Skip Navigation


Nucleic Acids Research Advance Access first published online on September 25, 2007
This version published online on October 3, 2007

Nucleic Acids Research, doi:10.1093/nar/gkm706
This Article
Right arrow Abstract Freely available
Right arrow Print PDF (4994K) Freely available
Right arrow Screen PDF (1226K) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
35/19/6517    most recent
gkm706v2
gkm706v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Phan, A. T.
Right arrow Articles by Patel, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Phan, A. T.
Right arrow Articles by Patel, D. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2007 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.


Structural Biology

Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution{dagger}

Anh Tuân Phan1,2,*, Vitaly Kuryavyi1, Kim Ngoc Luu1 and Dinshaw J. Patel1

1Structural Biology Program, Memorial Sloan-Kettering Cancer Center, New York, NY 10021, USA and 2Division of Physics and Applied Physics, School of Physical and Mathematical Sciences, Nanyang Technological University, Singapore 637551, Singapore

*To whom correspondence should be addressed. Tel: +65 6514 1915; Fax: +65 6794 1325; Email: phantuan{at}ntu.edu.sg Correspondence may also be addressed to Dinshaw J. Patel. Tel: + 1 212 639 7207; Fax: + 1 212 717 3066; Email: pateld{at}mskcc.org The authors wish to be known that, in their opinion, the first two authors should be regarded as joint First Authors.

Received July 7, 2007. Revised August 24, 2007. Accepted August 24, 2007.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 CONCLUSION
 NOTE
 SUPPLEMENTARY DATA
 REFERENCES
 
Intramolecular G-quadruplexes formed by human telomere sequences are attractive anticancer targets. Recently, four-repeat human telomere sequences have been shown to form two different intramolecular (3 + 1) G-quadruplexes in K+ solution (Form 1 and Form 2). Here we report on the solution structures of both Form 1 and Form 2 adopted by natural human telomere sequences. Both structures contain the (3 + 1) G-tetrad core with one double-chain-reversal and two edgewise loops, but differ in the successive order of loop arrangements within the G-quadruplex scaffold. Our results provide the structural details at the two ends of the G-tetrad core in the context of natural sequences and information on different loop conformations. This structural information might be important for our understanding of telomere G-quadruplex structures and for anticancer drug design targeted to such scaffolds.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 CONCLUSION
 NOTE
 SUPPLEMENTARY DATA
 REFERENCES
 
Guanine-rich DNA sequences can form G-quadruplex structures in vitro through stacking of planar G·G·G·G tetrads (1–5). DNA at the ends (telomeres) of eukaryotic chromosomes consists of tandem repeats of G-rich sequences, such as (GGGTTA)n in humans (6). The in vitro (7,8) and in vivo (9–11) observations of G-quadruplex formation in telomeric sequences and telomeres, respectively, show the biological importance of this DNA scaffold. G-quadruplexes formed by human telomere sequences are promising anticancer targets (12–16), because formation of such structures inhibits the activity of telomerase (17–19), an enzyme (20) that is required for the proliferation of 80%–85% of cancer cells (21).

In 1993, our group characterized the first NMR-based solution structure of a four-repeat human telomere sequence, d[AGGG(TTAGGG)3] in Na+ solution (7). This sequence forms an intramolecular G-quadruplex involving three stacked G-tetrads with anti·anti·syn·syn glycosidic conformations around each tetrad. Three connecting TTA loops adopt successive edgewise, diagonal and edgewise alignments, such that each strand has both parallel and antiparallel adjacent strands (Figure 1A). In 2002, a very different G-quadruplex structure of the same sequence was observed in a K+-containing crystal by the Stephen Neidle group (8). In this structure, all four strands are parallel, the connecting TTA loops are double-chain-reversal, and all guanines adopt anti glycosidic conformations (Figure 1B). Subsequent studies from many laboratories indicated the presence of a mixture of multiple G-quadruplex forms for human telomere sequences in physiological K+ solution conditions (22–40).


Figure 1
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Schematic structures of intramolecular G-quadruplexes formed by the human telomeric sequences: (A) d[AGGG(TTAGGG)3] in Na+ solution; (B) d[AGGG(TTAGGG)3] in a K+-containing crystal; (C) d[TAGGG(TTAGGG)3] in K+ solution (natural-Form 1) and (D) d[TAGGG(TTAGGG)3TT] in K+ solution (natural-Form 2). Loops are colored red; anti and syn guanines are colored cyan and magenta, respectively. W, M and N denote wide, medium and narrow groove, respectively.

 
In 2005, our group showed that three-repeat human telomere sequences form a bimolecular (3 + 1) quadruplex in Na+ solution, whose core contains three strands oriented in one direction and the fourth in the opposite direction (41). This type of (3 + 1) G-quadruplex core was first reported by our group in 1994 for a Tetrahymena telomere G-quadruplex (42). In 2006, our group showed that four-repeat human telomere sequences form at least two intramolecular G-quadruplexes of the (3 + 1)-type (Form 1 and Form 2) in K+ solution (43,44). Form 1 (Figure 1C) and Form 2 (Figure 1D) are the major conformations (~70%) of the natural human telomere 23-nt d[TAGGG(TTAGGG)3] and 25-nt d[TAGGG(TTA GGG)3TT] sequences in K+ solution, respectively (43,44). Both forms contain one double-chain-reversal and two edgewise loops, but they differ in the successive order of loop arrangements: the double-chain-reversal loop is formed by the third TTA linker in Form 2 (Figure 1D) instead of the first TTA linker in Form 1 (Figure 1C). Formation of Form 1 human telomere quadruplex was independently proposed by two other research groups using end-modified (45) and multiple 8-bromoguanine-substituted (46) sequences, respectively. It appeared that some modifications at terminal residues favor certain loop conformations of the quadruplex due to their interaction with the loop residues (43–45), while multiple guanine-to-8-bromoguanine (G -> BrG) substitutions would favor a quadruplex form, in which the substituted guanines are forced to adopt syn conformations (46–48).

By slightly modifying some flanking terminal residues, we could favor Form 1 (to ~95%) and determine its solution structure (43). Although this structure provided the first approximation to the 3D structure of an intramolecular human telomere G-quadruplex in K+ solution (49), some structural information could be altered by incorporated modified bases at the ends of the molecule (43). Very recently, structures of Form 1 were also reported by Dai et al. (50) for a different end-modified sequence and by Matsugami et al. (51) for a sequence containing five BrG substitutions.

Here we report on the NMR-based solution structures of both Form 1 and Form 2 quadruplexes adopted by natural human telomere sequences. The structure determination was assisted by the study of sequences each containing judiciously chosen single BrG substitution (see below). Our results provide the structural details at the two ends of the G-tetrad core in the context of natural sequences and information on the range of conformations accessible to the TAA loops. This structural information might be important for the design of anticancer drugs targeted to human telomeric DNA.


    METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 CONCLUSION
 NOTE
 SUPPLEMENTARY DATA
 REFERENCES
 
Sample preparation
The unlabeled and the site-specific low-enrichment (2% 15N-labeled) oligonucleotides were synthesized and purified as described previously (52,53). Unless otherwise stated, the strand concentration of the NMR samples was typically 0.5–5 mM; the solutions contained 70 mM of KCl and 20 mM of potassium phosphate (pH 7). Sequences used in this work are shown below:
Name Sequence
Natural-Form 1 d[TAGGGTTAGGGTTAGGGTTAGGG]
BrG16-Form 1 d[TAGGGTTAGGGTTAG(BrG)GTTAGGG]
Natural-Form 2 d[TAGGGTTAGGGTTAGGGTTAGGGTT]
BrG15-Form 2 d[TAGGGTTAGGGTTA(BrG)GGTTAGGGTT]
Two forms d[TAGGGTTAGGGTTAGGGTTAGGGT]

NMR spectroscopy
Experiments were performed on 600 MHz spectrometers at 25°C, unless otherwise specified. Resonances for G residues were assigned unambiguously by using site-specific low-enrichment labeling and through-bond correlations at natural abundance (52–55). Resonances for T residues were assigned following systematic T-to-U replacements. Assignments of resonances for A residues were obtained from NOE connectivities with neighboring T and G residues in the fold. NMR spectral assignments were completed by through-bond (COSY, TOCSY) and through-space (NOESY) correlation experiments as described previously (54). Interproton distances were measured by using NOESY experiments at different mixing times.

Structure calculation
The structures of Form 1 and Form 2 human telomere quadruplexes were calculated using the X-PLOR program (56). NMR-restrained molecular dynamics computations were performed as described previously (43). The structures were first calculated for BrG-substituted sequences. Inclusion of K+ ions within the top and bottom caps of Form 2 (57) resulted in well-converged structures, which are consistent with experimental data. The ensembles of structures for natural sequences were computed from those for BrG-substituted sequences by refining them against the experimental restraints obtained for natural sequences.

Data deposition
The coordinates for four quadruplex structures formed by the 23-nt and 25-nt natural and BrG-substituted human telomere sequences have been deposited in the Protein Data Bank (accession codes natural-Form 1: 2JSM; BrG16-Form 1: 2JSK; natural-Form 2: 2JSL; BrG15-Form 2: 2JSQ).


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 CONCLUSION
 NOTE
 SUPPLEMENTARY DATA
 REFERENCES
 
Effects of DNA sequences on relative quadruplex populations and quality of NMR spectra
Previously, we systematically examined human telomere sequences containing four G-tracts and showed that small changes to flanking sequences can perturb the equilibrium between different coexisting G-quadruplex forms (44). In K+ solution, d[TAGGG(TTAGGG)3] (a natural human telomere sequence) forms up to 70% of Form 1 (43), while d[TAGGG(TTAGGG)3TT] (also a natural human telomere sequence) with two Ts at 3'-end forms up to 70% of Form 2 (44). Here we will call these sequences natural-Form 1 and natural-Form 2, respectively. It should be noted that two G-quadruplex conformers coexist in slow exchange at comparable proportions in d[TAGGG(TTA GGG)3T] (another natural human telomere sequence) having one T at 3'-end (Figure S1, Supplementary Data).

Substitution of proton by bromine at position C8 of a guanine has been shown to favor syn glycosidic conformation of the nucleotide (47). When all five guanines that adopted syn conformations in Form 1 were substituted by 8-bromoguanines, Form 1 predominated (46,51). However, each G-to-BrG substitution removes a proton (useful in NMR studies). For the natural-Form 1 and natural-Form 2 sequences, we could identify single G-to-BrG substitutions (at position G16 and G15, respectively) that further favored the corresponding major form, thereby significantly improving NMR spectra (Figure 2). They will be called BrG16-Form 1 and BrG15-Form 2, respectively.


Figure 2
View larger version (13K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Imino proton spectra of (A) d[TAGGG(TTAGGG)3] (natural-Form 1), (B) BrG16-Form 1, (C) d[TAGGG(TTAGGG)3TT] (natural-Form 2) and (D) BrG15-Form 2, in K+ solution with assignments listed over the spectra.

 
NMR spectral assignments
We have previously unambiguously assigned imino and H8 protons of guanines in natural sequences (43,44). Corresponding assignments for single BrG-substituted sequences could be obtained by comparing spectral patterns of the modified and natural sequences (Figures 2 and 3). These assignments were also independently confirmed by some low-enrichment site-specific labeling and natural abundance through-bond correlation experiments (Figure 4) (52–55). Assignments of resonances for T residues were obtained from T-to-U substitution samples (54). NMR spectral assignments were completed by through-bond (COSY, TOCSY) and through-space (NOESY) correlation experiments as described previously (54).


Figure 3
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. The H8/6-H1' proton region of NOESY spectra (mixing time, 300 ms) of (A) d[TAGGG(TTAGGG)3] (natural-Form 1), (B) BrG16-Form 1, (C) d[TAGGG(TTAGGG)3TT] (natural-Form 2) and (D) BrG15-Form 2 in K+ solution. The assignments and H8/6-H1' NOE sequential connectivities are shown.

 

Figure 4
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Imino proton spectra and assignments of (A and B) the BrG16-Form 1 and (D and E) BrG15-Form 2 human telomere sequences in K+ solution. (A and D) Reference guanine imino proton spectra (reference) and some examples of imino protons assignments by 15N-filtered spectra recorded for samples, 2% 15N-labeled at the indicated positions. (B and E) Imino proton spectra after 1 h in D2O at 25°C. (C and F) H8 proton assignments of (C) the BrG16-Form 1 and (F) BrG15-Form 2 human telomere sequences by through-bond correlations between imino and H8 protons via 13C5 at natural abundance.

 
We first assigned most peaks in NOESY spectra of BrG-substituted sequences. These NOE assignments helped us to assign NOEs for the natural sequences, which would have been very difficult to complete due to the presence of a significant amount of minor conformation(s).

Analysis of NOE patterns (Figure 3) suggested that the major forms of BrG-substituted sequences and those of the corresponding natural sequences are of the same general folds (Figure 1). The Form 1 and Form 2 folds for BrG-substituted sequences were supported by proton exchange data, which showed that imino protons of the central G-tetrad are the most protected from exchange with water (Figure 4).

Overall solution structure
The structures of Form 1 (Figures 5, 6 and S2, Table 1) and Form 2 (Figures 7, 8 and S3, Table 2) human telomere quadruplexes adopted by BrG-substituted and natural sequences were calculated on the basis of NMR restraints using the X-PLOR program (56). In all cases, the structure of the G-tetrad cores is better defined than that of the loops (Figures 5 and 7). The structures formed by the BrG-substituted and the corresponding natural sequences are quite similar. However, the structures calculated for the BrG-substituted sequences (Figures 5A and 7A) are slightly better defined than those calculated for the natural sequences (Figures 5C and 7C) thanks to larger numbers of defined NOE peaks associated with cleaner NMR spectra.


Figure 5
View larger version (45K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. Stereo views of Form 1 structure. (A) Ten superpositioned refined structures of BrG16-Form 1. (B) Ribbon view of a representative structure. (C) Ten superpositioned refined structures of natural-Form 1. Anti and syn guanines are colored cyan and magenta, respectively; in (A) and (C), adenines are colored green; thymines, orange; backbone, gray; O4' atoms, red; phosphorus atoms, yellow. In (B), O4' atoms are colored yellow.

 

Figure 6
View larger version (47K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6. Detailed loop structure of BrG16-Form 1 (A) 5'-end top cap (side view). (B) Double-chain-reversal loop (C) 3'-end bottom cap (side view). (D) 5'-end top cap (top view). (E) 3'-end bottom cap (bottom view). Color coded as in Figure 5A.

 

Figure 7
View larger version (56K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 7. Stereo views of Form 2 structure. (A) Ten superpositioned refined structures of BrG15-Form 2. (B) Ribbon view of a representative structure. (C) Ten superpositioned refined structures of natural-Form 2. Color coded as in Figure 5A.

 

Figure 8
View larger version (55K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 8. Detailed loop structure of BrG15-Form 2 (A) 5'-end top cap (side view). (B) Double-chain-reversal loop (C) 3'-end bottom cap (side view); (D) 5'-end top cap (top view); (E) 3'-end bottom cap (bottom view). Color coded as in Figure 5A.

 

View this table:
[in this window]
[in a new window]

 
Table 1. Statistics of the computed structures of Form 1

 

View this table:
[in this window]
[in a new window]

 
Table 2. Statistics of the computed structures of Form 2

 
Both Form 1 and Form 2 contain the (3 + 1) G-quadruplex core, which is identified by one narrow, one wide and two medium grooves (Figure 1C and D) (41–43). The groove widths are defined mainly by the relative orientations of strands, but are also somewhat affected by the structures of the closing loops. For example, the narrow groove seems narrower in Form 2 than in Form 1 (Figures 5B and 7B, respectively). These grooves could serve as potential targets for small-molecule ligands.

Structure of loops and caps
In both Form 1 and Form 2, there are one double-chain-reversal and two edgewise TTA loops. The double-chain-reversal loop is situated in a medium groove. The edgewise loops always connect an anti guanine to a syn guanine, across narrow or wide grooves; they cap the top and the bottom of the G-tetrad core, respectively (Figure 1). The detailed structures of these elements in Form 1 and Form 2 are shown in Figures 6 and 8, respectively. Figures S2 and S3 show the distribution of sequential and long-range NOEs used to derive the loop structures in these forms.

In Form 1, the T18–T19–A20 loop (Figure 6A) closes a narrow groove and caps the top of the G-tetrad core. Residue A20 from this loop is aligned with residues T1 and A2 from the 5'-end to form the (T1–A2) · A20 triad platform (Figure 6A and D). Residue T19 is stacked on top of this platform, while T18 is projected aside. An adenine triple was observed by Dai et al. (50) in the top cap of Form 1 for an end-modified sequence, in which the natural residue T1 was replaced by an A. This base triple involved adenines which are equivalent to A2, A8 and A20 in our sequence. Such an adenine triple does not form in our structure of the natural human telomere sequence. The T12–T13–A14 loop (Figure 6C) closes a wide groove and caps the bottom of the G-tetrad core. Hoogsteen base pair A14–T12 was observed among computed structures and stacks over the terminal G-tetrad (Figures 5 and 6C). This configuration of the bottom loop is clearly different from that observed for Form 1 with modified bases at the 3'-end (43,50). The structure of the T6–T7–A8 double-chain-reversal loop shows the stacking between T7 and A8 (Figure 6B). We observe differences in the conformations of both edgewise TTA loops between our Form 1 solution structure (Figures 6A and C) and the corresponding solution structure reported by Matsugami et al. (51). In our case, there is much greater stacking of the loop residues over the terminal G-tetrads.

In Form 2, the T12–T13–A14 loop (Figure 8A) closes a narrow groove and caps the top of the G-tetrad core. The residues in this loop interact intimately with the 5'-end residues T1–A2 (Figure 8A and D). NOEs detected within this region are consistent with a structure where T1, T12 and A14 residues, together with the carbonyl groups of the top G-tetrad, can potentially coordinate a K+ ion within the loop (Figure S4). This structure would explain the upfield chemical shifts of many protons of T1 (Figure 3 and Table S2). However, other structures might also be possible for this region, as manifested by the broadening of some resonances at 25°C (44). For example, in some stages of computation we observed the interaction of A20 from the double-chain-reversal loop with residues in the top cap. The structure of the T18–T19–A20 double-chain-reversal loop shows some stacking between T18 and T19 bases (Figure 8B). The T6–T7–A8 loop (Figure 8C) closes a wide groove and caps the bottom of the G-tetrad core. Residues T7 and A8 interact with T24 from the 3'-end to form a (T7–A8) · T24 triad platform. Residue T25 is stacked below this platform. The configuration of the bottom cap in Form 2 involving the interaction between the loop and the 3'-end residues is quite different from that observed in Form 1 [see above and Refs. (43,50,51)]. A K+ ion can also be potentially coordinated between the bottom G-tetrad and the cap (Figure S4).

In general, K+ can be coordinated within all edgewise loops presented here, and the equilibrium between base pairings and K+ coordination is probably the best description of their structure in solution. These observations reinforce a previous proposal by our group of K+ cation coordination within edgewise loops in G-quadruplexes (57).

Structure of TTA loops in telomere quadruplexes
Four-repeat human telomere sequences can form at least two different intramolecular (3 + 1) G-quadruplexes in K+ solution. These structures can coexist and be in dynamic equilibrium with other G-quadruplex forms. Such an equilibrium between conformers is reminiscent of what was reported previously by our group for two-repeat human telomere (22) and two-repeat Tetrahymena telomere (53) G-quadruplexes in solution. As all possible human telomere G-quadruplexes might contain TTA loops, it is important to gather structural patterns of different TTA loop conformations. We have obtained from this work several different configurations of TTA loops in the context of G-quadruplexes formed by natural sequences. Generally, the bases of edgewise loops tend to maximize pairing by forming non-canonical pairs, triples and triads, which in turn stack over the terminal G-tetrads. In favorable cases, edgewise loop residues could also align to potentially coordinate a K+ cation, embedded within the loop turn. A range of topologies have been observed for TTA double-chain-reversal loops, with a common theme that two out of the three bases generally tend to stack on each other. Note that even though the present structures were solved for natural human telomere sequences, sequence extension towards either 5'- or 3'-ends can affect the structure of the loops and caps (44). It should also be noted that the presence of a ligand may push the equilibrium towards one particular structure, which may or may not be represented by the free native sequence (58).


    CONCLUSION
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 CONCLUSION
 NOTE
 SUPPLEMENTARY DATA
 REFERENCES
 
We have determined the structures of Form 1 and Form 2 intramolecular (3 + 1) G-quadruplexes adopted by natural human telomere sequences in K+ solution in the presence of up to 30% of minor conformations. Both structures contain the (3 + 1) G-tetrad core with one double-chain-reversal and two edgewise loops, but differ in the successive order of loop appearance within the G-quadruplex scaffold. Our results provide the structural details at the two ends of the G-tetrad core in the context of natural sequences and context-dependent information on edgewise and double-chain-reversal loop conformations. Comparison between different TTA loop conformations has revealed structural patterns, which are likely to recur within the family of G-quadruplex structures adopted by human telomere sequences.


    NOTE
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 CONCLUSION
 NOTE
 SUPPLEMENTARY DATA
 REFERENCES
 
A paper on the NMR-based solution structure of Form 2 human telomere G-quadruplex for the sequence d[TTAGGGTTAGGGTTAGGGTTAGGGTT] appeared online (coordinates are currently on hold) during the review of our paper. This sequence contains an additional T at the 5'-end compared to our Form 2 sequence (Dai,J., Carver,M., Punchihewa,C., Jones,R.A. and Yang,D. (2007) Structure of the hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence. Nucleic Acids Res. online).


    SUPPLEMENTARY DATA
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 CONCLUSION
 NOTE
 SUPPLEMENTARY DATA
 REFERENCES
 
Supplementary Data are available at NAR Online.


    ACKNOWLEDGEMENTS
 
This research was supported by US National Institutes of Health Grant GM34504 to D.J.P. and Singapore Ministry of Education Grants SUG05/06 and RG138/06 to A.T.P. D.J.P. is a member of the New York Structural Biology Center supported by US National Institutes of Health Grant GM66354. Funding to pay the Open Access publication charges for this article was provided by US National Institutes of Health Grant GM34504.

Conflict of interest statement. None declared.


    Footnotes
 
{dagger} Much of this work was presented at the First International Quadruplex DNA Meeting, Louisville, KY, USA; April 2007. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 METHODS
 RESULTS AND DISCUSSION
 CONCLUSION
 NOTE
 SUPPLEMENTARY DATA
 REFERENCES
 

  1. Gellert MN, Lipsett MN, Davies DR. Helix formation by guanylic acid. Proc. Natl Acad. Sci. USA (1962) 48:2013–2018.[Free Full Text]

  2. Simonsson T. G-quadruplex DNA structures–variations on a theme. Biol. Chem. (2001) 382:621–628.[CrossRef][Web of Science][Medline]

  3. Davis JT. G-quartets 40 years later: from 5'-GMP to molecular biology and supramolecular chemistry. Angew. Chem. Int. Ed. Engl. (2004) 43:668–698.[CrossRef]

  4. Phan AT, Kuryavyi V, Patel DJ. DNA architecture: from G to Z. Curr. Opin. Struct. Biol. (2006) 16:288–298.[CrossRef][Web of Science][Medline]

  5. Burge S, Parkinson GN, Hazel P, Todd AK, Neidle S. Quadruplex DNA: sequence, topology and structure. Nucleic Acids Res. (2006) 34:5402–5415.[Abstract/Free Full Text]

  6. Moyzis RK, Buckingham JM, Cram LS, Dani M, Deaven LL, Jones MD, Meyne J, Ratliff RL, Wu JR. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc. Natl Acad. Sci. USA (1988) 85:6622–6626.[Abstract/Free Full Text]

  7. Wang Y, Patel DJ. Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex. Structure (1993) 1:263–282.[Medline]

  8. Parkinson GN, Lee M.PH, Neidle S. Crystal structure of parallel quadruplexes from human telomeric DNA. Nature (2002) 417:876–880.[CrossRef][Medline]

  9. Schaffitzel DL, Berger I, Postberg J, Hanes J, Lipps HJ, Plucthun A. In vitro generated antibodies specific for telomeric guanine-quadruplex DNA react with Stylonychia lemnae macronuclei. Proc. Natl Acad. Sci. USA (2001) 98:8572–8577.[Abstract/Free Full Text]

  10. Paeschke K, Simonsson T, Postberg J, Rhodes D, Lipps HJ. Telomere end-binding proteins control the formation of G-quadruplex DNA structures in vivo. Nat. Struct. Mol. Biol. (2005) 12:847–854.[CrossRef][Web of Science][Medline]

  11. Maizels N. Dynamic roles for G4 DNA in the biology of eukaryotic cells. Nat. Struct. Mol. Biol. (2006) 13:1055–1059.[CrossRef][Web of Science][Medline]

  12. Neidle S, Parkinson G. Telomere maintenance as a target for anticancer drug discovery. Nat. Rev. Drug Discov. (2002) 1:383–393.[CrossRef][Web of Science][Medline]

  13. Hurley LH. DNA and its associated processes as targets for cancer therapy. Nat. Rev. Cancer (2002) 2:188–200.[CrossRef][Web of Science][Medline]

  14. Mergny JL, Riou JF, Mailliet P, Teulade-Fichou MP, Gilson E. Natural and pharmacological regulation of telomerase. Nucleic Acids Res. (2002) 30:839–865.[Abstract/Free Full Text]

  15. Chang CC, Kuo IC, Ling IF, Chen CT, Chen HC, Lou PJ, Lin JJ, Chang TC. Detection of quadruplex DNA structures in human telomeres by a fluorescent carbazole derivative. Anal. Chem. (2004) 76:4490–4494.[Medline]

  16. Gomez D, O'Donohue MF, Wenner T, Douarre C, Macadre J, Koebel P, Giraud-Panis MJ, Kaplan H, Kolkes A, et al. The G-quadruplex ligand telomestatin inhibits POT1 binding to telomeric sequences in vitro and induces GFP-POT1 dissociation from telomeres in human cells. Cancer Res. (2006) 66:6908–6912.[Abstract/Free Full Text]

  17. Zahler AM, Williamson JR, Cech TR, Prescott DM. Inhibition of telomerase by G-quartet DNA structures. Nature (1991) 350:718–720.[CrossRef][Medline]

  18. Zaug AJ, Podell ER, Cech TR. Human POT1 disrupts telomeric G-quadruplexes allowing telomerase extension in vitro. Proc. Natl Acad. Sci. USA (2005) 102:10864–10869.[Abstract/Free Full Text]

  19. Oganesian L, Moon IK, Bryan TM, Jarstfer MB. Extension of G-quadruplex DNA by ciliate telomerase. EMBO J. (2006) 25:1148–1159.[CrossRef][Web of Science][Medline]

  20. Greider CW, Blackburn EH. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell (1985) 43:405–413.[CrossRef][Web of Science][Medline]

  21. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL, Coviello GM, Wright WE, Weinrich SL, et al. Specific association of human telomerase activity with immortal cells and cancer. Science (1994) 266:2011–2015.[Abstract/Free Full Text]

  22. Phan AT, Patel DJ. Two-repeat human telomeric d(TAGGGTTAGGGT) sequence forms interconverting parallel and antiparallel G-quadruplexes in solution: distinct topologies, thermodynamic properties, and folding/unfolding kinetics. J. Am. Chem. Soc. (2003) 125:15021–15027.[CrossRef][Web of Science][Medline]

  23. Ying L, Green JJ, Li H, Klenerman D, Balasubramanian S. Studies on the structure and dynamics of the human telomeric G-quadruplex by single-molecule fluorescence resonance energy transfer. Proc. Natl Acad. Sci. USA (2003) 100:14629–14634.[Abstract/Free Full Text]

  24. Redon S, Bombard S, Elizondo-Riojas MA, Chottard JC. Platinum cross-linking of adenines and guanines on the quadruplex structures of the AG3(T2AG3)3 and (T2AG3)4 human telomere sequences in Na+ and K+ solutions. Nucleic Acids Res. (2003) 31:1605–1613.[Abstract/Free Full Text]

  25. He Y, Neumann RD, Panyutin IG. Intramolecular quadruplex conformation of human telomeric DNA assessed with 125I-radioprobing. Nucleic Acids Res. (2004) 32:5359–5367.[Abstract/Free Full Text]

  26. Xu Y, Sugiyama H. Highly efficient photochemical 2'-deoxyribonolactone formation at the diagonal loop of a 5-iodouracil-containing antiparallel G-quartet. J. Am. Chem. Soc. (2004) 126:6274–6279.[CrossRef][Web of Science][Medline]

  27. D’Isa G, Galeone A, Oliviero G, Piccialli G, Varra M, Mayol L. Effect of gamma-hydroxypropano deoxyguanosine, the major acrolein-derived adduct, on monomolecular quadruplex structure of telomeric repeat d(TTAGGG)4. Bioorg. Med. Chem. Lett. (2004) 14:5417–5421.[CrossRef][Medline]

  28. Hazel P, Huppert J, Balasubramanian S, Neidle S. Loop-length-dependent folding of G-quadruplexes. J. Am. Chem. Soc. (2004) 126:16405–16415.[CrossRef][Web of Science][Medline]

  29. Risitano A, Fox KR. Inosine substitutions demonstrate that intramolecular DNA quadruplexes adopt different conformations in the presence of sodium and potassium. Bioorg. Med. Chem. Lett. (2005) 15:2047–2050.[CrossRef][Medline]

  30. Rezler EM, Seenisamy J, Bashyam S, Kim MY, White E, Wilson WD, Hurley LH. Telomestatin and diseleno sapphyrin bind selectively to two different forms of the human telomeric G-quadruplex structure. J. Am. Chem. Soc. (2005) 127:9439–9447.[CrossRef][Web of Science][Medline]

  31. Rujan IN, Meleney JC, Bolton PH. Vertebrate telomere repeat DNAs favor external loop propeller quadruplex structures in the presence of high concentrations of potassium. Nucleic Acids Res. (2005) 33:2022–2031.[Abstract/Free Full Text]

  32. Wlodarczyk A, Grzybowski P, Patkowski A, Dobek A. Effect of ions on the polymorphism, effective charge, and stability of human telomeric DNA. Photon correlation spectroscopy and circular dichroism studies. J. Phys. Chem. B (2005) 109:3594–3605.[Medline]

  33. Qi J, Shafer RH. Covalent ligation studies on the human telomere quadruplex. Nucleic Acids Res. (2005) 33:3185–3192.[Abstract/Free Full Text]

  34. Vorlickova M, Chladkova J, Kejnovska I, Fialova M, Kypr J. Guanine tetraplex topology of human telomere DNA is governed by the number of (TTAGGG) repeats. Nucleic Acids Res. (2005) 33:5851–5860.[Abstract/Free Full Text]

  35. Ourliac-Garnier I, Elizondo-Riojas MA, Redon S, Farrell NP, Bombard S. Cross-links of quadruplex structures from human telomeric DNA by dinuclear platinum complexes show the flexibility of both structures. Biochemistry (2005) 44:10620–10634.[CrossRef][Medline]

  36. Li J, Correia JJ, Wang L, Trent JO, Chaires JB. Not so crystal clear: the structure of the human telomere G-quadruplex in solution differs from that present in a crystal. Nucleic Acids Res. (2005) 33:4649–4659.[Abstract/Free Full Text]

  37. Lee JY, Okumus B, Kim DS, Ha T. Extreme conformational diversity in human telomeric DNA. Proc. Natl Acad. Sci. USA (2005) 102:18938–18943.[Abstract/Free Full Text]

  38. Jaumot J, Eritja R, Tauler R, Gargallo R. Resolution of a structural competition involving dimeric G-quadruplex and its C-rich complementary strand. Nucleic Acids Res. (2006) 34:206–216.[Abstract/Free Full Text]

  39. Kan ZY, Yao Y, Wang P, Li XH, Hao YH, Tan Z. Molecular crowding induces telomere G-quadruplex formation under salt-deficient conditions and enhances its competition with duplex formation. Angew. Chem. Int. Ed. Engl. (2006) 45:1629–1632.[CrossRef]

  40. Yu HQ, Miyoshi D, Sugimoto N. Characterization of structure and stability of long telomeric DNA G-quadruplexes. J. Am. Chem. Soc. (2006) 128:15461–15468.[CrossRef][Web of Science][Medline]

  41. Zhang N, Phan AT, Patel DJ. (3 + 1) Assembly of three human telomeric repeats into an asymmetric dimeric G-quadruplex. J. Am. Chem. Soc. (2005) 127:17277–17285.[CrossRef][Web of Science][Medline]

  42. Wang Y, Patel DJ. Solution structure of the Tetrahymena telomeric repeat d(T2G4)4 G-tetraplex. Structure (1994) 2:1141–1156.[Medline]

  43. Luu KN, Phan AT, Kuryavyi V, Lacroix L, Patel DJ. Structure of the human telomere in K+ solution: an intramolecular (3 + 1) G-quadruplex scaffold. J. Am. Chem. Soc. (2006) 128:9963–9970.[CrossRef][Medline]

  44. Phan AT, Luu KN, Patel DJ. Different loop arrangements of intramolecular human telomeric (3 + 1) G-quadruplexes in K+ solution. Nucleic Acids Res. (2006) 34:5715–5719.[Abstract/Free Full Text]

  45. Ambrus A, Chen D, Dai J, Bialis T, Jones RA, Yang D. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. (2006) 34:2723–2735.[Abstract/Free Full Text]

  46. Xu Y, Noguchi Y, Sugiyama H. The new models of the human telomere d[AGGG(TTAGGG)3] in K+ solution. Bioorg. Med. Chem. (2006) 14:5584–5591.[CrossRef][Medline]

  47. Dias E, Battiste JL, Williamson JR. Chemical probe for glycosidic conformation in telomeric DNAs. J. Am. Chem. Soc. (1994) 116:4479–4480.[CrossRef][Web of Science]

  48. Esposito V, Randazzo A, Piccialli G, Petraccone L, Giancola C, Mayol L. Effects of an 8-bromodeoxyguanosine incorporation on the parallel quadruplex structure [d(TGGGT)]4. Org. Biomol. Chem. (2004) 2:313–318.[CrossRef][Web of Science][Medline]

  49. Borman S. Quadruplex in its elements: structures of human telomeric quadruplex in cell-like solution have implications for anticancer therapeutics. Chem Eng News (2006) 84:46.

  50. Dai J, Punchihewa C, Ambrus A, Chen D, Jones RA, Yang D. Structure of the intramolecular human telomeric G-quadruplex in potassium solution: a novel adenine triple. Nucleic Acids Res. (2007) 35:2440–2450.[Abstract/Free Full Text]

  51. Matsugami A, Xu Y, Noguchi Y, Sugiyama H, Katahira M. Structure of a human telomeric DNA sequence stabilized by 8-bromoguanosine substitutions, as determined by NMR in a K+ solution. FEBS J. (2007) 274:3545–3556.[CrossRef][Medline]

  52. Phan AT, Patel DJ. A site-specific low-enrichment 15N,13C isotope-labeling approach to unambiguous NMR spectral assignments in nucleic acids. J. Am. Chem. Soc. (2002) 124:1160–1161.[CrossRef][Web of Science][Medline]

  53. Phan AT, Modi YS, Patel DJ. Two-repeat Tetrahymena telomeric d(TGGGGTTGGGGT) sequence interconverts between asymmetric dimeric G-quadruplexes in solution. J. Mol. Biol. (2004) 338:93–102.[CrossRef][Web of Science][Medline]

  54. Phan AT, Guéron M, Leroy JL. Investigation of unusual DNA motifs. Methods Enzymol. (2001) 338:341–371.[CrossRef][Web of Science][Medline]

  55. Phan AT. Long-range imino proton-13C J-couplings and the through-bond correlation of imino and non-exchangeable protons in unlabeled DNA. J. Biomol. NMR (2000) 16:175–178.[CrossRef][Web of Science][Medline]

  56. Brünger AT. X-PLOR: A System for X-ray Crystallography and NMR. (1992) New Haven, CT: Yale University Press.

  57. Bouaziz S, Kettani A, Patel DJ. A K-cation induced conformational switch within a loop spanning segment of a DNA quadruplex containing G-G-G-C repeats. J. Mol. Biol. (1998) 282:637–652.[CrossRef][Web of Science][Medline]

  58. Parkinson GN, Ghosh R, Neidle S. Structural basis for binding of porphyrin to human telomeres. Biochemistry (2007) 46:2390–2397.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
Z. Zhang, J. Dai, E. Veliath, R. A. Jones, and D. Yang
Structure of a two-G-tetrad intramolecular G-quadruplex formed by a variant human telomeric sequence in K+ solution: insights into the interconversion of human telomeric G-quadruplex structures
Nucleic Acids Res., November 27, 2009; (2009) gkp1029v1.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. W. Lim, P. Alberti, A. Guedin, L. Lacroix, J.-F. Riou, N. J. Royle, J.-L. Mergny, and A. T. Phan
Sequence variant (CTAGGG)n in the human telomere favors a G-quadruplex structure containing a G{middle dot}C{middle dot}G{middle dot}C tetrad
Nucleic Acids Res., October 1, 2009; 37(18): 6239 - 6248.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. G. T. Su, H. Fang, M. L. Gross, and J.-S. A. Taylor
Photocrosslinking of human telomeric G-quadruplex loops by anti cyclobutane thymine dimer formation
PNAS, August 4, 2009; 106(31): 12861 - 12866.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Y. Lee and D. S. Kim
Dramatic effect of single-base mutation on the conformational dynamics of human telomeric G-quadruplex
Nucleic Acids Res., June 1, 2009; 37(11): 3625 - 3634.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Randall and J. D. Griffith
Structure of Long Telomeric RNA Transcripts: THE G-RICH RNA FORMS A COMPACT REPEATING STRUCTURE CONTAINING G-QUARTETS
J. Biol. Chem., May 22, 2009; 284(21): 13980 - 13986.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J.-l. Zhang, Y. Fu, L. Zheng, W. Li, H. Li, Q. Sun, Y. Xiao, and F. Geng
Natural isoflavones regulate the quadruplex-duplex competition in human telomeric DNA
Nucleic Acids Res., May 1, 2009; 37(8): 2471 - 2482.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. M. Pedroso, W. Hayward, and T. M. Fletcher
The effect of the TRF2 N-terminal and TRFH regions on telomeric G-quadruplex structures
Nucleic Acids Res., April 1, 2009; 37(5): 1541 - 1554.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. N. Lane, J. B. Chaires, R. D. Gray, and J. O. Trent
Stability and kinetics of G-quadruplex structures
Nucleic Acids Res., October 1, 2008; 36(17): 5482 - 5515.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. I. Gaynutdinov, R. D. Neumann, and I. G. Panyutin
Structural polymorphism of intramolecular quadruplex of human telomeric DNA: effect of cations, quadruplex-binding drugs and flanking sequences
Nucleic Acids Res., July 1, 2008; 36(12): 4079 - 4087.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. J. Patel, A. T. Phan, and V. Kuryavyi
Human telomere, oncogenic promoter and 5'-UTR G-quadruplexes: diverse higher order DNA and RNA targets for cancer therapeutics
Nucleic Acids Res., November 17, 2007; (2007) gkm711v2.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (4994K) Freely available
Right arrow Screen PDF (1226K) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
35/19/6517    most recent
gkm706v2
gkm706v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Phan, A. T.
Right arrow Articles by Patel, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Phan, A. T.
Right arrow Articles by Patel, D. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?