Skip Navigation


Nucleic Acids Research Advance Access originally published online on May 21, 2009
Nucleic Acids Research 2009 37(13):4360-4370; doi:10.1093/nar/gkp365
This Article
Right arrow Abstract Freely available
Right arrow Print PDF (933K) Freely available
Right arrow Screen PDF (461K) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
37/13/4360    most recent
gkp365v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Rosado, I. V.
Right arrow Articles by Patel, K. J.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosado, I. V.
Right arrow Articles by Patel, K. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 2009, Vol. 37, No. 13 4360-4370
© 2009 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Genome Integrity, Repair and Replication

The Walker B motif in avian FANCM is required to limit sister chromatid exchanges but is dispensable for DNA crosslink repair

Ivan V. Rosado1, Wojciech Niedzwiedz1,2, Arno F. Alpi1 and Ketan J. Patel1,*

1MRC Laboratory of Molecular Biology, Hills Rd, Cambridge CB20QH and 2Department of Medical Oncology, Oxford University, Oxford OX3 9DS, UK

*To whom correspondence should be addressed. Email: kjp{at}mrc-1mb.cam.ac.uk

Received March 12, 2009. Revised April 22, 2009. Accepted April 23, 2009.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY DATA
 FUNDING
 REFERENCES
 
FANCM, the most highly conserved component of the Fanconi Anaemia (FA) pathway can resolve recombination intermediates and remodel synthetic replication forks. However, it is not known if these activities are relevant to how this conserved protein activates the FA pathway and promotes DNA crosslink repair. Here we use chicken DT40 cells to systematically dissect the function of the helicase and nuclease domains of FANCM. Our studies reveal that these domains contribute distinct roles in the tolerance of crosslinker, UV light and camptothecin-induced DNA damage. Although the complete helicase domain is critical for crosslink repair, a predicted inactivating mutation of the Walker B box domain has no impact on FA pathway associated functions. However, this mutation does result in elevated sister chromatid exchanges (SCE). Furthermore, our genetic dissection indicates that FANCM functions with the Blm helicase to suppress spontaneous SCE events. Overall our results lead us to reappraise the role of helicase domain associated activities of FANCM with respect to the activation of the FA pathway, crosslink repair and in the resolution of recombination intermediates.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY DATA
 FUNDING
 REFERENCES
 
A fundamental defect in DNA repair causes Fanconi Anaemia (FA), a genetic illness that leads to abnormal development, bone marrow failure and cancer. As many as 13 genes are known to be mutated in FA, most of these physically and genetically interact to form the FA genome stability pathway (1,2). A key question concerns how such a pathway stimulates DNA repair. The identification of FANCM, a highly conserved gene in the FA pathway, may shed light on this crucial question. Vertebrate FANCM contains highly conserved amino (N) terminal helicase and carboxy (C) terminal nuclease like domains, which suggest that it participates directly in DNA repair (3,4). This domain arrangement is identical to that of the archaeabacterial FANCM orthologue Hef, in which the activities of both domains are coordinated to unwind and cleave a replication fork (5). Recently, FANCM N-terminal helicase and C-terminal nuclease domains have been shown to interact with HCLK2 to promote the activation of DNA damage checkpoints (6). The C-terminal nuclease domain of FANCM interacts with a 24 kDa protein (FAAP24) and this protein complex binds to synthetic replication fork-like DNA structures, preferentially to ssDNA, splayed-arm, and 3'-flap DNA substrates (7). FAAP24 knock down abolishes DNA damage inducible FANCD2 monoubiquitination and leads to sensitivity to DNA crosslinking agents (7).

Biochemical studies of vertebrate and yeast FANCM orthologues, FML (S. pombe) and MPH1 (S. cerevisiae), have revealed that these proteins can bind Holliday junctions and replication fork-structured DNA. Yeast and human FANCM orthologues also promote fork regression, Holliday junction migration and can also unwind RPA-stabilized D-loops (8–11). Furthermore, genetic studies performed in yeast show that the FANCM orthologues promote replication restart and suppress crossovers following sister chromatid recombination after DNA damage (9,12). It is important to emphasize here that only translocase but not helicase activity has been reported for the full length purified FANCM. In addition close sequence analysis of the nuclease like domain does suggest that key catalytic residues seem to be missing leading to the conclusion that this region does not confer nuclease activity. Nevertheless taken together, these findings have led to the proposal that FANCM may move along double-stranded DNA, sensing, remodelling and restarting stalled replication forks.

While some progress has been achieved towards defining the biochemical functions of FANCM in different organisms, evidence about how these activities promote DNA repair following DNA damage in vivo is limited. The yeast orthologues, FML and MPH1, contain only the N terminal helicase-like domain and lack both the middle and C-terminal sections found in vertebrate FANCM. Additionally, no other FA genes have been identified in yeast to date. Therefore, it has not been possible to extrapolate the function of FANCM in the FA DNA repair pathway from the reported in vivo activities of yeast FANCM orthologues.

To circumvent the difficulties encountered in expressing transfected FANCM in either human or chicken FANCM deficient cell lines, Wang and colleagues have used a transient siRNA approach to knock down endogenous FANCM expression in a human cell line. This cell line was simultaneously complemented with siRNA resistant FANCM cDNA. Using this approach they showed that HeLa cells harbouring a point mutation in the ATPase Walker A sequence of FANCM were defective in crosslink repair despite being competent in FANCD2 monoubiquitination (13). This result therefore strongly suggests that the translocase activity of FANCM imparts crosslink repair function.

This work addresses the functions of the distinct domains of chicken FANCM in DNA repair. We systematically dissect how different domains of this large protein function to activate the FA pathway and promote DNA crosslink repair. Furthermore, our genetic analyses uncover two new functions of FANCM that do not overlap with its role in the FA pathway: UV and camptothecin induced DNA damage tolerance. Finally we discover a role for FANCM in the suppression of crossover recombination with the Bloom's (BLM) helicase.


   METHODS
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
RESULTS
 DISCUSSION
 SUPPLEMENTARY DATA
 FUNDING
 REFERENCES
 
Gene disruption of the chicken FANCM locus
The chicken FANCM locus was identified by BLAST search using the human protein sequence against the ENSEMBL draft chicken genome sequence. An ENSEMBL predicted transcript encompassed most of the FANCM gene, although the 5' end, containing some of the helicase motifs, was missing. The complete 5' end of the gene was amplified by PCR and all exons encoding the Mph1 like domain were identified. Sequence from the predicted and PCR amplified genomic DNA was used to design the two gene disruption cassettes (A and B). PCR oligos used to amplify 5' and 3' arms of construct A were TCGTGACACTTAATC CCTCGGTGCTCTGAGC/GAAGGGC GACAAAACCAACTTCCC and AGGCTGTGCA GCAGGTTGTTTCCAA/TGCAACACACAGCGTGA CACCCAGT, respectively. Those for the knockin construct B were 5' arm: AGCGGCGCTGGTCT ATATCTTTAGGG/GCAGACAGCG CTGAGGGGAATACA and 3'arm ACCAAAAGCTGAT GGACATCCAAATCC/AGTTGCCATAGGAAATGATGT TGGTGTCAG. PCR products were cloned into pCR2.1-TOPO (Invitrogen) and then the D203A point mutation was introduced using Stratagene QuickChange XL site directed mutagenesis kit and the following primers: GTTAAATGCTTGGTTG TTGCCGCGGCCCACAAAGCTCTGGG/CCCAGAGC TTTGTGGGCTTCGGCAACAACCAAGCATTTAAC. Transfections, selection and Southern analyses of targeted DT40 clones were carried out as described previously (4,14). The lox drug resistance cassette was removed by transiently transfecting cell lines with the Cre recombinase NLS-expression plasmid. Cells were cloned by limiting dilution and then tested individually for loss of drug resistance. To confirm the appropriate disruptions of the GgFANCM locus the following PCR oligos were used; F1, TTTGGGACGGGAATAGAGC; R1, GCCACCTCCTTTCCTCTAT. Generation of {Delta}BLM FANCM-D203A knockin cell line was carried out by targeting sequentially FANCM-D203A Knockin and FANCM-hel constructs into the {Delta}BLM strain [kind gift from Professor Enomoto (19)]. 5' and 3' arms of the FANCC in situ TAP-tagged construct were generated as described before (4).

Flag-tag constructs were amplified using chicken FANCM cDNA using forward primers CCGAGATCTCACCATGG ATTACAAGGATGACGACGATAAGGACTATAAGGACGAT GATGACAAGAGCGGCGG CCGGCAGCGCACCCTGCCC for the +HEL construct and CCGGGATCCCACCA TGGATTACAAGGATGACGACGATA AGGACTATAAGGACGATGATGACAAG GGGGATT GCAGCTATGAACTGGAGCTT for either +LMS or +NUC constructs and reverse primers CCGAGATCTTCCTTCAGCAGGAAACACACGTGAG for the +HEL construct, CCGGGATCCTCCTTCA GCAGGAAACACACGTGAG for the +LMS construct and CCGGGATCCAGCGGCCGCTCAGCTCCTGCTG for the +NUC construct. These PCR products were cloned into pCR-TOPO and verified by sequencing. These fragments were cloned from pCR-TOPO into the expression plasmid pEXPRESS and checked for orientation. Expression cassettes were cloned into drug resistance cassette-containing pLOX plasmids. Proteins expression was confirmed by western blot.

Mutagen sensitivity assays
For cisplatin survival assays cell lines were plated into 96-well plates at a density of 3000 cells per plate. A range of doses of cisplatin was added to wells, and the plates were returned to the incubator for five complete cell-doubling times. After this the cells were pulsed with MTS (Promega) and incubated for another 1 h. Cell viability was measured by luminometry according to manufacturer's instructions (Promega), and each dose point was assayed in triplicate. The colony survival values plotted are relative to an untreated control.

For UV sensitivity, cells were irradiated with the indicated doses, diluted in medium and grown for 2 weeks in methylcellulose containing plates. For camptothecin sensitivity, cells were grown for 2 weeks in CPT-containing methylcellulose plates. Plots represent the average of three independent experiments. Error bars represent standard deviation.

FANCC-TAP precipitation
Treated or untreated cells (109) were lysed in lysis buffer (50 mM Tris–HCl, pH 8.0, 0.5 mM EDTA, 0.1% Triton X-100, 200 mM NaCl and protease inhibitor cocktail (Roche Molecular Biochemicals)) with a Dounce homogenizer. Lysates were cleared by centrifugation using a Beckman rotor Ti45, at 4°C and 35 000 r.p.m. for 60 min. Extracts (9 mg total protein) were incubated for 2 h at 4°C with 50 µl IgG-Sepharose beads (Amersham). Precipitated material was extensively washed with lysis buffer containing 500 mM NaCl. Precipitated material was resolved by 4–12% Bis/Tris–SDS–PAGE (Invitrogen) and detected by immunoblot with antibodies to Flag, GgFANCG, or TAP. Western blot analyses for FANCD2 were done as described previously (14). Detection of chicken FANCM was carried out using antisera directed to the large middle section of the chicken FANCM gene. The details of this reagent are published in Mosedale et al. (4).

Cellular subfractionation
Two hundred million DT40 cells were treated with 1 mM cisplatin for 16 h, harvested, washed once with PBS and lysed in hypotonic buffer (10 mM Tris–HCl pH 7.4, 10 mM KCl, 1.5 mM MgCl2, 10 mM 2-mercaptoethanol) by pushing cells through a 19G needle. Nuclei were collected by centrifugation (2700 g, 10 s) washed twice with hypotonic buffer and nuclear proteins were extracted with a high-salt buffer (15 mM Tris–HCl, pH 7.4, 1 mM EDTA, 500 mM NaCl, 1 mM MgCl2, 10% glycerol, 10 mM 2-mercaptoethanol and protease inhibitor cocktail). To enrich for chromatin-associated proteins, salt-extracted pellets were treated with 1500 units micrococcal nuclease (Amersham) for 20 min at room temperature in nuclease reaction buffer (20 mM Tris–HCl, pH 7.4, 100 mM KCl, 2 mM MgCl2, 1 mM CaCl2, 0.3 M sucrose, 0.1% Triton X-100 and protease inhibitor cocktail). Comparable amounts (relative to each fraction) were resolved on 4–16% Tris–glycine gels (Invitrogen) by SDS–PAGE and analysed by immunoblotting using anti-FLAG (sigma), anti PAP or anti-histone H3 (Abcam) antibodies.

Gel-filtration analyses
High salt nuclear extracts were prepared with a few modifications as described previously (4). Briefly, proteins were extracted from nuclei (isolated from 4 x 109 DT40 cells as indicated) with nuclear extraction buffer [15 mM Tris–HCl, pH 8.0, 0.2 mM EDTA, 420 mM NaCl, 1.5 mM MgCl2, 25% glycerol, 0.5 mM DTT and protease inhibitor cocktail (Roche Molecular Biochemicals)]. Cleared nuclear extracts (3.5 mg) were directly applied to a Superose 6 HR16/50 column (Amersham) equilibriated with column buffer (15 mM Tris–HCl pH, 8.0, 0.2 mM EDTA, 420 mM NaCl, 1.5 mM MgCl2, 10% glycerol, 0.5 mM DTT). Fractions (4 ml) were collected and aliquots were resolved by 4–12% Bis/Tris–SDS–PAGE (Invitrogen). FANCC-TAP was detected by immunoblot analyses with an antibody to TAP (Sigma). FANCM and FANCG were detected by immunoblot analyses with antibodies raised against GgFANCM and GgFANCG, respectively. The Superose 6 column was calibrated with a high molecular weight calibration kit (Amersham).

SCE analysis in DT40 cells
We carried out SCE assays as previously described (14) using 10 µM BrdU for two cell cycles and adding 0.1 µg (per ml) of colcemid 2.5 h before harvesting cells. The slides were coded (therefore blinded to the observer) and approximately 50 metaphases for each cell line were scored.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
DISCUSSION
 SUPPLEMENTARY DATA
 FUNDING
 REFERENCES
 
Hypomorphic alleles of FANCM in DT40 show different phenotypes
As a first step to distinguish between the functions of the distinct domains of FANCM, we disrupted the exons encoding either the helicase (FANCM-{Delta}hel) (Figure 1A) or the nuclease domain (FANCM-{Delta}nuc) (Mosedale 2004). DT40 strains carrying homozygous deletion of either of these domains were then compared to the full-length deleted FANCM ({Delta}FANCM) strain in terms of FANCD2 monoubiquitination and sensitivity to DNA crosslinking agents (Figure 1B and C). When these cell lines were exposed to high doses of cisplatin, we noted that FANCD2 ubiquitination in the FANCM null cell line was defective compared to wild-type, but importantly was clearly detectable. However, deletion of FANCL a member of FA core complex, completely abolished FANCD2 monoubiquitination. In the FANCM-{Delta}hel cell line, FANCD2 monoubiquitination levels were also diminished, but were unperturbed in the FANCM-{Delta}nuc cell line. We also measured the sensitivity to cisplatin of the FANCM deficient cell lines. The FANCM null cell line was more sensitive to cisplatin than FANCM-{Delta}hel, whilst FANCM-{Delta}nuc is not sensitive to this agent (Figure 1C). This sensitivity partially correlates with the ability of these cell lines to monoubiquitinate FANCD2. A feature of all chicken DT40 FA pathway knockouts is the presence of raised spontaneous sister chromatid exchange events (SCEs) (14–17). FANCM deficient DT40 cells display increased numbers of spontaneous sister chromatid exchanges (SCEs) (4). We therefore compared the levels of SCEs in each FANCM mutant strain. The {Delta}FANCM (mean = 9.0 SCEs per metaphase) and the FANCM-{Delta}hel (mean = 9.2 SCEs per metaphase) strains show elevated SCEs, whilst FANCM-{Delta}nuc (mean = 1.3 SCEs per metaphase) shows wild-type SCEs levels (Figure 1D). Double mutants of genes involved in the FA repair pathway such as FANCC/FANCG, FANCC/FANCA and FANCC/FANCJ do not lead to an increase in SCEs compared to respective single mutants, indicating that SCEs arise by virtue of a common process (14,16). As FANCM is a component of the FA core complex, we compared SCEs levels in the double mutant cell line {Delta}FANCM {Delta}FANCC and the respective single mutant strains. Strikingly, the double {Delta}FANCM {Delta}FANCC strain (mean = 14.9 SCEs per metaphase) has more spontaneous SCEs than either single knockout strain, indicative of an additive impact on this phenotype. Cumulatively, these results suggest that the helicase but not the nuclease domain of FANCM is required for crosslink repair and SCE suppression.


Figure 1
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1. Disruption and characterization of FANCM helicase and nuclease domain deficient DT40 strains. (A) Map of the FANCM locus containing the exons encoding the helicase domain. The gene disruption strategy removes three exons coding for the conserved helicase domain. Genomic Southern blot confirms disruption of the helicase domain. Cartoon depicting predicted products generated by hypomorphic alleles in FANCM deficient cell lines (LMS—Large Middle Section). (B) Time course experiment of FANCD2 monoubiquitination in FANCM deficient cell lines. Cells were exposed to 5 µM cisplatin for up to 6 h. The ratios for D2-L (monoubiquitinated FANCD2) over D2-S (unmodified FANCD2) are shown for 0-h and 6-h time point. FANCD2 monoubiquitination activation in FANCM-{Delta}hel and {Delta}FANCM cell lines is deficient, but normal in FANCM-{Delta}nuc deficient cell line. FANCD2 monoubiquitination in {Delta}FANCL cell line is completely abolished even after 6 h of treatment. (C) Graph showing cisplatin sensitivity determined by cell viability (MTS assay) of FANCM cell lines. (D) Spontaneous SCE frequencies determined for FANCC and FANCM knockout cell lines. The elevated SCEs in the {Delta}FANCM strain are additive compared to {Delta}FANCC in the {Delta}FANCM{Delta}FANCC mutant.

 
Complementation of the FANCM knockout with FANCM domain-specific cDNA
Immunoblot analyses failed to detect residual FANCM protein in any of these strains indicating that the respective disruptions did result in reduced protein expression. However, since the phenotypes of FANCM-{Delta}hel and FANCM-{Delta}nuc cells clearly differed we believe that this most likely reflects the creation of hypomorphic alleles of FANCM (data not shown). To confirm this, we generated FANCM Flag-tagged domain specific over-expression constructs (Figure 2A). These constructs consist of the helicase domain with the large middle section (LMS) of FANCM (+HEL construct), the LMS alone (+LMS construct), or the LMS with the nuclease domain (+NUC construct). LMS was included in all constructs since this region contains the putative bipartite nuclear localization signal. To monitor the FA core complex dynamics, we expressed these cDNAs in a {Delta}FANCM strain that carries a FANCC-TAP tagged allele ({Delta}FANCM FANCC-TAP). Drug resistant clones were then tested for expression and complementation of the various {Delta}FANCM associated defects, such as DNA damage induced FANCD2 monoubiquitination (Figure 2B), cisplatin sensitivity (Figure 2C), ability to interact with the FA core complex (Figure 2D), chromatin targeting of the core complex (Figure 2E) and finally SCEs (Figure 2F). The construct containing the helicase domain (+HEL) partially rescues the FANCD2 monoubiquitination defects (Figure 2B, compare 18.9 monoubiquitination induction fold in +HEL cell line to 12.2 shown by {Delta}FANCM cell line) and cisplatin sensitivity seen in {Delta}FANCM cell line (Figure 2C), it is able to form a stable FA core complex and facilitates accumulation of this complex on chromatin (Figure 2D and E). Moreover, the FANCM helicase domain also partially suppresses elevated SCEs in the FANCM null mutant (Figure 2F). The construct containing the nuclease domain of FANCM partially rescues the FANCD2 monoubiquitination defect observed in {Delta}FANCM (Figure 2B, +NUC cell line shows 28.1 monoubiquitination induction fold compared to 12.2 shown by {Delta}FANCM cell line) indicating that this function is redundant to the helicase domain. It can also assemble into the FA core complex (Figure 2D), however it does not rescue cisplatin sensitivity or the elevated levels of SCE detected in {Delta}FANCM (Figure 2C and F). Finally, +LMS does not complement any of the defects observed in FANCM null cell line but importantly, it can interact with the FA core complex (Figure 2D). These results indicate that the helicase and nuclease domains play redundant roles in FANCD2 ubiquitination process, however, only the helicase domain partially rescues {Delta}FANCM cells from sensitivity to cisplatin and to suppress elevated levels of SCEs observed in the FANCM null cell line. As all the constructs can interact with the FA core complex, we also conclude that LMS region is required to anchor FANCM into this complex.


Figure 2
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2. Complementation of {Delta}FANCM deficient cell line with FANCM domain specific cDNA. (A) The cartoon depicts the three cDNA constructs used for over-expressing three different FANCM domains in the {Delta}FANCM cell line. (B) Suppression by the helicase and nuclease domains of FANCD2 monoubiquitination defects observed in {Delta}FANCM cell line. (–) and (+) indicates untreated and treated cells exposed to 5 µM cisplatin for 17 h. Shown below is the ratio of FANCD2-L over FANCD2-S. Induction fold was calculated dividing FANCD2 ratio after by the ratio before treatment. (C) Graph showing cisplatin sensitivity as determined by cell viability (MTS assay) for all the strains shown. (D) Pull down of FANCC-TAP from nuclear extracts. Anti-FLAG immunoblot for detecting expression of FANCM domains. FANCC-TAP was detected by anti-PAP immunoblot. Left—Nuclear extract, right—FANCC-TAP immunoprecipitation (25). (E) Cellular fractionation of {Delta}FANCM cell lines expressing the three different FANCM domains. Above—Accumulation of FANCC-TAP into the chromatin fractions in the absence (–) or presence (+) of DNA damage. TAP blot to detect FANCC-TAP, middle—Histone H3 blot, and below—FLAG blot to detect FLAG tagged FANCM domains. (F) Spontaneous SCEs frequencies in the {Delta}FANCM cell line expressing the different FANCM domains.

 
In the course of our studies of the {Delta}FANCM strain we noticed that this mutant was also sensitive to UV light and camptothecin (CPT). This is not a feature shared with any of the other FA gene knockouts (data not shown). We decided to investigate this further by identifying the section of FANCM that may be important for either UV light or CPT tolerance. As can be seen in Figure 3A, the {Delta}FANCM strain is sensitive to UV light (D10 value – WT = 5.1 J/m2 {Delta}FANCM = 2.8 J/m2). However, this sensitivity can be complemented with the construct containing the helicase domain (D10 value- + HEL = 4.7 J/m2) (Figure 3B). A similar analysis was also carried out for CPT sensitivity. Again we noted that {Delta}FANCM is sensitive to this agent (Figure 3C). CPT sensitivity, in contrast to UV sensitivity, is partially complemented by the construct containing the nuclease domain but not by the helicase domain (Figure 3D). Cumulatively, the results indicate that the region encompassing the helicase domain of FANCM promotes repair of UV light damage, whilst that encompassing the nuclease domain appears to be critical.


Figure 3
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3. Sensitivity of {Delta}FANCM cell line to UV and camptothecin. (A) UV sensitivity curve of {Delta}FANCM cell line. (B) Complementation of UV light sensitivity shown by the {Delta}FANCM cell line harbouring +HEL but not +NUC construct. (C) Camptothecin sensitivity curve of {Delta}FANCM cell line. (D) CPT sensitivity of {Delta}FANCM cell line is partially complemented by +NUC but not +HEL construct.

 
A point mutation in the helicase Walker B motif separates SCE suppression from crosslink repair functions of FANCM
We then focused our studies on the raised spontaneous SCEs in the {Delta}FANCM and {Delta}FANCM-hel strains. Genetic epistasis results indicate that these raised spontaneous SCEs are not simply due to a defective FA pathway (Figure 1D). To determine whether the putative helicase activity of FANCM suppresses SCEs, an inactivating point mutation (DEAD to AEAD) was introduced into the Walker B motif of this domain. The isolated strain, FANCM-D203A (helicase domain disruption in one allele and knockin into the second allele), contains the relevant mutation in the genomic sequence (Supplementary Figure 1) and importantly expresses full length FANCM protein (Figure 4A). To our surprise, we noted that the point mutant strain was proficient in monoubiquitinating FANCD2 (Figure 4A) and not sensitive to cisplatin (Figure 4B) indicating that the Walker B motif is dispensable for crosslink repair. Next we knocked in a TAP tag into the last exon of the FANCC allele. This results in the expression of endogenously TAP tagged FANCC which enables us to determine the stability of the FA core complex in our point mutant cell line (Figure 4C). In WT cells, the FA core complex migrated in a peak corresponding to 1 MDa. In {Delta}FANCM and FANCM-{Delta}hel cell lines, this complex eluted at a lower molecular weight when compared to the wild type. However, the gel filtration profile for the FANCM-D203A cell line was identical to the wild type profile, indicating that the FA core complex is intact (Figure 4C). Strikingly, this mutant shows high levels of SCEs (Figure 4D) demonstrating that the suppression of SCEs can be attributed to the enzymatic activity of the helicase domain of FANCM. Therefore, the Walker B box mutation D203A dissociates the role of FANCM in crosslink repair and FANCD2 monoubiquitination from that in suppressing SCEs. Since FANCM and both yeast FANCM orthologues also suppress crossover recombination (9), this indicates that the SCEs suppression function of FANCM is conserved in evolution.


Figure 4
View larger version (41K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4. A Walker B point mutation in the helicase domain separates the role for FANCM in SCEs suppression from that in crosslink repair. (A) FANCM immunoblot of nuclear extracts without (–) or with (+) DNA damage. A full length FANCM protein is expressed in the knock in strain that is phosphorylated following DNA damage. Below—the FANCD2 monoubiquitination process after DNA damage is not defective in FANCM-D203A cell line. (B) Cisplatin sensitivity curve as determined by cell viability (MTS assay). The strain expressing the knockin point mutation FANCM-D203A is not sensitive to cisplatin. (C) Gel filtration analysis of endogenously modified FANCM cell lines. Fractions were blotted for FANCC-TAP to detect the FA core complex. {Delta}FANCM and FANCM-{Delta}hel knockout mutants but not FANCM-D203A show a smaller FA core complex size compared to wild-type. (D) High levels of spontaneous SCEs in FANCM-D203A mutant strain compared to wild-type.

 
FANCM functions with the Bloom helicase to suppress SCEs
The Blm helicase is the main guardian against SCEs in eukaryotes (18). The yeast FANCM orthologues function in a distinct SCE suppression pathway to their respective Blm orthologues (9). In order to test whether vertebrate FANCM functions in the same or a distinct SCE suppression pathway to Blm, we made the helicase point mutation D203A in a DT40 BLM knockout cell line ({Delta}Blm) (19) to obtain the cell line {Delta}Blm FANCM-D203A (Supplementary Figure 2). The double mutant strain displayed the same viability as the single {Delta}Blm strain (Supplementary Figure 2). This strain was proficient at FANCD2 monoubiquitination although with slightly reduced efficiency when compared to either single mutant strain (Figure 5A). We also determined the crosslink sensitivity and particularly noted that the {Delta}Blm FANCM-D203A strain retained the cisplatin sensitivity of the {Delta}Blm strain (Figure 5B). Most importantly, the number of SCEs in the {Delta}Blm FANCM-D203A strain (mean = 15.2 SCEs per metaphase) was equivalent to the {Delta}Blm strain (mean = 14 SCEs per metaphase) (Figure 5C).


Figure 5
View larger version (52K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 5. FANCM functions with Blm to suppress a subset of SCE events. (A) FANCD2 monoubiquitination in the {Delta}Blm FANCM-D203A mutant cell line. Shown below are the ratios of FANCD2-L over FANCD2-S and fold induction before (–) and after 6 h treatment (+) with 1 µM cisplatin. (B) Cisplatin sensitivity curve as determined by cell viability (MTS assay). (C) Spontaneous SCE levels in the {Delta}Blm FANCM-D203A strain resemble those in the {Delta}Blm strain. (D) Gel filtration analisys of FANCM and FANCG in {Delta}Blm and {Delta}FANCL strains. Above—Anti FANCM immunoblot of nuclear extract fractions obtained from gel filtration. FANCM fractionates as a large molecular mass peak that does not change in {Delta}Blm but shifts in {Delta}FANCL strains. Bottom—The same fractions were also blotted with an anti-FANCG antibody to monitor the FA core complex. (E) FANCM modification after DNA damage in FA deficient cell lines. FANCM becomes modified in the absence of a functional FA core complex.

 
Since FANCM functions within the FA core complex and also with Blm to carry out distinct functions, we set out to determine if the distribution of FANCM protein complex(es) is/are altered in the absence of Blm or the FA core complex. Nuclear extracts from wild-type, {Delta}Blm and {Delta}FANCL DT40 strains were fractionated by size exclusion chromatography and blotted for FANCM or the FA core complex protein FANCG. The high molecular mass FANCM complex is unperturbed in {Delta}Blm cells but shifts to a slightly smaller mass when the FA complex integrity is disrupted, as seen in {Delta}FANCL cells (Figure 5D). In addition, FANCM is stable and it can be phosphorylated in most chicken FA knockout cell lines (Figure 5E). Together, these studies point to the existence of a distinct stable FANCM complex that does not contain BLM or the FA core complex. Cumulatively, these experiments indicate that FANCM contributes only in a subset of Blm suppressible SCE events.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
SUPPLEMENTARY DATA
 FUNDING
 REFERENCES
 
In conclusion our systematic genetic dissection of chicken FANCM reveals how this protein promotes activation of the FA pathway and crosslink repair. In addition we discovered that FANCM is not only required for tolerance of UV and camptothecin induced DNA damage, but also for the suppression of crossover recombination.

Monoubiquitination of FANCD2 is crucial for the activation of the FA pathway. This process requires an intact FA core complex, Ube2t and FANCI, occurring only during the S and G2 phases of the cell cycle (20). The core enzymatic basis of this reaction is probably modulated by the E2 ligase (Ube2t) interacting with the E3 (FANCL embedded in the core complex) and the substrate (FANCD2 complexed to FANCI) (21–23). Studies using siRNA knockdown of FANCM or its nuclease domain binding partner FAAP24 in human cell lines show that FANCD2 monoubiquitination is severely impaired. In contrast, although chicken FANCM knockouts have reduced FANCD2 monoubiquitination, the defect in this modification is less marked than that observed in human cell lines. Moreover, when the {Delta}FANCM strain is exposed to large doses of cisplatin we can still see DNA damage induced FANCD2 monoubiquitination. Despite this discrepancy, a question that remains is how FANCM stimulates DNA damage inducible FANCD2 monoubiquitination. This cannot simply be due to assembly of the residual FA core complex existing in the {Delta}FANCM strain. One possibility is that FANCM mobilizes the FA core complex to chromatin by recognizing damaged DNA replication forks (4,24). Indeed both the helicase and nuclease domains can bind fork structured DNA (4,7,8) and we show here that both domains can independently stimulate FANCD2 monoubiquitination. However if stalled replication forks degenerate into double strand breaks in FANCM null cells, then this may enable a residual FANCM deficient core complex to stimulate FANCD2 monoubiquitination.

A key function of the FA pathway is to promote DNA crosslink repair. Genetic studies indicate that the FA proteins work upstream of a combined HR and TLS process to remove crosslinks (14). A recent report using Xenopus extract provides biochemical proof of such a combined process (25). We currently do not know the molecular basis of the putative upstream role of the FA pathway in such a combined process. However, FANCM clearly plays a key role in this process and it may now be possible using the genetic and biochemical evidence to integrate this into a working model. Our study clearly shows that the N-terminal helicase domain is crucial for effective repair, although a predicted inactivating mutation in the helicase domain has no impact on crosslink repair. The biochemical activities of FANCM, such as branch migration, translocase activity, D-loop dissolution and fork regression, all require ATPase activity and are very likely to be significantly impacted by mutation of the DEAD box. This suggests that these activities may not confer crosslink repair activity to FANCM. On the other hand, the siRNA complementation based approach does suggest that ATP binding is required for crosslink repair (13). It is therefore plausible that the ATP binding in the context of an intact helicase domain is crucial for crosslink repair, although this may not simply be used to drive the helicase or translocase functions. We propose that the helicase domain of FANCM recognizes and binds to stalled replication forks. DNA dependent ATP binding activity may then induce a conformational change that recruits other repair proteins to the site (Figure 6A). Such a model would predict that apart from FAAP24 other proteins might interact with FANCM.

An unexpected finding reported here is the marked sensitivity to both UV light and camptothecin, interestingly this is a feature it shares with hamster cell line mutant of FANCG (26). FANCM seems to utilize different domains to protect against the genotoxic effects of either of these agents, revealing a new level of complexity in the repair functions of this protein (Figure 6B). The helicase domain, but not its translocase activity (data not shown), is required to protect against UV light. However, it is not possible from our genetic studies to deduce how the FANCM helicase domain facilitates repair of UV light induced DNA damage, creating double mutants where FANCM disruption is combined with either NER or TLS genes may shed important light into this question. The marked sensitivity to camptothecin in the FANCM knockout requires the region emcompassing the nuclease domain. Camptothecin exerts its toxicity by covalently trapping type I topoisomerases-DNA complexes. Such complexes impede replication and are converted into lethal double strand breaks. The nuclease domain appears to have no obvious activity apart from binding to FAAP24 and HCLK2, and to fork structured DNA. Therefore, it could be that this FANCM domain can target repair enzymes to replication forks stalled at locked type I topoisomerases-DNA complexes. It is interesting to note that {Delta}Blm cells are also sensitive to CPT and it has been suggested that the Blm-Topo III complex helps resolve damage caused by this agent (27). Since FANCM co-purifies with the Blm-Topo III complex (28) it is conceivable that the C terminus of FANCM recruits the Blm-Topo III complex to resolve such stalled forks.

FANCM loss in DT40 results in an increase in spontaneous SCE events. These events could reflect the presence of spontaneous DNA damage that is then resolved by HR. In such a scenario it is possible that replication fork breakage occurs more frequently in the absence of FANCM resulting in the accumulation of double strand breaks. Unrestrained homologous recombination may then repair such lesions and since some of such events are resolved by crossover this may result in raised SCE. Alternatively and more likely the SCE events could be due to a bias towards resolving recombination intermediates by crossover. How might FANCM act to suppress crossover recombination? Our studies clearly show that this requires the Walker DEAD box motif, and this is a distinct activity from the other FANCM based DNA damage tolerance responses reported here. In addition, our genetic studies show that FANCM functions in only a subset of Blm dependent non-crossover events. It is also noteworthy that both yeast FANCM orthologues—MPH1 and FML1 also suppress crossover recombination. However, in contrast to FANCM, both yeast FANCM orthologues function in an independent pathway to their respective Blm orthologues. Recombinant FANCM, Mph1 and Fml1 can all dissolve D loops (Figure 6C) (9,10,12). These recombination intermediates precede crossover-resolving steps. By resolving such early recombination intermediates, FANCM may indirectly reduce crossover events. What might then be the function of Blm in such situations? One possibility is that FANCM synergises the function of Blm in dissolving D loops. The fact that Blm seems to be more important than FANCM in suppressing crossovers may reflect its key role in decatenating double Holliday junctions (18). It will therefore be important to test whether Blm augments the anti-recombinogenic biochemical activities of FANCM. Multiple DNA helicases in both budding yeast (Sgs1, Srs2, Mph1) (29,30) and vertebrates (Blm, Wrn, Fbh1, FANCM, RecQL1, RecQL5) (31–33) defend their genomes from crossovers. The fact that mitotic eukaryotic cells display very low levels of crossovers is a testament to the evolutionary conserved function of these pathways. Their inactivation leaves genomes vulnerable to loss of heterozygosity, chromosome translocations and thereby to inevitable consequences on health.


Figure 6
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 6. Model for the role of FANCM in the DNA damage response. (A) Model for the role of FANCM in the FA pathway and crosslink repair in the DNA damage response. (1) The helicase or nuclease domain can target the FA core complex to a replication block at a DNA crosslink. (2) The core complex can stimulate FANCD2 monoubiquitination, perhaps by being in close proximity to its substrates FANCD2 and FANCI. (3) An ATP driven conformational change may enable the FANCM complex to recruit additional DNA repair proteins that carry out crosslink repair. (B) A cartoon of the FANCM protein divided into the three domains systematically dissected in this article. Each of the domains confers distinct functions to FANCM in the DNA damage response. (C) FANCM helicase suppresses crossovers by dissolving D-loops, by acting early to suppress D loop formation FANCM may prevent the formation of Holliday junction, which are then resolved by crossover.

 

   SUPPLEMENTARY DATA
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY DATA
FUNDING
 REFERENCES
 
Supplementary Data are available at NAR Online.


   FUNDING
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY DATA
 FUNDING
REFERENCES
 
Personal long-term FEBS fellowship to I.V.R.; personal postdoc fellowship from the AICR to W.N. and A.A. Funding for open access charge: MRC.

Conflict of interest statement. None declared.


   ACKNOWLEDGEMENTS
 
We thank Paul Pace, Georgina Mosedale and Alicja Trebinska for valuable advice and creation of key reagents, Professors Enomoto, S.Takeda for DT40 knockout strains. We also thank to J.P. de Winter for communicating us unpublished results, and all the members in K.J. Patel lab for critical reading of the manuscript. W.N. is currently a recipient of an AICR investigator award.


   Footnotes
 
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS
 DISCUSSION
 SUPPLEMENTARY DATA
 FUNDING
 REFERENCES
 

  1. Patel KJ, Joenje H. Fanconi anemia and DNA replication repair. DNA Rep. (2007) 6:885–890.[CrossRef]

  2. Wang W. Emergence of a DNA-damage response network consisting of Fanconi anaemia and BRCA proteins. Nat. Rev. (2007) 8:735–748.

  3. Meetei AR, Medhurst AL, Ling C, Xue Y, Singh TR, Bier P, Steltenpool J, Stone S, Dokal I, Mathew CG, et al. A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M. Nat. Genet. (2005) 37:958–963.[CrossRef][Web of Science][Medline]

  4. Mosedale G, Niedzwiedz W, Alpi A, Perrina F, Pereira-Leal JB, Johnson M, Langevin F, Pace P, Patel KJ. The vertebrate Hef ortholog is a component of the Fanconi anemia tumor-suppressor pathway. Nat. Struct. Mol. Biol. (2005) 12:763–771.[CrossRef][Web of Science][Medline]

  5. Komori K, Hidaka M, Horiuchi T, Fujikane R, Shinagawa H, Ishino Y. Cooperation of the N-terminal Helicase and C-terminal endonuclease activities of Archaeal Hef protein in processing stalled replication forks. J. Biol. Chem. (2004) 279:53175–53185.[Abstract/Free Full Text]

  6. Collis SJ, Ciccia A, Deans AJ, Horejsi Z, Martin JS, Maslen SL, Skehel JM, Elledge SJ, West SC, Boulton SJ. FANCM and FAAP24 function in ATR-mediated checkpoint signaling independently of the fanconi anemia core complex. Mol. Cell (2008) 32:313–324.[CrossRef][Web of Science][Medline]

  7. Ciccia A, Ling C, Coulthard R, Yan Z, Xue Y, Meetei AR, Laghmani el H, Joenje H, McDonald N, de Winter JP, et al. Identification of FAAP24, a Fanconi anemia core complex protein that interacts with FANCM. Mol. Cell (2007) 25:331–343.[CrossRef][Web of Science][Medline]

  8. Gari K, Decaillet C, Stasiak AZ, Stasiak A, Constantinou A. The Fanconi anemia protein FANCM can promote branch migration of Holliday junctions and replication forks. Mol. Cell (2008) 29:141–148.[CrossRef][Web of Science][Medline]

  9. Sun W, Nandi S, Osman F, Ahn JS, Jakovleska J, Lorenz A, Whitby MC. The FANCM ortholog Fml1 promotes recombination at stalled replication forks and limits crossing over during DNA double-strand break repair. Mol. Cell (2008) 32:118–128.[CrossRef][Web of Science][Medline]

  10. Gari K, Decaillet C, Delannoy M, Wu L, Constantinou A. Remodeling of DNA replication structures by the branch point translocase FANCM. Proc.Natl Acad. Sci. USA (2008) 105:16107–16112.[Abstract/Free Full Text]

  11. Prakash R, Krejci L, Van Komen S, Anke Schurer K, Kramer W, Sung P. Saccharomyces cerevisiae MPH1 gene, required for homologous recombination-mediated mutation avoidance, encodes a 3' to 5' DNA helicase. J. Biol. Chem. (2005) 280:7854–7860.[Abstract/Free Full Text]

  12. Prakash R, Satory D, Dray E, Papusha A, Scheller J, Kramer W, Krejci L, Klein H, Haber JE, Sung P, et al. Yeast Mph1 helicase dissociates Rad51-made D-loops: implications for crossover control in mitotic recombination. Genes Dev. (2009) 23:67–79.[Abstract/Free Full Text]

  13. Xue Y, Li Y, Guo R, Ling C, Wang W. FANCM of the Fanconi anemia core complex is required for both monoubiquitination and DNA repair. Hum. Mol. Genet. (2008) 17:1641–1652.[Abstract/Free Full Text]

  14. Niedzwiedz W, Mosedale G, Johnson M, Ong CY, Pace P, Patel KJ. The Fanconi anaemia gene FANCC promotes homologous recombination and error-prone DNA repair. Mol. Cell (2004) 15:607–620.[CrossRef][Web of Science][Medline]

  15. Yamamoto K, Hirano S, Ishiai M, Morishima K, Kitao H, Namikoshi K, Kimura M, Matsushita N, Arakawa H, Buerstedde JM, et al. Fanconi anemia protein FANCD2 promotes immunoglobulin gene conversion and DNA repair through a mechanism related to homologous recombination. Mol. Cell Biol. (2005) 25:34–43.[Abstract/Free Full Text]

  16. Bridge WL, Vandenberg CJ, Franklin RJ, Hiom K. The BRIP1 helicase functions independently of BRCA1 in the Fanconi anemia pathway for DNA crosslink repair. Nat. Genet. (2005) 37:953–957.[CrossRef][Web of Science][Medline]

  17. Ling C, Ishiai M, Ali AM, Medhurst AL, Neveling K, Kalb R, Yan Z, Xue Y, Oostra AB, Auerbach AD, et al. FAAP100 is essential for activation of the Fanconi anemia-associated DNA damage response pathway. EMBO J. (2007) 26:2104–2114.[CrossRef][Medline]

  18. Wu L, Hickson ID. The Bloom's syndrome helicase suppresses crossing over during homologous recombination. Nature (2003) 426:870–874.[CrossRef][Medline]

  19. Wang W, Seki M, Narita Y, Sonoda E, Takeda S, Yamada K, Masuko T, Katada T, Enomoto T. Possible association of BLM in decreasing DNA double strand breaks during DNA replication. EMBO J. (2000) 19:3428–3435.[CrossRef][Web of Science][Medline]

  20. Wang W. A major switch for the Fanconi anemia DNA damage-response pathway. Nat. Struct. Mol. Biol. (2008) 15:1128–1130.[CrossRef][Web of Science][Medline]

  21. Alpi A, Langevin F, Mosedale G, Machida YJ, Dutta A, Patel KJ. UBE2T, the Fanconi anemia core complex, and FANCD2 are recruited independently to chromatin: a basis for the regulation of FANCD2 monoubiquitination. Mol. Cell Biol. (2007) 27:8421–8430.[Abstract/Free Full Text]

  22. Machida YJ, Machida Y, Chen Y, Gurtan AM, Kupfer GM, D'Andrea AD, Dutta A. UBE2T is the E2 in the Fanconi anemia pathway and undergoes negative autoregulation. Mol. Cell (2006) 23:589–596.[CrossRef][Web of Science][Medline]

  23. Ishiai M, Kitao H, Smogorzewska A, Tomida J, Kinomura A, Uchida E, Saberi A, Kinoshita E, Kinoshita-Kikuta E, Koike T, et al. FANCI phosphorylation functions as a molecular switch to turn on the Fanconi anemia pathway. Nat. Struct. Mol. Biol. (2008) 15:1138–1146.[CrossRef][Web of Science][Medline]

  24. Kim JM, Kee Y, Gurtan A, D'Andrea AD. Cell cycle-dependent chromatin loading of the Fanconi anemia core complex by FANCM/FAAP24. Blood (2008) 111:5215–5222.[Abstract/Free Full Text]

  25. Raschle M, Knipsheer P, Enoiu M, Angelov T, Sun J, Griffith JD, Ellenberger TE, Scharer OD, Walter JC. Mechanism of replication-coupled DNA interstrand crosslink repair. Cell (2008) 134:969–980.[CrossRef][Web of Science][Medline]

  26. Tebbs RS, Hinz JM, Yamada NA, Wilson JB, Salazar EP, Thomas CB, Jones IM, Jones NJ, Thompson LH. New insights into the Fanconi anemia pathway from an isogenic FancG hamster CHO mutant. DNA Rep. (2005) 4:11–22.[CrossRef]

  27. Rao VA, Fan AM, Meng L, Doe CF, North PS, Hickson ID, Pommier Y. Phosphorylation of BLM, dissociation from topoisomerase IIIalpha, and colocalization with gamma-H2AX after topoisomerase I-induced replication damage. Mol. Cell Biol. (2005) 25:8925–8937.[Abstract/Free Full Text]

  28. Meetei AR, Sechi S, Wallisch M, Yang D, Young MK, Joenje H, Hoatlin ME, Wang W. A multiprotein nuclear complex connects Fanconi anemia and Bloom syndrome. Mol. Cell Biol. (2003) 23:3417–3426.[Abstract/Free Full Text]

  29. Robert T, Dervins D, Fabre F, Gangloff S. Mrc1 and Srs2 are major actors in the regulation of spontaneous crossover. EMBO J. (2006) 25:2837–2846.[CrossRef][Web of Science][Medline]

  30. Ira G, Malkova A, Liberi G, Foiani M, Haber JE. Srs2 and Sgs1-Top3 suppress crossovers during double-strand break repair in yeast. Cell (2003) 115:401–411.[CrossRef][Web of Science][Medline]

  31. Wang W, Seki M, Narita Y, Nakagawa T, Yoshimura A, Otsuki M, Kawabe Y, Tada S, Yagi H, Ishii Y, et al. Functional relation among RecQ family helicases RecQL1, RecQL5, and BLM in cell growth and sister chromatid exchange formation. Mol. Cell Biol. (2003) 23:3527–3535.[Abstract/Free Full Text]

  32. Imamura O, Fujita K, Shimamoto A, Tanabe H, Takeda S, Furuichi Y, Matsumoto T. Bloom helicase is involved in DNA surveillance in early S phase in vertebrate cells. Oncogene (2001) 20:1143–1151.[CrossRef][Web of Science][Medline]

  33. Hu Y, Lu X, Barnes E, Yan M, Lou H, Luo G. Recql5 and Blm RecQ DNA helicases have nonredundant roles in suppressing crossovers. Mol. Cell Biol. (2005) 25:3431–3442.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Print PDF (933K) Freely available
Right arrow Screen PDF (461K) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
37/13/4360    most recent
gkp365v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Rosado, I. V.
Right arrow Articles by Patel, K. J.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosado, I. V.
Right arrow Articles by Patel, K. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?