Nucleic Acids Research Advance Access originally published online on June 10, 2009
Nucleic Acids Research 2009 37(15):e102; doi:10.1093/nar/gkp494
Nucleic Acids Research, 2009, Vol. 37, No. 15 e102
© 2009 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Plasmid-based lacZ
assay for DNA polymerase fidelity: application to archaeal family-B DNA polymerase
Stanislaw K. Jozwiakowski and
Bernard A. Connolly*
Institute of Cell and Molecular Biosciences (ICaMB), Newcastle University, Newcastle upon Tyne, NE2 4HH, UK
*To whom correspondence should be addressed. Tel: +44 0191 222 7371; Fax: +44 0191 222 7424; Email: b.a.connolly{at}ncl.ac.uk
Received March 19, 2009. Revised May 20, 2009. Accepted May 21, 2009.
 |
ABSTRACT
|
|---|
The preparation of a gapped pUC18 derivative, containing the
lacZ
reporter gene in the single-stranded region, is described.
Gapping is achieved by flanking the
lacZ
gene with sites for
two related nicking endonucleases, enabling the excision of
either the coding or non-coding strand. However, the excised
strand remains annealed to the plasmid through non-covalent
Watson–Crick base-pairing; its removal, therefore, requires
a heat–cool cycle in the presence of an exactly complementary
competitor DNA. The gapped plasmids can be used to assess DNA
polymerase fidelity using
in vitro replication, followed by
transformation into
Escherichia coli and scoring the blue/white
colony ratio. Results found with plasmids are similar to the
well established method based on gapped M13, in terms of background
(

0.08% in both cases) and the mutation frequencies observed
with a number of DNA polymerases, providing validation for this
straightforward and technically uncomplicated approach. Several
error prone variants of the archaeal family-B DNA polymerase
from
Pyrococcus furiosus have been investigated, illuminating
the potential of the method.
 |
INTRODUCTION
|
|---|
DNA polymerases play a central role in cellular DNA replication
and repair and are used for a number of biotechnology purposes
such as DNA sequencing and the polymerase chain reaction (
1–6).
The accuracy of DNA polymerases is critical both for
in vivo functions and
in vitro applications, necessitating simple methods
for measuring fidelity. Many polymerases, particularly those
involved in replication of the genome, are very accurate often
making only a single mistake per 10
5/10
6 bases incorporated
(
7,
8). Therefore, fidelity assays must be capable of measuring
the occasional rare mistake, occurring in a background of faithful
replication. A popular method uses the
lacZ 
-complementation
gene (
lacZ
), which encodes the

-peptide, an inactive segment
of β-galactosidase. The presence of the
lacZ
gene in complementing
Escherichia coli strains (which contain a chromosomal copy of
the remaining
β-galactosidase gene fragment) results in
the reconstitution of a functional β-galactosidase, giving
blue colonies on media supplemented with X-gal. A general approach
involves the use of a gapped M13 DNA, containing the
lacZ
gene
in the single-stranded region (
9,
10). A polymerase is used to
fill in the gap and the product introduced into
E. coli cells,
which are plated on media containing X-gal. Gap filling without
mistakes results in a fully functional

-peptide, and the formation
of blue plaques. Errors give rise to changes in the
lacZ
coding
sequence, which can result in a defective

-peptide and the appearance
of white plaques. The ratio of white/blue plaques is a reflection
of fidelity, the higher the proportion of white plaques the
less accurate the polymerase. Further information can be obtained
by sequencing white plaques, which reveals the exact nature
of the base-pair change. An alternative, applicable to thermostable
DNA polymerases, involves PCR amplification of a fragment encoding
lacIOZ
and subsequent insertion of the amplicons into

gt10 phage
vector (
7,
11). Here, errors during the copying of
lacI, the
gene encoding the lac repressor, are scored. Mistakes by the
polymerase lead to a defective lac repressor, allowing transcription
of the
lacZ
gene and, therefore, the appearance of blue plaques.
A high blue/white plaque ratio indicates a polymerase of poor
fidelity. A plasmid-based assay using the
Cro gene has also
been described (
12). However, the preparation of the required
gapped plasmid was somewhat unwieldy, requiring nicking with
a restriction endonuclease in the presence of ethidium bromide,
followed by digestion with exonuclease III. The protocol results
in only half the molecules containing the
Cro gene in the single-stranded
region, necessitating corrections to the observed mutation frequency.
Mistakes in filling the gap give a Cro
– phenotype, scored
as red colonies, and the method has been used to investigate
the error prone DNA polymerase V. A plasmid system based on
the herpes simplex virus thymidine kinase gene is known, although
its use to assay polymerase fidelity
in vitro is somewhat convoluted,
involving multiple steps (
13). Finally, a fully double-stranded
plasmid containing
oriC and a streptomycin-selectable marker
(the
rpsL gene, encoding the small ribosomal S12 protein) has
been described (
14). However, experiments can only be performed
with fully reconstituted replisomes, capable of DNA synthesis
from
OriC, and not with isolated polymerases. In this publication
an alternative fidelity assay, based on gapped plasmids containing
the
lacZ
gene, is described. The substrate plasmids are easy
to prepare and the fidelity measurement rapid and straightforward.
The method is applicable to the
in vitro study of all polymerases
and potentially useful for studying DNA replication and repair
in vivo in a number of cell types.
 |
MATERIALS AND METHODS
|
|---|
Materials
Deoxynucleotide triphosphates (dNTPs) were supplied by Roche
(Penzberg, Germany) and were the best quality available (PCR
grade). Phusion DNA polymerase (derived from a
Pyroccccus species
DNA polymerase), T4 DNA polymerase (T4-Pol) and lambda (

) exonuclease
were purchased from New England Biolabs (Hitchin, UK). NtBpu10I
and NbBpu10I nicking enzymes, the restriction endonucleases
PstI and DpnI and
Thermus aquaticus DNA polymerase (Taq-Pol)
were supplied by Fermentas (York, UK). pUC18 was from Stratagene
(Agilent, Stockport, UK). The purification of Pfu-Pol (the following
variants were used in this publication: wild type, the 3'-5'
proof-reading exonuclease minus (exo
–) mutant D215A, the
low-fidelity double mutants Q472G/D215A and D473G/D215A) has
been described (
15,
16). The following
E. coli strains were used:
Top10 (Invitrogen, Paisley, UK) and XL-10 Gold (Stratagene).
Site-directed mutagenesis of pUC18 to produce pSJ1
To flank the lacZ
gene, present in pUC18, with two sites for each of the related nicking enzymes NtBpu10I (frames the coding strand) and NbBpu10I (frames the non-coding strand), two rounds back-to-back PCR site directed mutagenesis (17) were carried out. The primers GTCATAGCTGAGGCCTGTGTGAAATTGTTATCCGCTCACAATTC and CAATTTCACACAGGCCTCAGCTATGACCATGATTACG were used in the first PCR to generate nicking sites upstream of lacZ
. In a second PCR the primers CGGGTGTCGGCTCAGGCTTAACTATGCGGCATCAGAG and CATAGTTAAGCCTGAGCCGACACCCGCCAACACCCGCTGAC were used to produce the downstream nicking sites. The PCR reaction mixture comprised 50 µl of 1x HF buffer supplied with Phusion DNA polymerase, 200 µM of the four dNTPs, 1 µM of forward and reverse primer,
300 ng of pUC18 template and 40 U/ml of Phusion DNA polymerase. Nineteen PCR cycles (35 s at 95°C, 40 s at 55°C and 4 min at 70°C) were used. Amplified DNA was purified with PCR clean-up kit (Qiagen, Crawley, UK) and subsequently treated with DpnI for 5 h to destroy parental plasmid template. XL-10 Gold (Stratagene) ultra competent cells were transformed with the DNA sample according to the supplier's protocol. Transformants were grown over night at 37°C on LB plates supplemented with ampicillin and used next day to seed 5-ml liquid culture in LB media containing 100 ug/ml of ampicillin. Usually three of the clones were subjected to mini preparative scale DNA extraction (Qiagen) and the presence of the nicking sites and the integrity of the lacZ
gene were confirmed by DNA sequencing.
Nicking pSJ1 with NtBpu10I and NbBpu10I
Twenty micrograms of pSJ1 was nicked with either NtBpu10I (cuts twice on the coding strand of lacZ
) or NbBpu10I (cuts twice on the non-coding strand of lacZ
). Reactions were performed for 3 h at 37°C in 1 ml with 100 U of the enzymes and using the buffer recommended by the supplier. The nicked plasmid was purified with a PCR clean up kit (Qiagen).
Preparation of lacZ
single-stranded competitor DNA
The lacZ
gene, in pUC18, was amplified by PCR using two sets of primers: either pTCAGCTATGACCATGATTACG and GGCTTAACTATGCGGCATCAGAG or TCAGCTATGACCATGATTACG and pGGCTTAACTATGCGGCATCAGAG (where p represents a 5'-phosphate group). The PCR reaction mixture used identical to that described above and 30 cycles (35 s at 95°C, 35 s at 55°C and 30 s at 70°C) were used. The amplified lacZ
DNA was purified with a PCR clean-up kit (Qiagen) and subsequently subjected to specific degradation of the 5' phosphorylated strand using lambda exonuclease (18). The reaction was performed with 2 µg of the PCR product in 50 µl of supplier's buffer using 5 U of lambda exonuclease for 30 min at 37°C. The resulting single-stranded DNA was purified using a nucleotide removal kit (Qiagen).
Preparation of gapped DNA
Nicked pSJ1 was converted to gapped pSJ1(+) and pSJ1(–) using an excess of single-stranded competitor DNA substrates. Ten micrograms of the nicked plasmid was mixed with 10-fold molar excess of the appropriate lacZ
single-stranded competitor in 500 µl of 50 mM Tris–HCl, pH 7.5, 100 mM NaCl, 10 mM MgCl2, 0.1 mg/ml bovine serum albumin and subjected to three cycles of denaturation/re-annealing that consisted of 1 min, 90°C; 10 min, 60°C 20 min, 37°C. The mixture was then treated with 100 U of PstI restriction endonuclease for 3 h at 37°C. Finally, the gapped pSJ1(+) and pSJ1(–) were purified using gel electrophoresis on 1% agarose, stained with ethidium bromide and visualized under UV light. The bands corresponding to the gapped plasmids were extracted with a gel extraction kit (Qiagen) and stored frozen in –20°C until further use. Approximately 3 µg of the gapped plasmid was obtained from each 10 µg of nicked pSJ1.
Background mutation rate determination
To measure background rate of mutations associated with pSJ1, about 40 fmol of nicked pSJ1 (cut singly at either the upstream and downstream nicking sites or double cut at both nicking sites) or gapped pSJ1(+) and pSJ1(–) were added to the DNA polymerase extension buffer (described below). One microlitre of these mixtures were used to transform 30 µl of E. coli Top10 (in a few cases XL-10 Gold) ultra competent cells, which were held on ice for 30 min. The cells were heat shocked by treatment at 42°C for 35 s, held on ice for a further 2 min and then supplemented with 970 µl of NZY medium (lacking ampicillin). Following incubation at 37°C for 1 h, the cells were diluted 20-fold with fresh NZY (plus ampicillin) medium and 100 µl was then plated on LB media supplemented with 20 µg/ml X-Gal, 100 µg/ml ampicillin and 100 µM IPTG. After incubation of the plates at 37°C for 16 h, the plates were scored for blue and colourless colonies.
DNA polymerase fidelity assayed with pSJ1(+) and pSJ1(–)
Three polymerases (Phusion (a Pyrococcus furiosus polymerase derivative), Thermus aquaticus and T4) were used to gap fill pSJ1(+) and pSJ1(–). Reactions (25 µl) contained 50 mM Tris–HCl (pH 7.7), 10 mM MgCl2, 100 mM NaCl, 1 mM DTT, 100 µg/ml bovine serum albumin, 100 µM of each dNTP, 0.8 nM pSJ1(+) or pSJ1(–) and 20 U/ml (units defined by the supplier) of the DNA polymerase. Polymerization reactions were performed at 30°C for 30 min. The completeness of polymerase-catalysed gap-filling was determined using agarose (1%) gel electrophoresis, with ethidium bromide staining and UV visualization. The polymerase reactions products were then used to transform E. coli Top10 for blue/white colony scoring as described above.
DNA sequencing
Single colonies on LB plates were picked and grown overnight at 37°C in LB media containing 100 µg/ml ampicillin. Cells were pelleted by centrifugation and plasmids isolated by alkaline mini preparative scale purification using a Qiagen kit. Plasmids were sequenced (GATC-Biotech, Cambridge, UK) using CGTATGTTGTGTGGAATTG as primer. The sequences determined were aligned with the coding strand of the parental lacZ
reporter gene present in pSJ1 using Clone Manager Professional Suite 8.0 (Sci-Ed Software, Cary NC, USA).
Fidelity of error prone Pfu-Pol mutants
Four Pfu-Pol variants (wild type, the 3'-5' exonuclease (exo–) minus variant D215A and two exo– double mutants Q472G/D215A and D473G/D215A) were used to fill pSJ(+). Reactions (20 µl) contained 50 mM Tris, pH 8.0, 100 mM NaCl, 3 mM MgSO4, 100 µg/ml bovine serum albumin, 100 µM of each dNTP, 0.8 nM pSJ1(+) and 50 nM of each polymerase. Polymerization reactions were conducted at 50°C for 35 min and the completeness gap-filling was determined using agarose (1%) gel electrophoresis, with ethidium bromide staining and UV visualization. The polymerase reactions products were then used to transform E. coli Top10 for blue/white colony scoring as described above.
 |
RESULTS
|
|---|
Plasmid preparation
The construction of plasmids suitable for measuring DNA polymerase
fidelity begins from pUC18, which contains the
lacZ
gene (
Figure 1).
A unique PstI restriction site, in the middle of
lacZ
is important
for subsequent manipulation. Two rounds of site-directed mutagenesis
are used to generate pSJ1, in which
lacZ
is flanked by restriction
sites for two, related, nicking endonucleases, Nt.Bpu10I and
Nb.Bpu10I. There are no other sites for these enzymes in pSJ1
and, as shown in
Figure 1, Nt.Bpu10I and Nb.Bpu10I are able
to introduce two nicks at the extremities of the coding and
non-coding strands of
lacZ
, respectively. Following treatment
with Nt.Bpu10I or Nb.Bpu10I, we were unable to effectively remove
the nicked single-strands, to produce the required gapped plasmids,
simply by heating, rapid cooling and separation by gel electrophoresis.
As shown in the
Figure 2 (lanes labelled 0 competitor)
this simple procedure resulted in only nicked pSJ1, with the
excised
lacZ
sequences retained by non-covalent Watson–Crick
hydrogen bonding. A subsequent treatment with the PstI restriction
endonuclease resulted in a linear plasmid (
Figure 2). PstI requires
duplex DNA, confirming that the double-nicked single strand
remains associated with the gapped plasmid. Inclusion of a single-stranded
competitor DNA, exactly complementary to the excised strand,
facilitated the production of gapped plasmid. Addition of the
competitor, after reaction with Nt.Bpu10I or Nb.Bpu10I and prior
to commencing the heat–cool cycle, resulted in two species,
the nicked plasmids and, running slightly faster, the desired
gapped plasmids, pSJ1(+) and pSJ1(–) (
Figure 2). As the
amount of competitor increased, more of the required gapped
plasmid was produced; a 5-fold excess appearing optimal. Digestion
with PstI converted any remaining nicked plasmid to the linear
form, but, as expected, the gapped plasmid proved refractory
to such treatment. Moreover, the desired gapped plasmid and
any linear contaminant produced after PstI digestion are well
separated by gel electrophoresis, facilitating purification.
It proved straightforward to produce the required single stranded
competitor by carrying out PCR of
lacZ
with one of the primers
bearing a 5'-phosphate group. A subsequent treatment with

exonuclease
specially degrades the duplex strand that contains the 5'-phosphate,
yielding the competitor (
18).

View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
|
Figure 1. Gapped plasmids for measuring DNA polymerase fidelity. Site-directed mutagenesis is used to flank the lacZ gene in pUC18 with sites for two related nicking endonucleases, Nt and Nb Bpu10I. Cutting the resulting pSJ1 with these nucleases liberates either the coding or non-coding strand to give pSJ1(+) and pSJ1(–). To completely remove the excised strand from the gapped plasmid it is necessary to add competitor DNA, complementary to the excised region. The unique PstI restriction site is important for analysis and purification.
|
|

View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
|
Figure 2. Preparation and purification of pSJ1(+). Gel electrophoretic analysis of pSJ1 following treatment with Nt Bpu10I. In the absence of competitor DNA (lanes marked 0) a nicked plasmid, where the excised strand remains associated with the plasmid by Watson–Crick interactions, is produced. Cutting with PstI gives a linear plasmid as the PstI site remains in a double-stranded region. Adding increasing amounts of competitor (excess over plasmid denoted by x1, x3, x5 and x10) progressively gives more of the desired gapped pSJ1(+) at the expense of the nicked intermediate. Treatment with PstI destroys any remained nicked plasmid but not the gapped pSJ1(+) as, in this case, the PstI site is in a single-stranded DNA region.
|
|
Background mutation rate
Prior to using pSJ1(+/–) to assess polymerase fidelity,
control transformations were carried out to determine background
mutation rate. The parent plasmid, pSJ1, and various elaborations
which included nicked derivatives (cut at a single site upstream
or downstream of
lacZ
or double-cut at both sites) and the gapped
pSJ1(+)/pSJ1(–) were used to transform
E. coli Top10.
As shown in
Table 1, a background mutation rate of about 0.08%
(i.e.

1 in every 1250 colonies was white) was observed in every
case. No significant differences were seen between intact pSJ1
and the nicked and gapped derivatives. The background of

0.08%,
found with the plasmid-based
lacZ
system, is similar to the
control rates of 0.06–0.07% observed with gapped M13 derivatives
(
9,
10). However, certain
E. coli strains, e.g. XL-10, showed
a noticeably higher mutation rate of around 0.5% (data not shown),
for reasons that are as yet unclear.
View this table:
[in this window]
[in a new window]
|
Table 1. Number of colonies observed and mutation rates found in control experiments using pSJ1, pSJ1(+) and pSJ1(–)
|
|
DNA polymerase fidelity assay
Subsequently three DNA polymerases, the family A polymerase
from
Thermus aquaticus (Taq-Pol), phage T4 polymerase (T4-Pol)
and Phusion, a derivative of the family-B DNA polymerase from
Pyrococcus furisosus, (Pfu-Pol) were successfully used to fill
in the gapped substrates, pSJ1(+) and pSJ1(–). In each
case, as assessed by gel electrophoresis (
Figure 3), all three
polymerases filled the 337-nt gap without obvious strand displacement.
Following polymerase-catalysed gap filling, plasmids were mixed
with
E. coli Top10 and transformed cells screened for blue and
white colonies. The results are summarized in
Table 2 which
shows that no differences in fidelity were seen when an individual
polymerase was assayed using either the (+) or the (–)
variants of pSJ1. The accuracy of the polymerases follows the
ranking order, Pfu-Pol > T4-Pol > Taq-Pol. The highest
mutation rate was seen with Taq-Pol and the corrected value
of 0.9% is in excellent agreement with values of between 0.75
and 1.2% found for different batches of this enzyme using the
M13
lacZ
method (
10). The family-A Taq-Pol lacks 3'-5' proof-reading
exonuclease activity, accounting for its relatively low fidelity
(
10). Lower mutation rates were observed with T4-Pol (0.3%)
and Pfu-Pol (0.1%), two family-B DNA polymerases both of which
possess 3'-5' exonuclease activity (
11,
19). Polymerases with
proof-reading activity copy DNA with higher fidelity than enzymes
that lack this function (
20). Many studies have compared the
accuracy of Taq-Pol and Pfu-Pol as both are extensively used
in the polymerase chain reaction, an application for which fidelity
is an important consideration. The general consensus is that
Pfu-Pol has a 10-fold higher fidelity than Taq-Pol (
7), agreeing
with the results in
Table 2.

View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
|
Figure 3. Copying pSJ1(+) with DNA polymerases. A standard is provided by pSJ1, which mainly runs as the supercoiled form (prominent fast migrating band) but with traces of the open-circle form due to the presence on nicks. The starting gapped pSJ1(+) (no polymerase) is also show. Treatment with Taq, Pfu and T4 polymerase results in copying of the single stranded region of pSJ1(+) to give a filled derivative, running, as expected, with mobility identical to the open circle form of pSJ1.
|
|
Mutation spectra by DNA sequencing
The
lacZ
genes of a number of mutant (white) colonies have been
sequenced, to determine the nature of the introduced mutation.
The results are given in
Table 3 and show that, in all the 10
cases examined, mutations in the controls are characterized
by a C

T change in the template strand. It is most likely that
these changes are due to the presence of uracil in the single-stranded
template regions of the gapped plasmids pSJ1(+) and pSJ1(–).
In DNA the deamination of cytosine results in uracil, a thymine
mimic which codes for the incorporation of dAMP in progeny strands,
ultimately resulting in a C

T transition mutation (
21). Such
cryptic damage is also observed using the M13
lacZ
system (
22,
23) and has been ascribed to template damage
during the preparation of the gapped substrates. The gapped
plasmids pSJ1(+/–), used for assessing polymerase fidelity,
are derived from the parental pSJ1 using a number of
in vitro manipulations (
Figure 1). Both pSJ1 and pSJ1(+/–) show
the same background mutation frequency (
Table 1), making it
unlikely that significant additional deamination takes place
during the conversion of pSJ1 to pSJ1(+/–), e.g. during
the treatment with the nicking enzymes Nb.Bpu10I or Nt.Bpu10I.
Rather, uracil appears to be present in pSJ1 itself, arising
either during its purification or from plasmids that either
escaped or were awaiting uracil–DNA–glycosylase
(UDG) initiated base excision DNA repair in
E.coli (
24).The
presence of uracil in pSJ1 limits the sensitivity of the assay
to a mutation rate of around 0.08%.
The changes in the template strand observed when the gapped
pSJ1(+) and pSJ1(–) were filled using three different
polymerases are also summarized in
Table 3. Including controls,
38 of the 40 mutant plasmids sequenced contained only a single
alteration, two having two changes. Similarly, 40 out of 42
mutations resulted from a base substitution, with just two deletions
being seen. With pSJ1(+), Taq-Pol and Pfu-Pol gave a variety
of mutations, although with T4-Pol it is noticeable that all
five changes seen give rise to template strand A

T transitions.
Different results were seen with pSJ1(–); with Taq-Pol
and T4-Pol all the changes are characterized by C

T transitions,
identical to the alterations seen in controls. In the case of
Pfu-Pol a wider range of mutations was observed, which may result
from the inability of archaeal polymerases to replicate beyond
template-strand uracil (
25,
26), suppressing many of the C

T changes.
Determination, by DNA sequencing, of the error spectrum arising
with a particular DNA polymerase gives valuable mechanistic
information, as extensively demonstrated with the M13-phage
lacZ
system (
10,
22,
27). However, to obtain robust data, particularly
with accurate polymerases which give few errors above background,
many sequences need to be determined. In this publication sequencing
was primarily used to confirm that white colonies actually arise
from changes in DNA sequence and so provide assay validation,
rather than to investigate the polymerases
per se. Therefore,
only a relatively small number of white colonies have had their
sequences determined and comments on the polymerase mutation
spectra, e.g. whether the C

T changes seen with Taq-Pol/T4-Pol/pSJ1(–)
are merely fortuitous sampling of background mutations, are
unwarranted at present. All DNA sequences are given in full
in the appendix.
Application of pSJ1
Previously our group showed that mutations to three amino acids that comprise a loop in the fingers sub-domain of Pfu-Pol gave low-fidelity variants, useful in error prone PCR (15). Accuracy was assessed using PCR amplification of lacIOZ
, where errors introduced by the polymerase during the copying of lacI give rise to a defective lac repressor, allowing transcription of the lacZ
gene and the appearance of blue plaques (7,11). Unfortunately, concomitant mistakes in lacZ
itself, resulting in an inactive β-galactosidase, interfere with the assay, although these may be controlled for, providing the number of mistakes is not excessive. Although the fidelity of Pfu-Pol could be determined using lacIOZ
, the higher error rates of the Pfu-Pol loop mutants made this assay inapplicable and their accuracy was assessed directly by sequencing of PCR amplicons. Comparing Pfu-Pol D215A (exo–) (lacIOZ
assay) with one of the loop mutants, Pfu-Pol D473G/D215A exo– (amplicon sequencing), suggested D473G about 14-fold more error prone (15). The use of different assays is unsatisfactory and, therefore, the pSJ1-based method has been used to more rigorously compare the fidelity of two loop mutants, Q472G (exo–) and D473G (exo–), with the exo– parent. Table 2 shows that Pfu-Pol exo– has a mutation rate some 10-fold higher than exo+, in agreement with previous observations (7,15). Changing glutamine 472 or glutamic acid 473 to glycine further increases the mutation rate, by a factor of 1.3 for Q472G and 2.5 for D473G. The pSJ1(+)-based assay shows the difference in fidelity between Pfu-Pol exo– and Pfu-Pol D473G exo– (the mutation rate of Pfu-Pol Q472G exo– was not measured in our earlier publication) to be smaller than previously determined. However, our experience is that D473G exo– is useful in error prone PCR, despite being more accurate than previously suspected.
 |
DISCUSSION
|
|---|
A plasmid-based
lacZ
system for measuring DNA polymerase fidelity
is described. The key steps, used to prepare the desired gapped
duplex, are the use of a nicking endonuclease to specifically
excise one strand and its complete removal using a complementary
oligodeoxynucleotide. Although a plasmid system based on the
Cro gene has previously been reported (
12), the methods described
here to prepare gapped duplex represent a clear advance, with
100% of the product having a single-stranded gapped region.
The approach using pSJ1 is conceptually similar to the well
established method based on gapped M13 (
9), both giving identical
background mutation rates of

0.08%. The fidelities of three
DNA polymerases (Taq, T4 and Pfu) measured using gapped plasmids
were very similar to those found with M13, validating the plasmid-based
approach. The use of plasmids may represent a simpler system
in terms of maintenance and production of reporter DNA, ease
of gapped substrate preparation, transformation of cells, analysis
of cells (relying on colonies rather than plaques) and recovery
of mutated plasmids for DNA sequencing. Further, as plasmids
are compatible with virtually all bacteria and many eukaryotes
such as yeast, gapped derivatives may be useful for
in vivo study of DNA replication and repair, for example using microbes
mutated in repair pathways. Obviously the plasmid system is
not yet as advanced as the long-established approach based on
M13. Thus, although the mutation rates of different polymerases
can be ranked, based on the ratio of blue/white colonies, it
is not yet possible to determine error frequency, i.e. the mistakes
made per nucleotide incorporated by the polymerase. The error
frequency can be determined using the following equation (
9,
10):
Where mf = mutant fraction
determined by DNA sequencing, Mr
0 and Mr
b are the mutation rates
observed after polymerase-catalysed replication and background,
respectively,
fo = frequency of expression of newly synthesized
strand,
Nd = number of nucleotides within the gapped region
known to yield a mutant phenotype. The latter two terms have
yet to be evaluated for the plasmid-based system described here.
Nevertheless the usefulness and applicability of the pSJ1 system
has been established by the experiments with error prone Pfu-Pol
loop mutants. Perhaps the most pressing problem, common to both
plasmids and M13, is the spontaneous mutation rate of around
0.08%. This is higher than the error rate of many polymerases
and makes several important applications, e.g. comparing the
fidelities of thermostable polymerases used in the PCR, difficult.
With the plasmid system most, if not all, of the background
seems to arise from cytosine deamination to uracil, and is already
fully present in the parent pSJ1. Lower backgrounds may be achieved
using
E. coli strains that overexpress UDG (reducing
in vivo levels of uracil) or treating pSJ1 with UDG
in vitro, to degrade
damaged plasmids. Treatment with repair enzymes has been reported
to be beneficial with the
Cro plasmid system (
12).
 |
FUNDING
|
|---|
The UK BBSRC (Project grant BB/F00687X/1); and the European
Union (Marie Curie Research Training Network QLK3-CT-2001-00448).
Funding for open access charge: UK BBSRC (Project grant BB/F00687X/1).
Conflict of interest statement. None declared.
 |
ACKNOWLEDGEMENTS
|
|---|
The authors thank Pauline Heslop for technical assistance.
 |
REFERENCES
|
|---|
- Garcia-Diaz M, Bebenek K. Multiple functions of DNA polymerases. Crit. Rev. Plant Sci. (2007) 26:105–122.[CrossRef][Medline]
- Hübscher U, Nasheuer H.-P, Syväoja JE. Eukaryotic DNA polymerases, a growing family. Trends Biochem. Sci. (2000) 25:143–147.[CrossRef][Web of Science][Medline]
- Garg P, Burgers P.MJ. DNA polymerases that propagate the eukaryotic DNA replication fork. Crit. Rev. Biochem. Mol. Biol. (2005) 40:115–128.[CrossRef]
- Prakash S, Johnson RE, Prakash L. Eukaryotic translesion synthesis DNA polymerases: specificity of structure and function. Annu. Rev. Biochem. (2005) 74:317–353.[CrossRef][Web of Science][Medline]
- Hamilton SC, Farchaus JW, Davis MC. DNA polymerases as engines for biotechnology. Biotechniques (2001) 31:370–376.[Web of Science][Medline]
- Pavlov AR, Pavlova NV, Kozyavkin SA, Slesarev AI. Recent developments in the optimization of thermostable DNA polymerases for efficient applications. Trends Biotechnol. (2004) 22:253–260.[CrossRef][Web of Science][Medline]
- Cline J, Braman JC, Hogrefe HH. PCR fidelity of Pfu DNA polymerase and other thermostable DNA polymerases. Nucleic Acids Res. (1996) 24:3546–3551.[Abstract/Free Full Text]
- McCulloch SD, Kunkel TA. The fidelity of DNA synthesis by eukaryotic replicative and translesion synthesis polymerases. Cell Res. (2008) 18:148–161.[CrossRef][Web of Science][Medline]
- Bebenek K, Kunkel TA. Analyzing fidelity of DNA polymerases. Methods Enzymol. (1995) 262:217–232.[Web of Science][Medline]
- Tindall KR, Kunkel TA. Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase. Biochemistry (1998) 27:6008–6013.[CrossRef]
- Lundberg KS, Shoemaker DD, Adams M.WW, Short M, Sorge JA, Mathur EJ. High-fidelity amplification using a thermostable DNA polymerase isolated form Pyrococcus furiosus. Gene (1991) 108:1–6.[CrossRef][Web of Science][Medline]
- Maor-Shoshani A, Reuven NB, Tomer G, Livneh Z. Highly mutagenic replication by DNA polymerase V (UmuC) provides a mechanistic basis for SOS untargeted mutagenesis. Proc. Natl Acad. Sci. USA (2000) 97:565–570.[Abstract/Free Full Text]
- Eckert KA, Mowery A, Hills SE. Misalignment-mediated DNA polymerase β mutations: comparison of microsatellite and frame-shift error rates using a forward mutation assay. Biochemistry (2002) 41:10490–10498.[CrossRef][Web of Science][Medline]
- Fujii S, Akiyama M, Aoki K, Sugaya Y, Higuchi K, Hiraoka M, Miki Y, Saitoh N, Yoshiyama K, Ihara K, et al. DNA replication errors produced by the replicative apparatus of Eschericia coli. J. Mol. Biol. (1999) 289:835–850.[CrossRef][Web of Science][Medline]
- Biles BD, Connolly BA. Low fidelity Pyrococcus furious DNA polymerase mutants useful in error-prone PCR. Nuleic Acids Res. (2004) 32:e176.[Abstract/Free Full Text]
- Evans SJ, Fogg MJ, Mamone A, Davis M, Pearl LH, Connolly BA. Improving dideoxynucleotide-triphosphate incorporation by the hyper-thermophilic DNA polymerase from the hyperthermophilic archaeon Pyrococcus furiosus. Nucleic Acids Res. (2000) 28:1059–1066.[Abstract/Free Full Text]
- Zheng L, Baumann U, Reymond JL. An efficient one-step site directed and site-saturation mutagenesis protocol. Nucleic Acids Res. (2004) 32:e115.[Abstract/Free Full Text]
- Thomas E, Pingoud A, Friedhoff P. An efficient method for the preparation of long heteroduplex DNA as substrate for mismatch repair by the Escherichia coli MutHLS system. Biol. Chem. (2002) 383:1459–1462.[CrossRef][Web of Science][Medline]
- Karam JD, Konigsberg WH. DNA polymerase of the T4-related bacteriophages. Prog Nucleic Acids Res. Mol. Biol. (2000) 64:65–96.[Web of Science][Medline]
- Kunkel TA. DNA replication fidelity. J. Biol. Chem. (1992) 267:18251–18254.[Free Full Text]
- Lindahl T. Instability and decay of the primary structure of DNA. Nature (1993) 362:709–715.[CrossRef][Medline]
- Kunkel TA, Alexander PS. The base substitution fidelity of eukaryotic DNA polymerases. J. Biol. Chem. (1986) 261:160–166.[Abstract/Free Full Text]
- Shcherbakova PV, Pavlov YI, Chilkova O, Rogozin IB, Johansson E, Kunkel TA. Unique error signature of the four-subunit yeast DNA polymerase epsilon. J. Biol. Chem. (2003) 278:43770–43780.[Abstract/Free Full Text]
- Krokan HE, Standhal R, Slipphaug G. DNA glycosylases in the base excision repair of DNA. Biochem. J. (1997) 325:1–16.[Web of Science][Medline]
- Greagg MA, Fogg MJ, Panayotou G, Evans SJ, Connolly BA, Pearl LH. A read-ahead function in archaeal family B DNA polymerases detects pro-mutagenic template-strand uracil. Proc. Natl Acad. Sci. USA (1999) 96:9045–9050.[Abstract/Free Full Text]
- Firbank SJ, Wardle J, Heslop P, Lewis RJ, Connolly BA. Uracil recognition in archaeal DNA polymerases captured by X-ray crystallography. J. Mol. Biol. (2008) 381:529–539.[CrossRef][Web of Science][Medline]
- Fortune JM, Pavlov YI, Welch CM, Johansson E, Burgers PM, Kunkel TA. Saccharomyces cerevisiae DNA polymerase delta:high fidelity for base substitutions but lower fidelity for single and multi-base deletions. J. Biol. Chem. (2005) 280:29980–29987.[Abstract/Free Full Text]

CiteULike
Connotea
Del.icio.us What's this?