Nucleic Acids Research Advance Access originally published online on September 12, 2008
Nucleic Acids Research 2008 36(18):5845-5854; doi:10.1093/nar/gkn554
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nucleic Acids Research, 2008, Vol. 36, No. 18 5845-5854
© 2008 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Molecular Biology |
A single amino acid substitution in ORF1 dramatically decreases L1 retrotransposition and provides insight into nucleic acid chaperone activity
1Department of Cell and Developmental Biology and Program in Molecular Biology, 2Human Medical Genetics Program, University of Colorado School of Medicine, Aurora, CO 80045, 3Department of Physics and 4Center for Interdisciplinary Research on Complex Systems, Northeastern University, 111 Dana Research Center, Boston, MA 02115, USA
*To whom correspondence should be addressed. Tel: +1 303 724 3467; Fax: +1 303 724 3420; Email: sandy.martin{at}ucdenver.edu Correspondence may also be addressed to Mark C. Williams. Tel: +1 617 373 7323; Fax: +1 617 373 2943; Email: mark{at}neu.edu
Received June 23, 2008. Revised July 30, 2008. Accepted August 14, 2008.
| ABSTRACT |
|---|
|
|
|---|
L1 is a ubiquitous interspersed repeated sequence in mammals that achieved its high copy number by autonomous retrotransposition. Individual L1 elements within a genome differ in sequence and retrotransposition activity. Retrotransposition requires two L1-encoded proteins, ORF1p and ORF2p. Chimeric elements were used to map a 15-fold difference in retrotransposition efficiency between two L1 variants from the mouse genome, TFC and TFspa, to a single amino acid substitution in ORF1p, D159H. The steady-state levels of L1 RNA and protein do not differ significantly between these two elements, yet new insertions are detected earlier and at higher frequency in TFC, indicating that it converts expressed L1 intermediates more effectively into new insertions. The two ORF1 proteins were purified and their nucleic acid binding and chaperone activities were examined in vitro. Although the RNA and DNA oligonucleotide binding affinities of these two ORF1 proteins were largely indistinguishable, D159 was significantly more effective as a nucleic acid chaperone than H159. These findings support a requirement for ORF1p nucleic acid chaperone activity at a late step during L1 retrotransposition, extend the region of ORF1p that is known to be critical for its functional interactions with nucleic acids, and enhance understanding of nucleic acid chaperone activity.
| INTRODUCTION |
|---|
|
|
|---|
L1 is an autonomous mammalian retrotransposon that has successfully amplified to comprise 17 and 19% of the human and mouse genomes, respectively. Most of the >600 000 copies of mouse L1 are inactive due to truncations and/or point mutations, but 3000 are estimated to be functional for further transposition (1,2). Full-length, active copies of L1 are 7 kb in length and encode two proteins necessary for retrotransposition. The ORF1 protein (ORF1p) acts as an RNA-binding protein and nucleic acid chaperone protein in vitro (3). The RNA-binding activity of ORF1p is necessary but not sufficient for retrotransposition (4,5), and retrotransposition efficiency depends upon nucleic acid chaperone efficacy (4). The ORF 2 protein (ORF2p) has three essential domains; two of these provide the endonuclease (EN; 6) and reverse transcriptase activities (7) required for the target-primed reverse transcription reaction (TPRT, 8) that characterizes the replication mechanism of L1 and other non-LTR retrotransposons.
Retrotransposition rates vary widely among different copies of L1. The evolution of L1 is episodic, typically characterized by one or a few distinct subtypes of L1 that dominate the dispersal process within a species and then become extinct (9). In mice, there are three subfamilies represented among the 3000 active copies of L1. These subfamilies, TF, A and GF, are distinguished by their distinct 5'-end sequences. Within each subfamily, individual members vary in their retrotransposition activity as much as several 100-fold, as measured by an antisense-intron (AI) reporter gene assay in cultured cells (1,2). Individual elements from the currently active subfamily of human L1 similarly exhibit different activities in the cultured cell assay. A total of 40 of 82 full-length human L1 sequences in the human genome database that contain intact ORFs were able to retrotranspose when tested in cultured cells. These active elements varied widely in their retrotransposon rates, however, with most of the total retrotransposition activity of the group (84%) being attributable to just six individual elements. Significantly, of these six elements, the one with the greatest activity had an amino acid sequence most similar to the subfamily consensus (10).
A mouse L1 element on the X chromosome, TFC, has a sequence most like the consensus of the TF subfamily and was found to retrotranspose 15 times more efficiently than another element of the same subfamily, TFspa (4). TFspa recently inserted into the beta-glycine receptor gene, hence it is a known active mouse L1 (11). A total of 20 nt substitutions, including three that cause amino acid replacements, distinguish the two elements. The goal of this study was to define the substitution responsible for this dramatic effect on L1 retrotransposition and determine its mechanism of action. The significant substitution mapped to one of the altered amino acids in ORF1 far N-terminal to the previously described nucleic acid interaction domain of the ORF1 protein (12–14). The substitution affects a late step in retrotransposition and significantly alters the nucleic acid chaperone activity of the ORF1 protein in vitro. The results of this work strengthen the hypothesis that the nucleic acid chaperone activity of ORF1p is required for TPRT during L1 retrotransposition (4,15), as well as increase our understanding of the mechanism of action of nucleic acid chaperone proteins.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Constructs
TFC and TFspa constructs for the autonomous retrotransposition assay were described previously (4). Chimeric constructs that place either the two ORF1 replacement substitutions or the single ORF2 replacement substitution of TFspa into the backbone of TFC were made by moving either the NheI-BstWI or the BstWI-SspI fragments, respectively, from TFspa into the homologous sites of TFC (Figure 1B). The single point mutations to reciprocally alter the two ORF1 amino acids that differ between TFC and TFspa were made by site-directed mutagenesis in either a TFC or a TFspa subclone. The NheI-BstWI fragment containing the mutation was then used to replace the homologous fragment of the intact L1 in the retrotransposition assay vector after verification that the desired point mutation was the only change by DNA sequencing.
|
Cell culture and autonomous retrotransposition
Retrotransposition assays were done in 143B cells as described previously (4), using either G418 resistance or expression of eGFP as the marker of retrotransposition events. Briefly, these reporter cassettes measure retrotransposition because expression of the marker requires excision of an AI in the L1 transcript, then conversion to cDNA and insertion into the genome by TPRT before the reporter can be transcribed into an mRNA that encodes functional protein, i.e. before either growth on medium containing G418 or detection of green fluorescence, is possible. Cells were transfected the day after seeding using Lipofectamine2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's recommendations. Transformants were selected for 24 h in10 µg/ml puromycin beginning 24 h after transfection. For experiments involving the eGFP marker, fluorescence was followed daily by microscopy and quantified by flow cytometry 6 days post-transfection as described (4). For experiments involving the neo marker, cells were transfected as for eGFP, except that cells were allowed to recover for 1 day after puromycin treatment, then placed in G418 (400 µg/ml) and allowed to grow for 10 additional days before fixing and staining with crystal violet. Transfections were identical for immunoflorescence assays except they were done using cells plated on polylysine-coated coverslips.
Immunofluorescence microscopy of L1 ORF1p
L1-transfected 143B cells were rinsed with phosphate buffered saline (PBS) and then fixed for 20 min in 4% paraformaldehyde at various times post-transfection. The fixed cells were rinsed in PBS, then blocked and permeabilized for 2 h in PBS containing 3% BSA and 0.1% Triton X-100 (block). The coverslips were incubated overnight at 4°C with rabbit polyclonal anti-ORF1p antibody (3.4 µg/ml) in block and then rinsed three times in block. Cells were then incubated with 1:500 Cy-5 conjugated goat anti-rabbit antibody (Jackson ImmunoResearch, West Grove, PA, USA) for 1 h at 4°C, rinsed three times in block and mounted on slides with Fluoromount G (Southern Biotech, Birmingham, AL, USA). Fluorescence was imaged and captured using a Zeiss LSM510.
RNA, DNA and protein analyses from transfected cells
Timepoints were taken from L1-transfected 143B cells by harvesting cells every 24 h post-transfection. Cells were recovered with trypsin, washed in PBS and stored frozen as cell pellets at –80°C. Pellets were resuspended in five volumes of PLB (140 mM NaCl, 200 mM Tris–HCl, pH 8.5, 2 mM MgCl2) to which a 1/20 volume of 5% NP40 was added. After gentle mixing followed by 5 min on ice, the lysate was centrifuged 10 min at 2000g. The supernatant was recovered for RNA and protein analysis and the pellet was used for DNA analysis. About 10 µg/ml protease inhibitors (P8340 Protease Inhibitor Cocktail, Sigma-Aldrich, St. Louis, MO, USA) were added to aliquots collected for western blot analysis.
Retrotransposition events were detected at the DNA level by PCR amplification of the spliced reporter gene. About 200 ng of total DNA from various days post-transfection were amplified for 20 cycles with primers A7 (5'-CGTCCATGCCGAGAGTGATCCC) and A8 (5'-GCTACGT CCAGGAGCGCACCATC), followed by 35 cycles with primers A16 (5'-GCTACGTCCAGGA GCGCACCATC and A8.
ORF1p was detected by western blotting using 20 µg of transfected cell lysate (Bradford Assay, Bio-Rad, Hercules, CA, USA) and affinity purified, rabbit anti-ORF1p antibody (16) with the HRP-conjugated goat anti-rabbit antibody Plus Western Blotting Reagent Pack (GE Healthcare, Pittsburg, PA, USA). Images were captured on a Typhoon 9400 (GE Healthcare). Anti-actin antibody (sc-8432) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and used as recommended by the manufacturer to detect actin on the same blots.
L1 RNA was detected and quantified using RT–PCR. Two microgram of RNA isolated from PLB supernatants using TRIzol LS (Invitrogen) were treated with RQ1-DNase (Promega, Madison, WI, USA) according to the manufacturer's instructions. One microgram of the DNase-treated RNA was added to 20 µl reverse transcriptase reactions as recommended by the manufacturer (Reverse Transcription System, Promega). Reactions were diluted to 100 µl in nuclease-free water and 10 µl were used in 25 µl PCR reactions with primers that amplify a 265 nt region of ORF2 (172 nt downstream of the AUG) in L1 from both TFC and TFspa. The oligonucleotides were 5'-GACACTACCTCAGAATCAAAGGCTGG (forward primer) and 5'-GTGAGGCGCAATGTGTGCTTTGAGC (reverse primer). It was empirically determined that 23 or 25, cycles remained within the linear range of the assay, on days 1–3 or 4–6, respectively. PCR products were separated by electrophoresis through 2% agarose gels, and then stained with ethidum bromide. Fluorescence images were captured on the Typhoon 9400 and analysed using ImageQuant (GE Healthcare).
Assays using purified proteins
D159 (TFC) and H159 (TFspa) ORF1 proteins were purified to apparent homogeneity after expression in baculovirus-infected insect cells as described (4). Briefly, insect cells were lysed 48 h post-infection and the His-tagged ORF1 proteins were purified using affinity (Ni-NTA agarose, Qiagen, Valencia, CA, USA) chromatography followed by size-exclusion (Sephacryl S300, GE Healthcare) chromatography. RNA binding, strand exchange and melting temperature (Tm) assays were done as described previously (4,15,17).
DNA stretching experiments were performed using a dual beam optical tweezers instrument, described previously (18). Single bacteriophage
DNA molecules (Roche Applied Science, Indianapolis, IN, USA) were labelled on the 5'-ends with biotin and captured between two 5 µm diameter streptavidin-coated polystyrene spheres (Bangs Labs, Fishers, IN, USA). After capturing a single DNA molecule between two spheres, other spheres and DNA were rinsed out of the optical tweezers trapping chamber, and the solution surrounding the single DNA molecule was exchanged with a solution containing a fixed protein concentration. After the volume was completely exchanged, the flow was stopped and the DNA was stretched in 100 nm steps at
1 step/s, and then relaxed back to the original extension at the same rate. The resulting force versus extension was then analysed to determine the amount of hysteresis between stretching and relaxation, the observed aggregation of dsDNA and ssDNA in the presence of protein, and the helix–coil transition width for a given set of solution conditions. All experiments were performed in 10 mM HEPES, 100 mM Na+ solution. To quantify the effects of these proteins on the DNA helix–coil transition, we calculated the transition width as a function of protein concentration, as described previously (4). The results were fit to the McGhee–von Hippel binding isotherm:
|
| (1) |
is the fractional change in transition width, K is the equilibrium association constant for protein binding to DNA and n is the binding site size. For simplicity we set n = 1 so that the equilibrium constant is the only fitting parameter. Kinetic experiments on oligonucleotides were performed on an upgraded Biacore 3000 instrument at 25°C. The 5'-biotinylated AAAAAGTACACAGTCTAACATCAACTCGC was annealed to either 5'-GCGAGTTGATGTTAGACTGTGTACTTTTT to make a perfectly matched, dsDNA duplex or to 5'-GCGAGTTGACGTCAGACCGTGCACTTTTT to make the mismatched dsDNA duplex. Biotinylated oligonucleotide was captured on a CM4 chip first derivitized with NeutrAvidin biotin-binding protein (Pierce, Rockford, IL, USA) via amine coupling. dsDNA constructs (perfectly matched and mismatched) were hybridized on the chip in running buffer (50 mM phosphate buffer, 250 mM NaCl, 0.1 mM EDTA, pH 7.6). The instrument was programmed for iterative cycles in which each kinetic cycle consisted of: (i) 300 s protein injection phase, (ii) 300 s or greater dissociation phase depending on affinity and (iii) a 120 s regeneration phase. A flow rate of 20 µl/min was maintained throughout the cycle. The concentration of proteins analysed ranged from 10 to 300 nM. The surface plasmon resonance (SPR) signal was recorded in real time every 0.5 s. Each sensorgram obtained was corrected for bulk refractive index changes by subtracting the corresponding protein injection cycle on a blank NeutrAvidin surface. The association and dissociation rate constants (kon and koff, respectively) for the interaction were calculated by globally fitting the data using different kinetic models available in the BIA evaluation software package with a simple 1:1 bimolecular Langmuir interaction model.
| RESULTS |
|---|
|
|
|---|
TFC, a mouse L1 element with the sequence of the TF subfamily consensus, retrotransposes 15-fold more frequently than TFspa in an autonomous retrotransposition assay (4). The 20 nt substitutions that distinguish these two elements are represented schematically in Figure 1A. Ten of these are in the monomers, which potentially could impact transcription and hence retrotransposition in vivo. However, the monomers are not present in the constructs used for the autonomous assay, rather the CMV promoter is used to drive transcription of both TFspa and TFC; thus, those 10 substitutions cannot account for the difference observed between the two elements using this assay. Just three of the remaining 10 nt substitutions cause amino acid replacements: two in ORF1 and one in ORF2. In addition, there are three single nucleotide substitutions in ORF2 that are silent at the amino acid level, another in the 5' non-coding region and three in the 3' non-coding region.
The ORF2 replacement altered a conserved EN domain in ORF2p (6), whereas the two ORF1 replacements both lie in a relatively non-conserved coiled-coil forming region of ORF1p (13,19). All three of the replacement substitutions were rare among the 539 aligned sequences (4) that were used to derive the consensus. In ORF1, D53G was present in just five of the sequences including TFspa, D53N occurred once and D159H was present only in TFspa. In ORF2, F224L also appeared only once in TFspa, but two of the sequences had F224Y and two others had F224C. Chimeric L1 constructs were made to test the importance of the ORF2 versus the two ORF1 substitutions in the retrotransposition assay by replacing either of two restriction fragments of TFC with the homologous fragments from TFspa; these two chimeric elements are both comprised of largely TFC, but introduce either the single amino acid replacement (together with one nearby silent substitution) of ORF2, or the two amino acids of ORF1 from TFspa into the TFC backbone. The elevated retrotransposition activity of TFC unambiguously mapped to the fragment containing the two replacements in ORF1, rather than to the fragment which altered ORF2 (Figure 1B). To determine whether one or both amino acid replacements in ORF1 were important for the enhanced activity of TFC and the diminished activity of TFspa, as well as to eliminate the possibility that one of the silent substitutions elsewhere was critical, the two ORF1 amino acid replacements of TFC were individually introduced into TFspa and the two replacements of TFspa were likewise introduced into TFC. Subsequent retrotransposition assays with these altered elements identified the aspartic acid at position 159 (D159) in ORF1p as the crucial amino acid responsible for most, if not all, of the 15-fold increase in retrotransposition activity exhibited by TFC (Figure 1C).
The kinetics of retrotransposition, as well as the expression of L1 RNA and ORF1p were examined in cells transfected with L1 TFC or TFspa marked with the eGFP AI reporter. Transfected cells were examined daily for the presence of green cells, which indicate retrotransposition of L1 from the transfected plasmid into genomic DNA (20). Cells transfected with TFC expressed eGFP at higher frequency throughout the timecourse compared with those transfected with TFspa; green cells were also initially apparent on day 3 post-transfection with TFC, versus day 4 with TFspa (Figure 2A and B). Interestingly, simultaneous detection of ORF1p by immunofluorescence suggests that ORF1p accumulates similarly when expressed from the two elements (Figure 2A) because there is no evidence for a lag in expression in cells transfected with TFspa compared with TFC, nor does there appear to be any difference in either the intensity or the subcellular localization of ORF1p over the timecourse examined (data not shown, but see also Figure 3). With both TFC and TFspa, retrotransposition leading to eGFP expression occurred in a minor fraction of the ORF1p expressing cells.
|
|
The results of the imaging studies were corroborated and extended using biochemical techniques. The finding that transposition occurred earlier in cells expressing TFC than TFspa was confirmed by PCR amplification of genomic DNA using a strategy that allowed simultaneous detection of the transfected eGFP DNA (intron present) and the retrotransposed copy (intron absent, Figure 2C). The spliced eGFP gene, indicative of successful retrotransposition, appeared earlier in genomic DNA after transfection and accumulated to higher levels in TFC-transfected cells compared with those transfected with TFspa, as expected based upon the results obtained by following the appearance of green cells. Consistent with the intensity and distribution of ORF1p observed by indirect immunofluorescence, the steady-state levels of ORF1p detected by western blotting did not differ between the two elements over the timecourse examined (Figure 3). Likewise, there were no significant differences in the steady-state level of L1 RNA detected by semi-quantitative RT–PCR between TFC and TFspa (Figure 4).
|
ORF1p is an RNA-binding protein that forms large complexes with L1 RNA (5,12,16,17,21). It is also a nucleic acid chaperone; mutations that compromise chaperone activity block or diminish retrotransposition (4). In order to examine these activities of ORF1p, we isolated the D159 (TFC) and H159 (TFspa) variant forms of ORF1p from baculovirus-infected insect cells. The two proteins behaved identically throughout protein purification (data not shown), eluting from size-exclusion chromatography in the identical fraction characteristic of the elongated trimer form of the protein as described previously for the TFspa, H159 variant (19). The ellipticity and Tm of these two purified proteins were also equivalent as determined by circular dichroism (–26 000 and –26 800 and 51 and 49.5°C, for H159 and D159, respectively).
The affinity of both proteins for RNA was measured using a nitrocellulose filter-binding assay. In a side-by-side comparison containing increasing concentrations of D159 or H159 ORF1p and 25 pM of an antisense 111 nt L1 RNA in 250 mM NaCl, the apparent Kd of D159 for RNA was 8.9 ± 1.0 nM and H159 was 7.0 ± 0.6 nM, respectively (data not shown). This 20% change is not significant based upon multiple experiments and is unlikely to explain the 15-fold decrease in L1 retrotransposition associated with D159H because a 38% drop in apparent affinity for RNA by the ORF1p mutant, R298K, decreases retrotransposition by just 56% (4).
The nucleic acid chaperone activity of ORF1p can be assessed by determining the Tm of a mismatched dsDNA oligonucleotide in the presence of protein (4). About 30 nM H159 ORF1p shifts the Tm of a 29 nt DS DNA oligonucleotide with four non-contiguous mismatches from 42°C to 22°C. At the same concentration of protein, D159 ORF1p has a significantly different effect, with only a small fraction of the mismatched double-stranded oligonucleotide being converted to single-stranded form (Figure 5A). This effect occurs over a broad concentration range of protein (compare B and C in Figure 5), and suggests that H159 ORF1p interacts more strongly with single-stranded DNA than D159 ORF1p as the duplex transiently or fully melts.
|
This difference in the interaction of ORF1p with a mismatched DNA oligonucleotide was explored in more detail using SPR. The interactions of both ORF1p proteins with ssDNA and with dsDNA containing either perfect or imperfect heteroduplex were examined for comparison. The interactions of the two proteins with the ssDNA oligonucleotide, as well as with the perfectly matched dsDNA oligonucleotide were similar. In contrast, a relatively large difference was observed between these two proteins in their interaction with the imperfect double-strand duplex of the same length; D159 ORF1p displays rapid kinetics of association and dissociation with the mismatched duplex whereas H159 ORF1p dissociates 10 times more slowly (Table 1).
|
Single-molecule analysis of DNA stretching is a sensitive assay for nucleic acid chaperone activity (see 18, and references therein). Typical DNA stretching experiments in the absence of protein and in the presence of 15 nM D159 or H159 ORF1p are shown in Figure 6A. The stretching curves (solid lines) for DNA in the presence of both proteins show significant changes in the shape of the helix–coil transition. In the absence of protein, at a force of about 60 pN, the DNA stretching force increases very little as the DNA extension is increased by a factor of about 1.7. This plateau represents a cooperative DNA helix–coil transition, and the length at which the force begins to increase dramatically at the end of the transition (indicated by an arrow) demonstrates almost complete conversion of the DNA from double- to single-stranded form. The width of the transition, which is smaller for a more cooperative transition, is only about 4 pN in the absence of protein. In contrast, the transition width (or the force change from the beginning to the end of the plateau) is much higher in the presence of both proteins, but D159 ORF1p shows a much greater increase in the transition width relative to that observed for H159 ORF1p at this protein concentration. Finally, both proteins induce a change in the extension at which the ssDNA stretching force increases at the end of the transition, shown by the arrows. This change in ssDNA extension represents ssDNA aggregation, in which protein-induced effects make ssDNA attracted to itself, thus effectively decreasing the ssDNA length at a given force. The magnitude of the ssDNA aggregation is clearly much greater in the case of H159 ORF1p. To quantify the effects of these proteins on the DNA helix–coil transition, we calculated the transition width as a function of protein concentration, as described previously (4). The results are shown as data points in Figure 6B, along with lines that represent fits to the McGhee–von Hippel binding isotherm (Methods section). A saturated transition width of 27.5 ± 1.2 pN and an equilibrium association constant of 0.78 ± 0.08 x 108M–1 (KD = 1.28 ± 0.13 x 10–8M) was calculated from the fit to the data obtained using D159 ORF1p, compared with a saturated transition width of 19.2 ± 0.8 pN and an equilibrium association constant of 2.1 ± 0.2 x 108M–1 (KD = 0.48 ± 0.05 x 10–8M) from the data obtained in the presence of H159 ORF1p. These equilibrium binding constants for ssDNA determined from DNA stretching experiments agree well with those presented in Table 1 from bulk measurements.
|
| DISCUSSION |
|---|
|
|
|---|
The human and mouse genomes contain hundreds or thousands of intact and therefore potentially retrotransposition-competent L1s, respectively. The activities of individual L1 elements vary widely when tested in a cultured cell assay (1,2,10). Analogous variations in retrotransposition activity are also detected on an evolutionary timescale through phylogenetic analysis of genomic sequences (22–24); thus this property of individual variation in the ability to produce progeny is likely intrinsic to L1 and not an artifact of the cultured cell assay. TFspa, the first active mouse L1 described, was isolated because it had retrotransposed into the glycine receptor beta subunit and disrupted the expression of this critical neurotransmitter receptor gene (11,25). TFC, on the other hand, was predicted to be an active element based upon its near identity to the consensus sequence of all of the TF elements in the mouse genome that are closely related to TFspa (4). Although both elements are active, TFC retrotransposes 15-fold more effectively than TFspa in the assay used here. The goal of this investigation was to determine the molecular basis for this difference in order to gain insight into the mechanism and control of L1 retrotransposition.
The increased activity of TFC was mapped to aspartate 159 in ORF1p (Figure 1), which affects a step that follows the accumulation of L1 intermediates (RNA and ORF1p) but precedes the successful insertion of a new cDNA copy of L1 into genomic DNA (Figures 2–4![]()
). Thus, the L1 expression products, RNA and ORF1p, are more effectively converted to new insertion events in TFC compared with TFspa. RNA binding and nucleic acid chaperone activities are the only two essential retrotransposition functions presently attributable to ORF1p (4,5). This study revealed that H159 ORF1p has a diminished nucleic acid chaperone activity compared with D159 ORF1p (Figures 5 and 6), although its affinities for RNA, a short ssDNA oligonucleotide, a perfectly base paired short dsDNA oligonucleotide and a long dsDNA were not affected (data not shown, Table 1, Figure 6). R297K and RR297:298KK substitutions in ORF1p disrupt nucleic acid chaperone activity without affecting RNA binding, but RR297:298AA causes a significant drop in RNA affinity and also destroys nucleic acid chaperone activity (4). Hence, no mutations in ORF1p are known to significantly reduce RNA binding without disrupting nucleic acid chaperone activity; such mutations would be useful for understanding the relationship between the RNA binding and nucleic acid chaperone activities of ORF1p.
The location of the amino acid substitution responsible for the improved nucleic acid chaperone function of ORF1p and the elevated retrotransposition activity of TFC was surprising based upon our understanding of the structure and function of L1 ORF1p prior to this work. Primary sequence analysis had revealed two domains in ORF1p: (i) an N-terminal, coiled-coil domain which is highly divergent and perhaps not homologous among mammalian L1s and (ii) a C-terminal conserved domain that is shared among all mammalian L1s and some non-LTR retrotransposons in fish (3, and references therein). Results of several studies indicate that the coiled-coil region is necessary and sufficient for the formation of highly stable ORF1p homotrimers, and the basic region of the conserved domain is likewise both necessary and sufficient for high-affinity interactions between ORF1p and RNA (12,14,19). The crucial residue for high retrotransposition activity identified here, D159, lies within the coiled-coil domain, but near its C-terminus (13); this is the first report of residues that are critical for functional protein–nucleic acid interactions in this region of ORF1p. Based upon the transfer of 32P from RNA to protein, a polypeptide with residues 244–371 of ORF1p binds RNA, but one with residues 1–251 does not (14). In addition, four consecutive alanine substitutions for REGK beginning at residue 235 in ORF1p from human L1 (homologous to 271 in mouse ORF1p) alter interaction of ORF1p with RNA (5). Thus, D159 in mouse L1 ORF1 is at least 85 amino acids N-terminal to the closest residue previously shown to be involved in nucleic acid interactions. Although it is possible that these regions are adjacent to one another in the presently unknown 3D structure of ORF1p, our data strongly suggest the presence of a heretofore unrecognized site on the protein for nucleic acid interactions.
The binding constant calculated from DNA stretching was similar for D159 and H159 ORF1 proteins, in agreement with the SPR analysis results shown in Table 1. In addition, the amount of hysteresis observed between the stretching and relaxation curves is also similar for these two variants. There are two primary differences between the DNA stretching results for D159 ORF1p and those obtained for H159 ORF1p. First, the amount of ssDNA aggregation is much greater for H159 relative to that observed in the presence of D159. Second, the maximum helix–coil transition width as predicted from fits to the binding titrations is greater for D159 ORF1p by about 40%. An increase in helix–coil transition width is positively correlated with nucleic acid chaperone activity (26–28), however, this increase in transition width with protein binding involves the combination of several effects related to chaperone activity that are not easily separated (29).
Recent studies demonstrated that the primary determinants of efficient nucleic acid chaperone activity are the capability to induce nucleic acid attraction, the ability to partially but not completely destabilize the DNA helix, and the ability to rapidly switch between ssDNA- and dsDNA-binding modes (30,31). Therefore, the chaperone activity of a specific protein is the result of a balance between competing effects. For example, the ability to induce DNA attraction, or aggregation of DNA, facilitates nucleic acid rearrangements by bringing complementary strands together. Conversely, this property also tends to stabilize the DNA helix and inhibit the mobility of the DNA–protein complex, thereby inhibiting rearrangements of nucleic acid secondary structure. HIV-1 nucleocapsid protein (NC) is a well-studied example of a protein that has optimized these various competing effects (31). Subtle changes in the architecture of the zinc fingers in NC destroy this delicate balance, resulting in an inefficient nucleic acid chaperone that is defective in retroviral replication (30).
The two ORF1p proteins studied here exhibit all of the characteristics of a nucleic acid chaperone, but to subtly different extents. They both aggregate DNA, bind preferentially to ssDNA and therefore stabilize the DNA helix, and do not strongly inhibit annealing of long DNA strands. These general nucleic acid chaperone characteristics were previously demonstrated using DNA stretching measurements for the TFspa ORF1p (4), and are also apparent in the results of DNA stretching experiments with TFC ORF1p (Figure 6A). More subtle features of the stretching experiments distinguish the two ORF1 proteins, however; the results show significantly lower aggregation for the TFC ORF1p, suggesting that DNA complexes with this protein will have increased mobility and therefore increased nucleic acid chaperone activity. The hypothesis that lower aggregation of ssDNA results in increased mobility of protein–DNA complexes is supported by the SPR results, which provide evidence of more rapid binding kinetics for the TFC ORF1p with a mismatched dsDNA oligonucleotide compared with the ORF1p from TFspa. It is also consistent with much stronger effect in melting the mismatched dsDNA oligonucleotide in the gel-based Tm experiments. Thus, the biophysical data presented here are fully consistent with the observed stronger nucleic acid chaperone capabilities of D159 compared with H159 ORF1p.
The results of earlier studies established that mutations in the C-terminus of TFspa ORF1p greatly inhibited nucleic acid chaperone activity, which in turn abolished L1 retrotransposition (4). There, the primary effect of the mutations on DNA stretching was to induce such strong ssDNA and dsDNA aggregation that the DNA could not be melted by force. Those earlier results illustrated that aggregation that is too strong inhibits chaperone activity. This hypothesis is supported by other studies in which similar ssDNA aggregation effects were observed for DNA stretching in the presence of HIV-1 Gag, a nucleic acid packaging protein (29), as well as in the presence of HIV-1 NC variants that were identified as poor nucleic acid chaperones (30). Increased DNA aggregation that results in decreased chaperone activity could be due directly to changes in a DNA-binding region of the protein, as is likely the case with mutations in the zinc finger regions of HIV-1 NC (30). It is possible that a tighter interaction with nucleic acids by H159 is a simple reflection of the more basic nature of histidine than glutamate. If D159H does directly alter a DNA binding site in ORF1p, it is not likely to be the previously known site because interactions of ORF1p with nucleic acids have consistently mapped to the distant C-terminal third of the protein (5,12–14). The known, C-terminal binding site is apparently unaltered by the D159H substitution, based upon the indistinguishable affinities of D159 and H159 ORF1p for RNA and ssDNA.
Alternatively, increased DNA aggregation that inhibits chaperone activity could also occur with amino acid substitutions that increase or alter homotypic protein–protein interactions, as is likely the explanation for the increased aggregation that was observed for HIV-1 Gag and the Gag cleavage product NCp9. For these two proteins, the DNA binding site remained intact, yet aggregation was increased and nucleic acid chaperone activity decreased compared with NCp7 (29). Given the location of D159H in the coiled-coil domain (13) where it is likely exposed to solvent, it is plausible that this residue could be involved in further protein–protein interactions between trimers. The differences observed between D159 and H159 in the assays involving short oligonucleotides are not easily explained by such protein–protein interactions, however, because each trimer occupies 50 nt (12). Hence, the 29 nt oligos used for Tm and SPR studies would only bind a single ORF1p trimer and would not be expected to interact with more than one trimer at a time.
A full understanding of the interactions of ORF1p with single and double-stranded nucleic acids, and the relationship between its high-affinity RNA-binding function and the nucleic acid chaperone function necessarily awaits a high resolution structure of the protein with and without its various nucleic acid ligands. Nevertheless, the results presented here illustrate the importance of maintaining a delicate balance between strong DNA binding and DNA–protein complex mobility for efficient nucleic acid chaperone activity. This work also lends further support to the conclusion that the nucleic acid chaperone activity of ORF1p plays an essential role during L1 retrotransposition; this role likely occurs late in the process, consistent with a function in facilitating the strand exchanges that are required to initiate TPRT or melting secondary structure in the RNA template for reverse transcription (15).
| FUNDING |
|---|
|
|
|---|
National Institutes of Health (GM40367 to S.L.M., GM 72462 to M.C.W. and NCI P30 CA046934 [GenBank] Cores for Tissue Culture and Monoclonal Antibody, and DNA Sequencing and Analysis, U Colorado); National Science Foundation (MCB-0744456 to M.C.W.). Funding for open access charge: NIH GM40367.
Conflict of interest statement. None declared.
| ACKNOWLEDGEMENTS |
|---|
We would like to thank Drs J. Hooper for help with fluorescence microscopy and S. Kwok and R. Hodges of the UC Denver Biophysics Core for help with CD and Biacore experiments and data interpretation.
| REFERENCES |
|---|
|
|
|---|
- DeBerardinis RJ, Goodier JL, Ostertag EM, Kazazian H.H. Jr. Rapid amplification of a retrotransposon subfamily is evolving the mouse genome. Nat. Genet. (1998) 20:288–290.[CrossRef][Web of Science][Medline]
- Goodier JL, Ostertag EM, Du K, Kazazian HHJ. A novel active L1 retrotransposon subfamily in the mouse. Genome Res. (2001) 11:1677–1685.
[Abstract/Free Full Text] - Martin SL. The ORF1 protein encoded by LINE-1: structure and function during L1 retrotransposition. J. Biomed. Biotechnol. (2006) 2006:45621–45626.[Medline]
- Martin SL, Cruceanu M, Branciforte D, Li P.W.-L., Kwok SC, Hodges RS, Williams MC. LINE-1 retrotransposition requires the nucleic acid chaperone activity of the ORF1 protein. J. Mol. Biol. (2005) 348:549–561.[CrossRef][Web of Science][Medline]
- Kulpa DA, Moran JV. Ribonucleoprotein particle formation is necessary but not sufficient for LINE-1 retrotransposition. Hum. Mol. Genet. (2005) 14:3237–3248.
[Abstract/Free Full Text] - Feng Q, Moran JV, Kazazian HHJ, Boeke JD. Human L1 retrotransposon encodes a conserved endonuclease required for retrotransposition. Cell (1996) 87:905–916.[CrossRef][Web of Science][Medline]
- Moran JV, Holmes SE, Naas TP, DeBerardinis RJ, Boeke JD, Kazazian H.H. Jr. High frequency retrotransposition in cultured mammalian cells. Cell (1996) 87:917–927.[CrossRef][Web of Science][Medline]
- Luan DD, Korman MH, Jakubczak JL, Eickbush TH. Reverse transcription of R2Bm RNA is primed by a nick at the chomosomal target site: a mechanism for non-LTR retrotransposition. Cell (1993) 72:595–605.[CrossRef][Web of Science][Medline]
- Furano AV. The biological properties and evolutionary dynamics of mammalian LINE-1 retrotransposons. Prog. Nucleic Acid Res. Mol. Biol. (2000) 64:255–294.[Web of Science][Medline]
- Brouha B, Schustak J, Badge RM, Lutz-Prigge S, Farley AH, Moran JV, Kazazian HHJ. Hot L1s account for the bulk of retrotransposition in the human population. Proc. Natl Acad. Sci. USA (2003) 100:5280–5285.
[Abstract/Free Full Text] - Kingsmore SF, Giros B, Suh D, Bieniarz M, Caron MG, Seldin MF. Glycine receptor beta-subunit gene mutation in spastic mouse associated with LINE-1 element insertion. Nat. Genet. (1994) 7:136–142.[CrossRef][Web of Science][Medline]
- Basame S, Li P.W.-1., Howard G, Branciforte D, Keller D, Martin SL. Spatial assembly and RNA binding stoichiometry of a protein essential for LINE-1 retrotransposition. J. Mol. Biol. (2006) 357:351–357.[CrossRef][Web of Science][Medline]
- Januszyk K, Li PW, Villareal V, Branciforte D, Wu H, Xie Y, Feigon J, Loo JA, Martin SL, Clubb RT. Identification and solution structure of a highly conserved C-terminal domain within ORF1p required for retrotransposition of long interspersed nuclear element-1. J. Biol. Chem. (2007) 282:24893–24904.
[Abstract/Free Full Text] - Martin SL, Li J, Weisz JA. Deletion analysis defines distinct functional domains for protein-protein and nucleic acid interactions in the ORF1 protein of mouse LINE-1. J. Mol. Biol. (2000) 304:11–20.[CrossRef][Web of Science][Medline]
- Martin SL, Bushman FD. Nucleic acid chaperone activity of the ORF1 protein from the mouse LINE-1 retrotransposon. Mol. Cell Biol. (2001) 21:467–475.
[Abstract/Free Full Text] - Martin SL. Ribonucleoprotein particles with LINE-1 RNA in mouse embryonal carcinoma cells. Mol. Cell Biol. (1991) 11:4804–4807.
[Abstract/Free Full Text] - Kolosha VO, Martin SL. High affinity, non-sequence-specific RNA binding by the open reading frame 1 (ORF1) protein from long interspersed nuclear element 1 (LINE-1). J. Biol. Chem. (2003) 278:8112–8117.
[Abstract/Free Full Text] - McCauley MJ, Williams MC. Mechanisms of DNA binding determined in optical tweezers experiments. Biopolymers (2007) 85:154–168.[CrossRef][Web of Science][Medline]
- Martin SL, Branciforte D, Keller D, Bain DL. Trimeric structure for an essential protein in L1 retrotransposition. Proc. Natl Acad. Sci. USA (2003) 100:13815–13820.
[Abstract/Free Full Text] - Ostertag EM, Prack ETL, DeBerardinis RJ, Moran JB, Kazazian H.H. Jr. Determination of L1 retrotransposition kinetics in cultured cells. Nucleic Acids Res. (2000) 28:1418–1423.
[Abstract/Free Full Text] - Hohjoh H, Singer MF. Cytoplasmic ribonucleoprotein complexes containing human LINE-1 protein and RNA. EMBO J. (1996) 15:630–639.[Web of Science][Medline]
- Furano AV, Duvernell DD, Boissinot S. L1 (LINE-1) retrotransposon diversity differs dramatically between mammals and fish. Trends Genet. (2004) 20:9–14.[CrossRef][Web of Science][Medline]
- Boissinot S, Chevret P, Furano AV. L1 (LINE-1) retrotransposon evolution and amplification in recent human history. Mol. Biol. Evol. (2000) 17:915–928.
[Abstract/Free Full Text] - Khan H, Smit A, Boissinot S. Molecular evolution and tempo of amplification of human LINE-1 retrotransposons since the origin of primates. Genome Res. (2006) 16:78–87.
[Abstract/Free Full Text] - Mullhard C, Fischer M, Gass P, Simon-Chazottes D, Guenet J.-L, Becker C.-M. The spastic mouse: aberrant splicing of glycine receptor beta subunit mRNA caused by intronic insertion of L1 element. Neuron (1994) 13:1003–1015.[CrossRef][Web of Science][Medline]
- Williams MC, Gorelick RJ, Musier-Forsyth K. Specific zinc-finger architecture required for HIV-1 nucleocapsid protein's nucleic acid chaperone function. Proc. Natl Acad. Sci. USA (2002) 99:8614–8619.
[Abstract/Free Full Text] - Williams MC, Rouzina I, Bloomfield VA. Thermodynamics of DNA interactions from single molecule stretching experiments. Acc. Chem. Res. (2002) 35:159–166.[CrossRef][Web of Science][Medline]
- Williams MC, Rouzina I, Wenner JR, Gorelick RJ, Musier-Forsyth K, Bloomfield VA. Mechanism for nucleic acid chaperone activity of HIV-1 nucleocapsid protein revealed by single molecule stretching. Proc. Natl Acad. Sci. USA (2001) 98:6121–6126.
[Abstract/Free Full Text] - Cruceanu M, Urbaneja MA, Hixson CV, Johnson DG, Datta SA, Fivash MJ, Stephen AG, Fisher RJ, Gorelick RJ, Casas-Finet JR, et al. Nucleic acid binding and chaperone properties of HIV-1 Gag and nucleocapsid proteins. Nucleic Acids Res. (2006) 34:593–605.
[Abstract/Free Full Text] - Cruceanu M, Gorelick RJ, Musier-Forsyth K, Rouzina I, Williams MC. Rapid Kinetics of Protein-Nucleic Acid Interaction is a Major Component of HIV-1 Nucleocapsid Protein's Nucleic Acid Chaperone Function. J. Mol. Biol. (2006) 363:867–877.[CrossRef][Web of Science][Medline]
- Levin JG, Guo J, Rouzina I, Musier-Forsyth K. Nucleic acid chaperone activity of HIV-1 nucleocapsid protein: critical role in reverse transcription and molecular mechanism. Prog. Nucleic Acid Res. Mol. Biol. (2005) 80:217–286.[CrossRef][Web of Science][Medline]
- Li P.W.-L, Li J, Timmerman SL, Krushel LA, Martin SL. The dicistronic RNA from the mouse LINE-1 retortransposon contains an internal ribosome entry site upstream of each ORF: implications for retrotransposition. Nucleic Acids Res. (2006) 34:853–864.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
D. F. Qualley, K. M. Stewart-Maynard, F. Wang, M. Mitra, R. J. Gorelick, I. Rouzina, M. C. Williams, and K. Musier-Forsyth C-terminal Domain Modulates the Nucleic Acid Chaperone Activity of Human T-cell Leukemia Virus Type 1 Nucleocapsid Protein via an Electrostatic Mechanism J. Biol. Chem., January 1, 2010; 285(1): 295 - 307. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






