, V412A/V415A, I769A, V772A, I783A/V788A and V412A/I783A/V788A), pEGFP-SUMO1, pDsRed-SUMO1, pDsRed-SUMO1
GG or pcDNA3.1 (Invitrogen) as a control. Cotransfection with 20 ng of pGadd45
-luciferase reporter (10) and 1 ng of pRL SV40 or pRL TK (Promega, Madison, WI) was performed to control for transfection efficiency. At 1 day after transfection, cells were treated with or without
-irradiation (4 or 8 Gy) or 0.3 µM trichostatin A (TSA, Sigma), and incubated for another 24 h before being harvested and assayed using the Dual Luciferase Reporter Assay (Promega). The luciferase activity was standardized against the transfection efficiency for each sample. Values are the mean ± SEM. from 3 to 6 experiments (*P < 0.05 compared with reporter alone).
Chromatin immunoprecipitation
Chromatin immunoprecipitation (ChIP) assays using antisera specific to acetylated histone 4 (H4) (Upstate Biotechnology, Lake Placid, NY), HDAC1 (Upstate Biotechnology), HDAC2 (Upstate Biotechnology), BRCA1 (Santa Cruz Biotechnology), SUMO1 (Santa Cruz Biotechnology), UBC9 (BD Biosciences), BARD1 (Santa Cruz Biotechnology), RNA polymerase II (Santa Cruz Biotechnology) and p300 (Santa Cruz Biotechnology) were performed according to the manufacturer's instructions (Upstate Biotechnology). The DNA representing either 0.1% of the total chromatin sample (input) or 5–10% of the immunoprecipitate DNA was amplified using the following promoter-specific primers: Gadd45
(5'-GCTG GGGTCAAATTGCTGG-3' and 5'-GCTCGCTCGCTC CCCGGAC-3'), p27KIP1 (5'-GCTTCCCGGGAGAGGA GCG-3' and 5'-CGAGCGCGCCGCCTCCCCG-3'), p21WAF1/CIP1 (5'-CCTTGCCTGCCAGAGGGG-3' and 5'-CAGCTGCTCACACCTCAG-3'), ErbB2 (5'-CCCGG ACTCCGGGGGAGG-3' and 5'-CCCGGGGGGCTCC CCTGG-3'), β-actin (5'-GAGGGGAGAGGGGGTAA AA-3' and 5'-AGCCATAAAAGGCAACTTTCG-3'), and GAPDH (5'-TACTAGCGGTTTTACGGGCG-3' and 5'-TCGAACAGGAGCAGAGAGCGA-3'). The PCR conditions consisted of 95°C for 2 min, followed by 30–35 cycles of 95°C for 30 sec, 58°C for 30 s and 72°C for 30–60 s.
DNA binding assays
Binding reactions were performed with 300 µg of nuclear extract in a binding buffer composed of 12% glycerol, 12 mM Hepes (pH 7.9), 4 mM Tris (pH 7.9), 150 mM KCl, 1 mM EDTA, 1 mM dithiothreitol and 10 µg of poly(dI-dC) (Amersham Biosciences). Probes were prepared by annealing of oligonucleotide containing biotin on the 5'-nucleotide of the sense strand (5'-GCAGGCTGATT TGCATAGCCCAATGGCCAAGCTGCATGCAAATG AGGCGGA, –107 to –57 of the human GADD45
promoter) to the respective complementary oligonucleotide. The binding reaction and electrophoresis were performed at room temperature. BRCA1 protein bound to the biotin-labeled Gadd45
promoter oligonucleotides was pulled down with streptavidin–agarose beads (Sigma) and detected as described previously (29).
RNA isolation and RT-PCR
Total RNA was isolated from cultured cells using TRIzol reagent (Life Technologies, Inc, Gaithersburg, MD) according to the manufacturer's instructions. RT-PCR was carried out using 2–3 µg of total RNA from cells overexpressing or silencing SUMO1, BRCA1 and/or HDAC1. The primer sequences for glyceraldehydes-6-phosphate dehydrogenase (GAPDH; used as an invariant housekeeping gene internal control), Gadd45
, p27KIP1, p21WAF1/CIP1, β actin, ErbB2 and Cyclin D1 genes are as follows: GAPDH (5'-GTCAACGGATTTGGTCTGTATT-3', 5'-AGTCTTCTGGGTGGCAGTGAT-3'), Gadd45
(5'-TG ACTTTGGAGGAATTCTCGGC-3', 5'-ATGAATGTG GATTCGTCACCAGCACGCAGT-3'), p27KIP1 (5'-CCT CTTCGGCCCGGTGGAC-3', 5'-TCTGCTCCACAGA ACCGGC-3'), p21WAF1/CIP1 (5'-CCTCCTCGGCCCGG TGGAC-3', 5'-CCGTTTTCGACCCTGAGAG-3'), β-actin (5'-TGGATTCCTGTGGCATTCATGAAAC-3' and 5'-TAAAACGCAGCTCAGTTACAGTCCG-3'), ErbB2 (5'-TGGCTGCAAGAAGATCTTTG-3', 5'-TGC AGTTGACACACTGGGTG-3') and CyclinD1 (5'-CCT CTTGTGCCACAGATG-3', 5'-GATGTCCACGTCCC GCAC-3'). RT-PCR was performed as follows: annealing at 55°C with 20–28 cycles for detected genes.
Real-time PCR
All reactions were performed in triplicate using SYBR Green PCR Master Mix kit (ABI) and an ABI PRISM 7000 Sequence Detector (ABI). Primers were used as described in RT-PCR and ChIP. The PCR levels were determined by normalization to that of GAPDH control for quantification of mRNA transcripts for RT-PCR or that of input DNA for quantitative ChIP assay. Quantities of immunoprecipitated DNA or input DNA were determined based on a standard curve.
| RESULTS |
|---|
|
|
|---|
Interaction of BRCA1 with SUMO1
SUMO1 was identified as a BRCA1-interacting protein by using four overlapping BRCA1 truncated fragments from 1 to 1064, which did not include the transactivation domains at the C-terminus, as baits in a yeast two-hybrid system (Figure 1A and B). The N-terminal (1–324) and central (758–1064) BRCA1 fragments interacted more strongly than the other two fragments (260–553 and 502–802) (Figure 1B). Next, we examined whether SUMO1 interacted with BRCA1 transactivation domains (1005–1313 and 1314–1863) by using SUMO1 as the bait (Figure 1B). Unlike the fragments from 1–1064, the transactivation domains (1005–1863) did not associate with SUMO1 (Figure 1B).
|
To determine whether BRCA1 interacted directly with SUMO1, six GST-fusion BRCA1 protein fragments spanning the entire BRCA1 open reading frame (Figure 1A) were immobilized on GST-sepharose beads and incubated with recombinant His-SUMO1 proteins. Beads bound to His-SUMO1 protein were recovered from each GST-BRCA1 fusion protein and detected by immunoblotting after electrophoresis. His-SUMO1 bound strongly to the GST-BRCA1 fusion proteins containing all four N-terminal and internal BRCA1 fragments (1–324, 260–553, 502–802 and 758–1064) but not to the two GST-BRCA1 fusion proteins containing the transactivation domains at the C-terminus (1005–1313 and 1314–1863) (Figure 1C). This result is consistent with the yeast two-hybrid results (Figure 1B) and reveals that BRCA1 interacts directly with SUMO1 in vitro.
We next tested whether BRCA1 interacted with SUMO1 in vivo. SUMO1 was coimmunoprecipitated with the anti-BRCA1 antibody from 293T cell lysates, indicating that endogenous BRCA1–SUMO1 interaction occurs in 293T cells (Figure 1D). Taken together, the interaction experiments show that BRCA1 interacts with SUMO1 in mammalian cells.
Repression of BRCA1-mediated transcription by SUMO1
To understand the role of the BRCA1–SUMO1 complex, we investigated the effect of SUMO1 on BRCA1-mediated transcription. Thus, we evaluated the transcriptional activity of BRCA1 by using a luciferase reporter driven by Gadd45
promoter, which is known to be regulated by BRCA1. BRCA1 alone induced transcription from the Gadd45
promoter by 2.6-fold, whereas SUMO1 alone reduced the Gadd45
transcription by
30% of the basal level in U2OS cells (Figure 2A). Moreover, SUMO1 together with BRCA1 suppressed BRCA1-induced transcriptional activity from the Gadd45
promoter to level lower than the basal level in U2OS cells (Figure 2A). In contrast to the results with SUMO1, UBC9 failed to have an effect on Gadd45
transcription (Figure 2A). UBC9 did not enhance or suppress transcription from the Gadd45
promoter in the presence or absence of BRCA1 (Figure 2A). UBC9 did not exhibit any additive effects in combination with SUMO1 (Figure 2A), suggesting that UBC9 does not play a role in the regulation of BRCA1-induced transcriptional activity from the Gadd45
promoter.
|
Next, we examined whether SUMO1 affected BRCA1-induced transcriptional activity in other cell lines. Consistent with the observations in U2OS cells, SUMO1 repressed BRCA1-induced transcriptional activity in 293T and HeLa cells to the basal level (Supplementary Figure 1), suggesting that the repressive effect of SUMO1 on BRCA1-mediated transcription may be general.
To further examine whether the transcriptional repression of Gadd45
gene is a bona fide SUMO1 activity and not an artifact of reporter assay, we measured the total levels of Gadd45
transcript by RT-PCR analysis following ectopic expression of BRCA1 and/or SUMO1. As expected, BRCA1 alone induced transcription of Gadd45
gene (Figure 2B). However, SUMO1 alone had little effect on the Gadd45
transcription (Figure 2B). SUMO1 in the presence of exogenously expressed BRCA1 proteins repressed BRCA1-induced Gadd45
transcription to the comparable levels observed in cells without exogenously expressed BRCA1 and SUMO1 or in cells with exogenously expressed SUMO1 alone (Figure 2B). The RT-PCR results for Gadd45
mRNA (Figure 2B) is consistent with the observations from the luciferase reporter hooked with Gadd45
promoter (Figure 2A and Supplementary Figure 1), suggesting that SUMO1 can physiologically regulate the BRCA1-mediated Gadd45
transcription.
Next, we investigated whether SUMO1 could downregulate transcriptions from other promoters that are not regulated by BRCA1. BRCA1 did not alter the transcriptions from ErbB2, CyclinD1 and β-actin promoters (Figure 2B). Also, SUMO1 either alone or in the presence of BRCA1 had little effect on transcriptions of theses promoters (Figure 2B). These observations suggest that the negative transcriptional effect of SUMO1 may not be general to transcriptions from many other promoters.
Repression of BRCA1-induced transcriptional activity by SUMO1 in a sumoylation-independent manner
Sumoylation of H4 and several transcriptional regulators (30) is thought to be essential for repression of transcription. For this reason, we investigated whether sumoylation was required for repression of BRCA1-induced transcription by SUMO1. The transcriptional activity from the Gadd45
promoter was monitored in the presence of SUMO1 that was unable to sumoylate substrates (SUMO1
GG) (Figure 3A). Inactive SUMO1
GG had glycine residues at 99 and 100 in the C-terminal region which were deleted. By comparison to wild-type SUMO1, sumoylation-incompetent SUMO1
GG exhibited a similar suppressive effect on transcription from the Gadd45
promoter by BRCA1 (Figure 3A). We also examined whether dominant-negative UBC9 (DN-UBC9) that is unable to conjugate SUMO1 with substrates, had an effect on SUMO1-mediated repression of BRCA1-induced transcriptional activity. DN-UBC9 did not alter BRCA1-mediated activation of Gadd45
transcription with or without SUMO1, consistent with the effect of wild-type UBC9 (Figure 2A). Together, these results indicate that sumoylation does not play a role in the repression of BRCA1-induced transcriptional activity by SUMO1.
|
Next, we investigated whether SUMO1
GG interacted with BRCA1 (Figure 3B and C). Purified His-SUMO1
GG was incubated with the six GST-tagged BRCA1 fragments immobilized on GST-agarose beads. SUMO1
GG interacted with four BRCA1 fragments (1–1064) (Figure 3B), in a manner consistent with the wild-type protein (Figure 1C). Interaction of BRCA1 with SUMO1
GG was also examined in 293T cells (Figure 3C). EGFP–SUMO1
GG was detected in anti-BRCA1 immunoprecipitates, showing that the BRCA1–SUMO1
GG interaction occurs in vivo (Figure 3C). These observations show that BRCA1 is able to interact with sumoylation-incompetent SUMO1
GG, and this interaction may lead to suppression of BRCA1-induced transcriptional activity without covalent modification by SUMO1.
BRCA1–SUMO1 interaction is required for repression of BRCA1-mediated transcription by SUMO1
We next tested whether BRCA1–SUMO1 interaction functionally links to SUMO1-induced repression of BRCA1-mediated transcription. To this end, we identified potential sumoylation-independent SUMO1 interaction motifs (SIMs, 31–34) in BRCA1 (Figure 4A). To determine whether the putative SIMs in BRCA1 directly mediated the interaction of BRCA1 with SUMO, we mutated the putative SIMs in four BRCA1-truncated fragments from the SUMO1 interacting region (1–1064, Figure 1A) and evaluated SUMO1 interacting activity by using the mutant BRCA1 fragments as baits in the yeast two-hybrid system (Figure 4B). Mutations of the SIMs, 122VSII125 (V122A) from the N-terminal BRCA1 (1–324) and 769ISLV772 (I769A and V772A) from the central BRCA1 (502–1064) displayed SUMO1 interaction activities almost equal to that observed from BRCA1 wild type (Figure 4B). In contrast, mutations of the SIMs, 412VLDV415 (V412A) and 783ISLLEV788 (783ISLL786 and 785LLEV788, I783A/V788A) exhibited reduced SUMO1 interaction activities, compared with that of BRCA1 wild type (Figure 4B). Taken together, these interaction experiments suggest that the 412VLDV415, 783ISLL786 and 785LLEV788 SIMs in BRCA1 play a role in interacting with SUMO1.
|
We next tested whether the BRCA1–SUMO1 interaction is required for the SUMO1-induced repression of BRCA1 transcription. To do this, we generated full-length BRCA1 mutants containing amino acid changes within the SIMs and evaluated BRCA1-induced activation of Gadd45
transcription. The Gadd45
promoter-driven transcription was upregulated by approximately 3.8-fold (in the presence of BRCA1-containing mutations of one SIM; V412A, V412A/V415A or I783A/V788A) to 5.8-fold (in the presence of BRCA1-containing mutations of two SIMs; V412A/I783A/V788A) (Figure 4C), displaying higher transcriptional activation by comparison to BRCA1 wild type (
2.2-fold) (Figure 4C). These findings indicate that SIMs in BRCA1 inhibit BRCA1's transcriptional activity possibly by interaction of SUMO1 with SIMs. To test this, we analyzed effects of SUMO1 on transcriptional activities of BRCA1 mutants (Figure 4D). The repression activity of SUMO1 decreased by
30% (in the presence of one-SIM BRCA1 mutants, V412A, V412A/V415A or I783A/V788A, from
3.8-fold to
1.7-fold) to 50% (in the presence of two-SIM BRCA1 mutant, V412A/I783A/V788A, from
5.8-fold to
3.9-fold) (Figure 4D and Supplementary Figure 2) compared to that seen with BRCA1 wild type (100%, from
2.2-fold to
0.65-fold), indicating that disruption of SIMs in BRCA1 attenuates repressive activity of SUMO1 against BRCA1-mediated transcription. Together, these analyses support that the SUMO1 interaction motifs in BRCA1 participate in BRCA1–SUMO1 interaction and sequentially exert influence of SUMO1 in the repression of BRCA1-induced transcription.
Repression of BRCA1-induced transcriptional activity by SUMO1 via histone deacetylation
Several recent observations indicate a functional link between the SUMO system and HDACs in mediating transcriptional repression via the formation of transcriptionally repressive chromatin. The possibility that HDACs may function together with SUMO1 to control BRCA1-mediated transcription is also supported by the association of BRCA1 with HDACs (13). Thus, we tested the effect of an HDAC inhibitor, TSA, on Gadd45
transcription (Figure 5A). TSA enhanced Gadd45
transcription without regard to expression of BRCA1 and SUMO1 (Figure 5A). By comparison to BRCA1 alone (
2.5-fold) and TSA alone (
2.0-fold), TSA together with BRCA1 synergistically increased Gadd45
transcription by
6.1-fold (Figure 5A). Moreover, TSA abrogated the suppressive effect of SUMO1 on BRCA1-induced Gadd45
activation (Figure 5A), suggesting that SUMO1 cannot repress BRCA1-induced transcription in the presence of TSA (Figure 5A). Together, these results show that HDAC activity contributes to the repression of BRCA1-induced transcription by SUMO1.
|
To further support the role of HDAC activity in repression of BRCA1-induced transcriptional activity by SUMO1, we investigated the histone acetylation status at the Gadd45
promoter using chromatin immunoprecipitation (ChIP) with anti-acetyl H4. BRCA1 alone increased the level of acetylated H4 at the Gadd45
promoter. The addition of SUMO1 decreased the level of acetylated H4 at the Gadd45
promoter compared with the level in the presence of BRCA1 alone (Figure 5B). This result suggests a close relationship between Gadd45
transcription and histone acetylation. We next observed that TSA treatment increased the level of acetylated histones at the Gadd45
promoter compared with the level in non-treated cells (Figure 5B). TSA alone led to an induction of histone acetylation almost equal to the level in cells expressing BRCA1 in the absence of TSA (Figure 5B). The level of histone acetylation in cells expressing BRCA1 in the presence of TSA was higher than in cells expressing BRCA1 in the absence of TSA (Figure 5B). The level of histone acetylation in cells coexpressing BRCA1 and SUMO1 in the presence of TSA is similar to that observed in cells expressing BRCA1 alone in the presence of TSA (Figure 5B). Thus, TSA abrogated the reduction of histone acetylation by SUMO1, leading to increased histone acetylation at the Gadd45
promoter. TSA-induced histone acetylation was in good correlation with the induction of Gadd45
transcription following TSA treatment (Figure 5A and B). Together, these data provide further support for the involvement of HDACs in the repression of BRCA1-induced transcriptional activity by SUMO1.
To further investigate the sumoylation-independent repression of BRCA1-induced transcriptional activity by SUMO1 (Figures 3), we analyzed the histone acetylation status of the Gadd45
promoter following expression of SUMO1
GG (Figure 5C). Sumoylation-defective SUMO1
GG reduced the level of histone acetylation to almost equal level in cells expressing wild-type SUMO1 (Figure 5C), thereby providing further support for the observation that sumoylation is not important in the repression of BRCA1-induced transcriptional activity by SUMO1.
SUMO1 recruits HDAC1 to and releases BRCA1 from the Gadd45
promoter
As the repressive effect of SUMO1 is TSA-sensitive and inversely correlated with the level of histone acetylation at the Gadd45
promoter, we investigated the influence of SUMO1 on the recruitment of HDACs by performing chromatin immunoprecipitation (ChIP) with anti-HDAC1 and 2 in the presence or absence of SUMO1 (Figure 6A). Expression of SUMO1 induced the recruitment of HDAC1 but not 2 to the Gadd45
promoter, with or without the coexpression of BRCA1 (Figure 6A). In contrast, BRCA1 alone caused the release of HDAC1 from the Gadd45
promoter (Figure 6A). Together, these observations indicate that SUMO1 can recruit HDAC1 to the Gadd45
promoter, and consequently diminish the level of histone acetylation (Figures 5B and C). ChIP ssays were then performed to assess whether SUMO1 interferes with the association of BRCA1 with the Gadd45
promoter. Exogenously expressed BRCA1 was recruited to the Gadd45
promoter (Figure 6A and B). The addition of SUMO1 led to a reduction in the level of BRCA1 recruited to the Gadd45
promoter (Figure 6A and B). These observations indicate that SUMO1 induces the recruitment of HDAC1 to the Gadd45
promoter and the release of BRCA1 from the promoter.
|
Next, we examined whether SUMO1 affected recruitment of BARD1, which interacts with BRCA1, at the Gadd45
promoter. As shown in Figure 5A, BRCA1 expression induced recruitment of BARD1 and SUMO1 expression induced release of BARD1 at the Gadd45
promoter, similar to the BRCA1 result. Similarly, RNA polymerase II, another BRCA1-interacting protein, was recruited to the promoter following BRCA1 expression and it was released from the promoter following SUMO1 expression (Figure 6A). However, expression of BRCA1 or/and SUMO1 had no effect on recruitment of p300 at the promoter (Figure 6A). The level of p300 at the promoter was not altered in the presence of BRCA1 or/and SUMO1. These observations indicate that SUMO1 induced the release of BARD1 and RNA polymerase II but not p300 from the Gadd45
promoter.
ChIP experiments revealed the release of HDAC1 but not HDAC2 from the Gadd45
promoter in the absence of SUMO1 expression. In contrast, BRCA1, BARD1 and RNA polymerase II, but not p300, were released in the presence of SUMO1 expression. Hence, we assessed whether expression of SUMO1 might differentially affect protein interactions between BRCA1/HDAC1, BRCA1/HDAC2, and BRCA1/BARD1 and BRCA1/p300. The presence of SUMO1 expression had little effect on BRCA1 interactions with HDAC1 or HDAC2 (Supplementary Figure 3). Similarly, interactions of BRCA1/BARD1 or BRCA1/p300 were not changed by SUMO1 expression (Supplementary Figure 3).
As SUMO1
GG represses BRCA1-induced transcription (Figure 3A), we tested whether SUMO1
GG could also affect the association of HDAC1 or BRCA1 with the Gadd45
promoter. ChIP analysis showed that expression of SUMO1
GG induced the recruitment of HDAC1 to the Gadd45
promoter (Figure 6C). SUMO1
GG also induced the release of BRCA1 from the Gadd45
promoter (Figure 6C). These results suggests that the effect of SUMO1
GG on the association of HDAC1 and BRCA1 with the Gadd45
promoter is consistent with wild-type SUMO1 (Figure 6A and B) and further supports the finding that SUMO1-induced repression of BRCA1-induced transcription is not mediated by sumoylation.
Based on our results that SUMO1 induced recruitment of HDAC1 at the promoter in the sumoylation-independent manner, we tested whether HDAC1 is required for SUMO1-induced repression of BRCA1's transcriptional activity. Thus, we examined the effect of HDAC1 knockdown on the transcriptional repression by SUMO1 (Figure 6D). HDAC1 knockdown had little effects on Gadd45
transcription without regard to expression of BRCA1 (Figure 6D). By comparison to BRCA1 alone (
2.5-fold) and HDAC1 knockdown alone (
1.1-fold), HDAC1 knockdown together with expression of BRCA1 barely increased Gadd45
transcription (
2.7-fold) (Figure 6D). However, HDAC1 knockdown attenuated the suppressive effect of SUMO1 on BRCA1-induced Gadd45
activation by
45% (Figure 6D), suggesting that SUMO1 is required for HDCA1 for efficient repression of BRCA1-induced transcription.
We next analyzed status of histone acetylation at the Gadd45
promoter when the level of endogenous HDAC1 was reduced. In the presence of exogenous SUMO1, depletion of HDAC1 by silencing led to less reduction of the level of acetylated histones, compared with the reduced level of acetylated histones without depletion of HDAC1. However, HDAC1-depletion had little effect on the histone acetylation without exogenous SUMO1 proteins (Figure 6E). Thus, depletion of HDAC1 alleviated the reduction of histone acetylation by SUMO1, leading to the increased histone acetylation at the Gadd45
promoter. HDAC1 depletion-induced histone acetylation (Figure 6E) was in good correlation with the induction of Gadd45
transcription in HDAC1-depleted cells (Figure 6D). Together, these results show that HDAC1 activity functions in the repression of BRCA1-induced transcription by SUMO1, via induction of histone deacetylation at the promoter.
Silencing of SUMO1 stimulates BRCA1-mediated transcription and BRCA1–interaction with promoters
The reporter assay, RT-PCR and ChIP analysis of the Gadd45
promoter were repeated in SUMO1 knockdown cells to ascertain the physiological relevance of these findings (Figures 1–6![]()
![]()
![]()
![]()
). We first evaluated Gadd45
transcription by using the reporter construct driven by the Gadd45
promoter. As expected, Gadd45
promoter-driven transcription was upregulated by approximately 1.6-fold (in the presence of exogenous BRCA1 proteins) to 2-fold (in the absence of exogenous BRCA1 proteins), when the level of endogenous SUMO1 was reduced (Figure 7A). The induction of BRCA1-mediated transcription in SUMO1-depeleted cells (Figure 7A) was comparable to that observed in cells expressing BRCA1 SIM-mutants (Figure 4C), indicating that SUMO1 indeed plays a role in repression of BRCA1-induced transcription. In contrast, Gadd45
transcription was downregulated by
20% (in the presence of exogenous BRCA1 and SUMO1 proteins or in the cells without either exogenous expression) to 35% (in the presence of exogenously expressed BRCA1 alone), when the level of BRCA1 was reduced by deletion of endogenous BRCA1 (Figure 7A).
|
We next analyzed expression of Gadd45
transcripts in SUMO1 knockdown cells by RT-PCR (Figure 7B). In consistent with the results obtained from the Gadd45
reporter (Figure 7A), the level of Gadd45
mRNAs increased in the SUMO1-depleted cells and decreased in the BRCA1-depleted cells (Figure 7B). In the presence of exogenous BRCA1, depletion of SUMO1 by silencing led to further induction of Gadd45
mRNA, compared with the induced level of Gadd45
mRNA without exogenous BRCA1 (Figure 7B). Together with Gadd45
promoter-driven reporter results in the SUMO1-depleted cells, the Gadd45
mRNA expression results indicate that SUMO1 may function as a physiological repressor for BRCA1 transcriptional activity.
Also, depletion of endogenous SUMO1 led to induction of the recruitment of BRCA1 to the Gadd45
promoter and the release of HDAC1 (Figure 7C). This result further supports the notion that SUMO1 represses BRCA1-induced transcription from the Gadd45
promoter by modulating protein association at the promoter. Also, silencing of BRCA1 induced recruitment of SUMO1 and HDAC1 to the promoter (Figure 7D), suggesting that assembly of SUMO1 and disassembly of BRCA1 at the Gadd45
promoter is important for repression of BRCA1-induced transcription by SUMO1.
Since BRCA1 activates p27Kip1 (35) and p21WAF1/CIP1 (36) gene transcriptions, we questioned whether BRCA1-stimulated transcription of p27Kip1 or p21WAF1/CIP1 genes might be repressed by SUMO1. First, we measured levels of p27Kip1 and p21WAF1/CIP1 mRNAs following silencing of SUMO1. Similar to the Gadd45
gene transcription, depletion of endogenous SUMO1 induced mRNA levels of p27Kip1 and p21WAF1/CIP1 genes (Figure 8A), suggesting that SUMO1 can also repress transcription of p27Kip1 and p21WAF1/CIP1 genes.
|
To see whether SUMO1 can inhibit association of BRCA1 with p27Kip1 and p21WAF1/CIP1 promoters, we performed the ChIP experiment in the SUMO1-depleted cells. Silencing of SUMO1 led to induction of BRCA1 association with both p27Kip1 and p21WAF1/CIP1 promoters (Figure 8B). In contrast, silencing of SUMO1 reduced the level of HDAC1 associated with both p27Kip1 and p21WAF1/CIP1 promoters (Figure 8B). Next, we examined whether the level of promoter-associated SUMO1 and HDAC1 is induced in the BRCA1-depleted cells. Silencing of BRCA1 induced association of SUMO1 and HDAC1 with both p27Kip1 and p21WAF1/CIP1 promoters (Figure 8B). Together, results from p27Kip1 and p21WAF1/CIP1 experiments further support the molecular mechanisms by which SUMO1 can downregulate the BRCA1-activated transcriptions via inhibition of BRCA1 association with promoters.
Next, we tested whether SUMO1 can reduce the level of histone acetylation at p21WAF1/CIP1 and p27Kip1 promoters. Depletion of SUMO1 by silencing led to an induction of the level of acetylated histones at p21WAF1/CIP1 (
2.5-fold) and p27Kip1 (
3.2-fold) promoters, consistent with the Gadd45
promoter result (
4.3-fold) (Figure 8C and D). In contrast, exogenously expressed SUMO1 diminished the level of histone acetylation at both promoters (
40
45%) (Figure 8D), supporting that reduction of histone acetylation at BRCA1 target promoters plays a role in SUMO1-induced repression. Also, both SUMO1 and SUMO1
GG inhibited association of BRCA1 with both p21WAF1/CIP1 and p27Kip1 promoters (Figure 8D), suggesting that dissociation of BRCA1 from both promoters contributes to repression of BRCA1-induced transcription by SUMO1.
To see whether deletion of SUMO1 can affect expression of other genes rather than BRCA1 targets, we analyzed mRNA transcripts of ErbB2 and Cylin D1. In SUMO1-knockdown cells, transcription of ErbB2 and Cylin D1 genes was not altered (Figure 8E), suggesting that SUMO1-induced repression may not be general. In consistent with the transcription results, status of histone acetylation at the ErbB2 and Cylin D1 promoters was not changed following deletion of SUMO1 (Figure 8E), supporting that effects of SUMO1 on transcriptional repression is not general.
SUMO1 reduces binding of BRCA1 to the Gadd45
promoter
The ChIP (Figures 6–8![]()
) and coimmunoprecipitation (Supplementary Figure 3) results suggest that regulation of BRCA1-mediated transcription by SUMO1 seems to be largely dependent on modulation of protein–DNA interactions but not protein–protein interactions, for the control of promoter occupancy. Thus, we next examined whether SUMO1 affected the DNA–binding activity of BRCA1 at the Gadd45
promoter, using biotin-labeled oligonucleotides containing the BRCA1–binding region (29). When BRCA1 alone was exogenously expressed, the ability of BRCA1 to bind to the Gadd45
promoter was strengthened (Figure 9A). However, when SUMO1 and BRCA1 were expressed together, the binding ability of BRCA1 was diminished significantly (Figure 9A). In consistent with the results with exogenously expressed BRCA1 (Figure 9A), SUMO1 led to a dissociation of endogenous BRCA1 from DNA (Figure 9B). Similarly, SUMO1
GG also induced release of endogenous BRCA1 from Gadd45
promoter DNA (Figure 9B). SUMO1 also reduced DNA–binding activity of exogenous and endogenous BARD1 (Figure 9). These DNA–binding results were in good agreement with repression of Gadd45
transcription following exogenous SUMO1 expression (Figures 2–5![]()
![]()
). These observations indicate that SUMO1 can affect binding of BRCA1 to the Gadd45
promoter, resulting in reduced recruitment of BRCA1 into the Gadd45
promoter and repression of transcription of Gadd45
gene.
|
SUMO1 represses BRCA1-induced transcriptional activity stimulated by DNA damage
BRCA1-induced transcriptional activity is enhanced by DNA damaging genotoxic treatment. We investigated whether SUMO1 repressed BRCA1-induced transcriptional activity in the presence of DNA damage. Consistent with previous reports (10,27), the level of Gadd45
transcription increased (
2.5- to 3.5-fold) upon
-irradiation when compared to the level in non-treated cells in the absence or presence of BRCA1 expression (Figure 10A). Expression of BRCA1 further enhanced Gadd45
gene expression in
-irradiated cells (
2.5-fold) (Figure 10A), consistent with the induction of Gadd45
transcription in the non-treated cells (
2.5-fold) (Figures 2–5
by BRCA1 in
-irradiated cells (Figure 10A), which is consistent with the effect of SUMO1 in non-treated cells (Figures 2–5
|
ChIP assays were performed to analyze the association of BRCA1 and HDAC1 with the Gadd45
promoter in
-irradiated cells (Figure 10B). The recruitment of BRCA1 and the release of SUMO1 were stimulated significantly upon
-irradiation. Moreover, HDAC1 was released from the Gadd45
promoter following
-irradiation (Figure 10B), possibly leading to histone acetylation and induced transcription. These findings further support the observation that the release of SUMO1 from the Gadd45
promoter takes place simultaneously with the recruitment of BRCA1 to the Gadd45
promoter, and correlates with Gadd45
expression. | DISCUSSION |
|---|
|
|
|---|
In this study we describe a novel function of SUMO1 in the negative regulation of BRCA1-mediated transcription. We have provided several lines of experimental evidence to suggest that the BRCA1-induced transcriptional activity is inhibited by SUMO1 in a sumoylation-independent manner (Figure 10C). First, expression of SUMO1 led to the recruitment of HDAC1 to target promoters of BRCA1, the release of BRCA1, and the subsequent repression of transcription of the BRCA1 target genes, Gadd45
, p27KIP1 and p21WAF/CIP1. Second, silencing of SUMO1 led to transcriptional induction of the BRCA1 target genes, possibly via recruitment of BRCA1 and release of HDAC1 at the BRCA1 target promoters, thereby supporting a repressive role of SUMO1 in the control of BRCA1-induced transcription. Third, disruption of sumoylation-independent SUMO interaction motifs (SIMs) in BRCA1 alleviated interaction of BRCA1 with SUMO1 and consequently attenuated repressive effects of SUMO1 on BRCA1-mediated transcription, suggesting that noncovalent interaction between BRCA1 and SUMO1 is required for the SUMO1-induced repression. Fourth, UBC9, or the dominant-negative mutant DN UBC9, had little effect on the Gadd45
trascription. Also, dominant-negative SUMO1
GG, that is missing the SUMO1 donor site essential for sumoylation, maintained the capacity to repress BRCA1-mediated Gadd45
transcription, in a manner similar to that observed for wild-type SUMO1. This result provided support for the notion that sumoylation is not involved in the repression of BRCA1-induced transcription. In summary, these results strongly suggest that sumoylation is not closely linked to repression of BRCA1-induced transcriptional activation.
Transcriptional repression by SUMO1 is mostly mediated by the sumoylation of sequence-specific transcriptional factors, coactivators and corepressors, including STAT1, TCF, c-Jun, ARNT, CEBP
, c-myb, Sp3, IRF-1, SREBP, SRF, Elk, AP1/2, androgen receptor, progesterone receptor and Huntington (30). The majority of evidence has established the collaborative integration of sumoylation with histone deacetylation to achieve repression of transcription. The repression of BRCA1-mediated transcription by SUMO1 is different from the known mechanism of repression of transcription, as it does not involve sumoylation. Sumoylation-independent regulation by SUMO1 is observed in other cellular processes including Rad51-mediated homologous recombination (37) and the regulation of apoptosis mediated by ASK (38). In addition, sumoylation-independent regulation by other SUMO family members, SUMO2 and SUMO3, has been observed in the process activating androgen receptor-mediated transcription (39). Recently, a novel model is proposed that noncovalent SUMO interaction mediated by SUMO interaction motif (SIM) may represent a mechanism that could control many various pathways, including formation of PML nuclear body (34). These results, together with the present study, support sumoylation-independent physiological role of SUMO proteins. Despite the importance of SIMs in repression by SUMO1, SUMO1-mediated repressive activity was attenuated but remained in the presence of the double SIM BRCA1 mutant. This result suggests that there could be additional SIMs in BRCA1 (Supplementary Figure 4). Also, we cannot rule out the possibility that other transcriptional repressor(s) can bind to both SUMO1 and SIM-deleted BRCA1, and suppress partially BRCA1-mediated transcription in a BRCA1's SIM-independent way. Together, these findings provide evidence that the mechanisms controlling cellular processes regulated by SUMO1 and its paralogs, SUMO2 and 3, are diverse.
The present results suggest that HDAC1 but not 2 plays a role in the repression of BRCA1-mediated transcriptional activity by SUMO1 (Figure 10C). First, repression of BRCA1-mediated transcriptional activity by SUMO1 was TSA-sensitive. Second, SUMO1 overexpression enhanced histone deacetylation of the BRCA1 target promoters via the recruitment of HDAC1 but not 2. Conversely, the reduction of SUMO1 by siRNA led to a decrease in HDAC1 recruitment and histone deacetylation, and enhanced transcriptional activity of the BRCA1 target promoters. Third, the depletion of HDAC1 abrogated the repressive effects of SUMO1 on BRCA1-mediated transcription. The results of the present study show that HDAC recruitment and subsequent histone deacetylation are common to the mechanism of sumoylation-independent repression and sumoylation-dependent transcriptional repression by SUMO1.
Although it is unclear that sumoylated transcriptional regulatory proteins are released from, or associated with promoters, growing evidence from investigations into sumoylation-dependent transcriptional repression suggest that SUMO1 is present at the repressed promoter. In the sumoylation of transcriptional proteins, the targeting of SUMO1 to a promoter can lead to the recruitment of other factors that repress transcription, including HDACs. The results of the present study for sumoylation-independent repression of BRCA1-induced transcriptional activity are consistent with the promoter occupancy of SUMO1 and HDAC1. Importantly, the presence of SUMO1 at the BRCA1 target promoters led to the release of BRCA1 from the promoters, suggesting that SUMO1 effectively reverses the promoter occupancy of BRCA1 in addition to HDAC1. Thus, sumoylation-independent repression of BRCA1-mediated transcriptional activity would affect the promoter occupancy of BRCA1 but not necessarily the associated sumoylated transcriptional proteins. Intriguingly, SUMO1 can downregulate DNA-binding activity of BRCA1, which subsequently results in the release of BRCA1 from the promoters. Taken together, those results from BRCA1-coimmunoprecipitation assays, ChIP analysis at the BRCA1 target promoters, and BRCA1–DNA-binding experiments point to a regulatory mechanism for BRCA1-mediated transcription, promoter occupancy through modulation of protein–DNA association but not protein–protein association by SUMO1.
Depletion of endogenous SUMO1 caused enhanced BRCA1 and reduced HDAC1 presence at the BRCA1 target promoters, leading to transcriptional activation, while overexpression of SUMO1 or SUMO1
GG had the opposite effect. Moreover, the effect of SUMO1
GG was consistent with the effect of wild–type SUMO1 and both UBC9 and DN-UBC9 did not compromise the promoter occupancy and activation of transcription by BRCA1. These results further support a sumoylation-independent mechanism for the action of SUMO1 on BRCA1-mediated activation of transcription. In contrast, depletion of endogenous BRCA1 promoted the recruitment of SUMO1 and HDAC1 to the BRCA1 target promoters, and overexpression of BRCA1 induced the release of SUMO1 and HDAC1 from the promoters. Collectively, these data are consistent with a model whereby SUMO1 recruits HDAC1 to the BRCA1 target promoter and induces the release of BRCA1, in a sumoylation-independent manner. It appears that recruitment of HDAC1 and the release of the transcriptional activator, BRCA1, are necessary for sumoylation-independent repression of transcription, whereas only recruitment of HDACs is required for sumoylation-dependent repression.
Promoter ChIP results for the BRCA1 target promoters suggest the importance of stoichiometry between BRCA1 and SUMO1 for promoter occupancy and regulation of transcription. This implies that BRCA1 and SUMO1 compete for promoter occupancy. This mechanism may explain the results for the interaction between BRCA1 and SUMO1 and their differential promoter occupancy. Initially, we observed an interaction between BRCA1 and SUMO1 in yeast with no homologous BRCA1 gene. However, coimmunoprecipitation experiments showed that the interaction in mammalian cells was weak, suggesting that the encounter between these proteins was transient, possibly as the proteins interacted at the promoter site.
DNA damage reversed the repression of BRCA1-mediated activation of transcription by SUMO1. Treatment with
-irradiation led to the recruitment of BRCA1 to the Gadd45
promoter and the release of both SUMO1 and HDAC1, resulting in enhanced transcriptional activation by BRCA1. These results are consistent with the results generated from overexpression of BRCA1 or silencing SUMO1. Because DNA damage enhances the level of BRCA1, it is likely that an increased level of BRCA1 is recruited to the promoter due to DNA damage, possibly leading to the sequential release of SUMO1 and HDAC1. Taken together, these results further support a mechanism involving differential promoter occupancy and reverse transcriptional regulation by SUMO1 and BRCA1.
Our finding that BRCA1 domains with transactivational potential, possibly by association with transcriptional cofactors such as histone acetyl transferase p300/CBP, did not associate with SUMO1 or UBC9, suggest that repression of BRCA1-induced transcription by SUMO1 is not attributed to inhibition of the association with transcriptional coactivators in BRCA1. It appears that SUMO1 affects promoter occupancy by modulating the assembly and disassembly of proteins that regulate transcription and can remodel the protein context at a promoter by a sumoylation-independent mechanism that leads to repression of transcription. In addition, our data showing downregulation of BRCA1–DNA association by SUMO1 support the potential role of SUMO1 in modulation of protein complex at a promoter.
Mutations of the BRCA1 gene account for
5% of breast and ovarian cancer cases, but the importance of BRCA1 in suppression of sporadic cancers may be far greater than what the frequency of BRCA1 mutations in sporadic cancers suggests. The level of BRCA1 is low in
30% of sporadic breast cancers (40). Here, we have hypothesized that SUMO1 may serve as a negative regulator of BRCA1's tumor suppression functions in a part of the remainder sporadic breast cancers that express similar levels to normal breast tissues. To get insights into our suggestions that the negative regulator of BRCA1 is a bona fide SUMO1 activity and not an artifact of enforced expression of SUMO1, we have investigated whether SUMO1 level raises in physiological conditions in which activity of BRCA1 in tumor suppression has been compromised. We found that the level of SUMO1 protein is markedly increased in some breast, lung and ovarian cancer cell lines, compared with that in normal epithelial cells, despite comparable levels of BRCA1 protein (Supplementary Figure 5). However,
-irradiation, a DNA damage signal, had little effect on induction of SUMO1 expression, in either normal or cancer cells. Consistently, SUMO1 mRNA level is high in cancer cells (data not shown). These results suggest that the level of SUMO1 might be rising in response to unknown carcinogen-induced stress or signal and subsequently attenuates BRCA1's activity. In carcinogenesis processes, SUMO1's function in downregulation of BRCA1 activity may have implications for development of sporadic breast and ovarian cancers without direct mutations or alterations in expression of BRCA1 gene.
BRCA1 exerts tumor suppression through multiple functions. Therefore, additional studies are required to evaluate whether and how SUMO1 antagonizes BRCA1 functions in maintaining genomic integrity via DNA repair, cell cycle checkpoint and other processes, besides its role in transcription. Due to rare mutations of BRCA1 in cancers, BRCA1 may be inactivated by alternative mechanisms. Therefore, we need to address the question whether SUMO1 can achieve functional inhibition of BRCA1 compromising the diverse roles of BRCA1 in tumor suppression.
In conclusion, we have examined the molecular mechanism underlying BRCA1-mediated activation of transcription. Although it is possible that a functional interplay between the SUMO system and HDAC1 plays a role in repression of transcription, the present study describes a novel sumoylation-independent mechanism whereby SUMO1 represses BRCA1-mediated activation of transcription via modulation of promoter occupancy.
| SUPPLEMENTARY DATA |
|---|
|
|
|---|
Supplementary Data are available at NAR Online.
| ACKNOWLEDGEMENTS |
|---|
We would particularly like to thank Dr Seong-Tae Kim (Sungkyunkwan University) for help with the real-time PCR. We also thank all members of Lee's laboratory. This work is supported by Korea Research Foundation (KRF E00050). M.A.P. is supported by KOSEF (2007-01791). J.-S.L. is supported by Ajou University. Funding to pay the Open Access publication charges for this article was provided by Korea Science and Engineering Foundation and Ajou University.
Conflict of interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Welcsh PL, King MC. BRCA1 and BRCA2 and the genetics of breast and ovarian cancer. Hum. Mol. Genet. (2001) 10:705–713.
[Abstract/Free Full Text] - Venkitaraman AR. Functions of BRCA1 and BRCA2 in the biological response to DNA damage. J Cell Sci. (2001) 114:3591–3598.[Web of Science][Medline]
- Jang ER, Lee J.-S. Diverse functions of BRCA1. Cancer Res. Treat. (2004) 36:214–221.
- Zheng L, Pan H, Li S, Flesken-Nikitin A, Chen PL, Boyer TG, Lee WH. Sequence specific transcriptional corepressor function for BRCA1 through a novel zinc finger protein, ZBRK1. Mol. Cell (2000) 6:757–768.[CrossRef][Web of Science][Medline]
- Pao GM, Janknecht R, Ruffner H, Hunter T, Verma IM. CBP/p300 interact with and function as transcriptional coactivators of BRCA1. Proc. Natl Acad. Sci. USA (2000) 97:1020–1025.
[Abstract/Free Full Text] - Tan W, Zheng L, Lee WH, Boyer TG. Functional dissection of transcription factor ZBRK1 reveals zinc fingers with dual roles in DNA-binding and BRCA1-dependent transcriptional repression. J. Biol. Chem. (2004) 279:6576–6587.
[Abstract/Free Full Text] - Oishi H, Kitagawa H, Wada O, Takezawa S, Tora L, Kouzu-Fujita M, Takada I, Yano T, Yanagisawa J, Kato S. An hGCN5/TRRAP histone acetyltransferase complex co-activates BRCA1 transactivation function through histone modification. J. Biol. Chem. (2006) 281:20–26.
[Abstract/Free Full Text] - Somasundaram K, Zhang H, Zeng YX, Houvras Y, Peng Y, Zhang H, Wu GS, Licht JD, Weber BL, El-Deiry WS. Arrest of the cell cycle by the tumour-suppressor BRCA1 requires the CDK-inhibitor p21WAF1/CiP1. Nature (1997) 389:187–190.[CrossRef][Medline]
- Ouchi T, Monteiro AN, August A, Aaronson SA, Hanafusa H. BRCA1 regulates p53-dependent gene expression. Proc. Natl Acad. Sci. USA (1998) 95:2302–2306.
[Abstract/Free Full Text] - Li S, Ting NS, Zheng L, Chen PL, Ziv Y, Shiloh Y, Lee EY, Lee WH. Functional link of BRCA1 and ataxia telangiectasia gene product in DNA damage response. Nature (2000) 406:210–215.[CrossRef][Medline]
- Fan S, Yuan R, Ma YX, Xiong J, Meng Q, Erdos M, Zhao JN, Goldberg ID, Pestell RG, Rosen EM. Disruption of BRCA1 LXCXE motif alters BRCA1 functional activity and regulation of RB family but not RB protein binding. Oncogene (2001) 20:4827–4841.[CrossRef][Web of Science][Medline]
- Welcsh PL, Lee MK, Gonsalez-Hernandez RM, Black DJ, Mahadevappa K, Swisher EM, Warrington JA, King MC. BRCA1 transcriptionally regulates genes involved in breast tumorigenesis. Proc. Natl Acad. Sci. USA (2002) 99:7560–7565.
[Abstract/Free Full Text] - Yarden RI, Brody LC. BRCA1 interacts with components of the histone deacetylase complex. Proc. Natl Acad. Sci. USA (1999) 96:4983–4988.
[Abstract/Free Full Text] - Anderson SF, Schlegel BP, Nakajima T, Wolpin ES, Parvin JD. BRCA1 protein is linked to the RNA polymerase II holoenzyme complex via RNA helicase A. Nat. Genet. (1998) 19:254–256.[CrossRef][Web of Science][Medline]
- Chai YL, Cui J, Shao N, Shyam E, Reddy P, Rao VN. The second BRCT domain of BRCA1 proteins interacts with p53 and stimulates transcription from the p21WAF1/CIP1 promoter. Oncogene (1999) 18:263–268.[CrossRef][Web of Science][Medline]
- Bochar DA, Wang L, Beniya H, Kinev A, Xue Y, Lane WS, Wang W, Kashanchi F, Shiekhattar R. BRCA1 is associated with a human SWI/SNF-related complex: linking chromatin remodeling to breast cancer. Cell (2000) 102:257–265.[CrossRef][Web of Science][Medline]
- Baker KM, Wei G, Schaffner AE, Ostrowski MC. Ets-2 and components of mammalian SWI/SNF form a repressor complex that negatively regulates the BRCA1 promoter. J. Biol. Chem. (2003) 278:17876–17884.
[Abstract/Free Full Text] - Chinnadurai G. CtBP, an unconventional transcriptional corepressor in development and oncogenesis. Mol. Cell (2002) 9:213–224.[CrossRef][Web of Science][Medline]
- Shiio Y, Eisenman RN. Histone sumoylation is associated with transcriptional repression. Proc. Natl Acad. Sci. USA (2003) 100:13225–16230.
[Abstract/Free Full Text] - Yang SH, Sharrocks AD. SUMO promotes HDAC-mediated transcriptional repression. Mol Cell (2004) 13:611–617.[CrossRef][Web of Science][Medline]
- David G, Neptune MA, DePinho RA. SUMO-1 modification of histone deacetylase 1 (HDAC1) modulates its biological activities. J. Biol. Chem. (2002) 277:23658–23663.
[Abstract/Free Full Text] - Girdwood D, Bumpass D, Vaughan OA, Thain A, Anderson LA, Snowden AW, Garcia-Wilson E, Perkins ND, Hay RT. P300 transcriptional repression is mediated by SUMO modification. Mol. Cell (2003) 11:1043–1054.[CrossRef][Web of Science][Medline]
- Lin X, Sun B, Liang M, Liang YY, Gast A, Hildebrand J, Brunicardi FC, Melchior F, Feng XH. Opposed regulation of corepressor CtBP by SUMOylation and PDZ binding. Mol. Cell (2003) 11:1389–1396.[CrossRef][Web of Science][Medline]
- Rogers RS, Horvath CM, Matunis MJ. SUMO modification of STAT1 and its role in PIAS-mediated inhibition of gene activation. J. Biol. Chem. (2003) 278:30091–30097.
[Abstract/Free Full Text] - Perdomo J, Verger A, Turner J, Crossley M. Role for SUMO modification in facilitating transcriptional repression by BKLF. Mol Cell Biol. (2005) 25:1549–1559.
[Abstract/Free Full Text] - Scully R, Ganesan S, Brown M, De Caprio JA, Cannistra SA, Feunteun J, Schnitt S, Livingston DM. Location of BRCA1 in human breast and ovarian cancer cells. Science (1996) 272:123–126.[Web of Science][Medline]
- Lee J-S, Collins KM, Brown AL, Lee CH, Chung JH. hCds1-mediated phosphorylation of BRCA1 regulates the DNA damage response. Nature (2000) 404:201–204.[CrossRef][Medline]
- Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science (2002) 296:550–553.
[Abstract/Free Full Text] - Fan W, Jin S, Tong T, Zhao H, Fan F, Antinore MJ, Rajasekaran B, Wu M, Zhan Q. BRCA1 regulates GADD45 through its interactions with the OCT-1 and CAAT motifs. J. Biol. Chem. (2002) 277:8061–8067.
[Abstract/Free Full Text] - Hilgarth RS, Murphy LA, Skaggs HS, Wilkerson DC, Xing H, Sarge KD. Regulation and function of SUMO modification. J. Biol. Chem. (2004) 52:53899–53902.
- Minty A, Dumont X, Kaghad M, Caput D. Covalent modification of p73
by SUMO-1. Two-hybrid screening with p73 identifies novel SUMO-1-interacting proteins and a SUMO-1 interaction motif. J. Biol. Chem. (2000) 275:36316–36323.[Abstract/Free Full Text] - Hannich JT, Lewis A, Kroetz MB, Li S, Jeide H, Emili A, Hochstrasser M. Defining the SUMO-modified proteome by multiple approaches in Saccharomyces cerevisiae. J. Biol. Chem. (2005) 280:4102–4110.
[Abstract/Free Full Text] - Reverter D, Lima CD. Insights into E3 ligase activity revealed by a SUMO-RanGAP1-Ubc9-Nup358 complex. Nature (2005) 435:687–692.[CrossRef][Medline]
- Shen TH, Lin HK, Scaglioni PP, Yung TM, Pandolfi PP. The mechanisms of PML-nuclear body formation. Mol. Cell (2006) 24:331–339.[CrossRef][Web of Science][Medline]
- Williamson EA, Wolf I, OKelly J, Bose S, Tanosaki S, Koeffler HP. BRCA1 and FOXA1proteins coregulate the expression of the cell cycle-dependent kinase inhibitor p27Kip1. Oncogene (2006) 25:1391–1399.[CrossRef][Web of Science][Medline]
- Miosan A, Gaudreau L. The BRCA1 COOH-terminal region acts as an RNA polymerase II carboxyl-terminal kinase inhibitor that modulates p21WAF1/CIP1 expression. J. Biol. Chem. (2006) 281:21119–21130.
[Abstract/Free Full Text] - Li W, Hesabi B, Babbo A, Pacione C, Liu J, Chen DJ, Nickoloff JA, Shen Z. Regulation of double-strand break-induced mammalian homologous recombination by UBL1, a RAD51-interacting protein. Nucleic Acids Res. (2000) 28:1145–1153.
[Abstract/Free Full Text] - Lee YS, Jang MS, Lee J.-S, Kim E. SUMO-1 represses apoptosis signal-regulating kinase 1 activation through physical interaction and not through covalent modification. EMBO Rep. (2005) 6:949–955.[CrossRef][Web of Science][Medline]
- Zheng Z, Cai C, Omwancha C, Chen SY, Baslan T, Shemshedini L. SUMO-3 enhances androgen receptor transcriptional activity through a sumoylation-independent mechanism in prostate cancer cells. J. Biol. Chem. (2006) 281:4002–4012.
[Abstract/Free Full Text] - Thompson ME, Jensen RA, Obermiller PS, Page DL, Holt JT. Decreased expression of BRCA1 accelerates growth and is often present during sporadic breast cancer progression. Nat. Genet. (1995) 9:444–450.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












