Nucleic Acids Research Advance Access published online on November 12, 2009
Nucleic Acids Research, doi:10.1093/nar/gkp1040
RNA |
Functional properties and evolutionary splicing constraints on a composite exonic regulatory element of splicing in CFTR exon 12
International Centre for Genetic Engineering and Biotechnology (ICGEB), 34149 Trieste, Italy
*To whom correspondence should be addressed. Tel: +39 040 3757337; Fax: +39 040 3757361; Email: baralle{at}icgeb.org
Received September 8, 2009. Revised October 22, 2009. Accepted October 22, 2009.
| ABSTRACT |
|---|
|
|
|---|
In general, splicing regulatory elements are defined as Enhancers or Silencers depending on their positive or negative effect upon exon inclusion. Often, these sequences are usually present separate from each other in exonic/intronic sequences. The Composite Exonic Splicing Regulatory Elements (CERES) represent an extreme physical overlap of enhancer/silencer activity. As a result, when CERES elements are mutated the consequences on the splicing process are difficult to predict. Here, we show that the functional activity of the CERES2 sequence in CFTR exon 12 is regulated by the binding, in very close proximity to each other, of several SR and hnRNP proteins. Moreover, our results show that practically the entire exon 12 sequence context participate in its definition. The consequences of this situation can be observed at the evolutionary level by comparing changes in conservation of different splicing elements in different species. In conclusion, our study highlights how it is increasingly difficult to define many exonic sequences by simply breaking them down in isolated enhancer/silencer or even neutral elements. The real picture is close to one of continuous competition between positive and negative factors where affinity for the target sequences and other dynamic factors decide the inclusion or exclusion of the exon.
| INTRODUCTION |
|---|
|
|
|---|
Only a few years ago, mutations in the protein-coding section of genes that did not affect amino acid coding capacities were considered to be neutral with regards to the protein functional properties (and thus the evolutionary fitness of the gene). Since then, advances in both the pre-mRNA splicing and the translational research fields have severely challenged this assumption, especially with regards to its implications in the occurrence of human disease and on evolutionary mechanisms in general (1–3). With regards to the pre-mRNA alternative splicing process (4), this assumption was first challenged by the discovery that splicing regulatory elements (SREs) could be found embedded within exonic coding sequences both in alternative and constitutive splicing (5,6) and that these elements and the strength of the basic splicing consensus motifs (7) could regulate exon inclusion levels. More than 20 years since these discoveries, the importance of splicing regulatory regions within exon coding sequences has, if anything, greatly increased. In fact, global analyses of splicing events (8,9) and the search for these splicing regulatory motifs embedded within exons has received considerable attention, especially through the use of high-throughput and bioinformatics approaches (10,11). The results of all these analyses clearly indicate that SRE elements represent important players in controlling both alternatively and constitutively splicing processes (12,13).
In general, SRE elements are individually referred to as Exonic and Intronic Splicing Enhancers (ESEs and ISEs) or Exonic and Intronic Splicing Silencers (ESSs and ISSs) sequences depending on their localization and functional effects (14–18). The way in which SRE elements exert their action is through the binding of trans-acting factors, predominantly belonging to the SR and hnRNP protein families (19–23). It should be noted, however, that the list of proteins capable of modulating splicing is growing every year (24) and much still remains to be uncovered in this area of research. Nonetheless, aside from individual identities, it has been determined long ago that the balance between antagonistic factors binding to a particular SRE element is one key factor in discriminating exon inclusion/exclusion levels (25,26). The possibility of controlling this balance has provided a great advantage to the eukaryotic cell because, whenever necessary, it can be shifted in one direction or the other through several mechanisms. In fact, beside the intrinsic affinity of splicing factors for their respective cis-targets, the binding level of each factor can be easily modified by variations in its relative expression levels (27–29), posttranslational modifications (30–33) or local RNA folding arrangements that limit/enhance their availability (34–39).
Studying these issues also makes for fascinating insights with regards to the potential relationships between coding and splicing regulatory regions during the course of evolution. It is now clear, in fact, that synonymous or even advantageous substitutions at the protein level may still be selected against if they end up to be harmful with regards to splicing decisions. On the other hand, suboptimal codon usage arrangements may be maintained to preserve correct splicing functionality (1,40). In keeping with this concept, recent analyses have uncovered the presence of extensive purifying selection against substitutions in ESE elements as determined by the reduced single nucleotide polymorphism density in these regions (41) and by the fact that codon usage at the exon–intron boundaries may be considerably affected by the need to maintain SRE sequences (42). It should also be mentioned, however, that these kind of analyses are still hampered by our limited knowledge of SRE sequences and caution should be employed when making these kind of comparisons on the basis of bioinformatic studies (43). For this reason, it is advisable to back up any eventual conclusion with functional experiments that might either support or not the bioinformatics considerations.
Among the known SRE sequences, a particularly interesting class of elements is represented by the discovery of the Composite Exonic Regulatory Elements of Splicing (CERES), that were first identified in human CFTR exon 12 and exon 9 (44,45). Unlike the classical exonic regulatory elements, that tend to predominantly possess either enhancing or silencing properties, the effect of mutagenesis in CERES elements is very unpredictable with regards to splicing outcomes. This makes it very difficult to evaluate the potential pathologic effect of apparently benign substitutions in these regions. In this work, we have combined the analysis of natural pathogenic mutations with a comparative human–mouse genomic approach to better understand the characteristics of one of these CERES elements in CFTR exon 12 (CERES2). The results of this analysis have reinforced the emerging concept that in many cases dividing exonic sequences in well defined enhancer/silencer or neutral splicing regulatory elements does not satisfactorily explain anymore the effects of artificial and natural substitutions. It is only by adopting a more global view of splicing regulatory codes that will allow us to understanding many dynamic sequence interplays aimed at preserving splicing definition of eukaryotic exons.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Hybrid minigene constructs
Human CFTR exon 12 minigene constructs (T40C, G48C, A49G, A51T, C52T and WT) have been previously described (40,44). Further modification of the exon were introduced by PCR-directed mutagenesis using specific primers and cloned inside the NdeI restriction site of the pTB plasmid. Primer sequences for each described mutants can be provided up on request. Mouse CFTR Exon 12 along with the mouse introns (297 nt of intron 11 and 219 nt of intron 12) was amplified from genomic DNA (Mus musculas strain C57BL/6) using primers MCF12 F: 5'-ggctccaggcttgagcatatgtactaatctg-3' and MCF12 R: 5'-caagaaattggcttcatatgtgatcatcaga-3'. Mouse CFTR exon 12 modifications were also performed by PCR-directed mutagenesis with specific primers.
CFTR exon 12 sequences of different animals were recovered using NCBI BLASTN search. Accession numbers of the sequences are Human (Gene Bank accession number NM_000492.3 [GenBank] Homo sapiens), Guinea pig (Gene Bank accession number AF133216.1 Cavia porcellus), Ground Squirrel (Gene Bank accession number AC184040.3 Spermophilus tridecemlineatus), Mouse (Gene Bank accession number NM_021050.2 [GenBank] Mus musculus), Rabbit (Oryctolagus cuniculus) GenBank accession no. NM_001082716, Cow (Bos tortus) GenBank accession no. NM_174018 [GenBank] , Pig (Sus scrofa) GenBank accession no. AY585334 [GenBank] , Horse (Equus caballus) GenBank accession no. NM_001110510, Lemur (Lemur catta) GenBank accession no. AC123543.
Cell culture, transfections and RT–PCR analysis
HeLa cells were cultured in Dulbeccos modified Eagles medium with Glutamax (Invitrogen) in standard conditions. The minigenes used for transfection were purified using phenol–choloroform extraction followed by a sephacryl S-400 (GE healthcare) column purification step. HeLa cells were plated at a concentration of 2.8 x 105 to achieve 80–90% confluence. The following day, 500 ng of plasmid DNA were transfected in the cells using Effectene transfection reagents (Qiagen). In case of in vivo overexpression of SR proteins (a kind gift from J. Caceres), 1µg of expression vector was mixed with 500 ng of minigenes. Finally, after 24 h total RNA was extracted using TRIreagent solution (Ambion). One microgram of total RNA was used in the retrotranscription reaction with random primers and Moloney murine leukemia virus enzyme (Invitrogen). Spliced products from the transfected minigene were obtained using primers Bra2 5'-taggatccggtcaccaggaagttggttaaatca-3' and
2–3 5'-caacttcaagctcctaagccactgc-3'. PCR conditions were the following: 94°C for 5 min.; 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s for 30 cycles; and 72°C for 7 min for the final extension. PCRs were optimized to be in the exponential phase of amplification and products were routinely fractionated in 1.8% (wt/vol) agarose gels.
In vitro transcription and synthetic RNA oligo
RNA was transcribed from PCR templates amplified from the respective plasmids. A T7 promoter sequence was added towards the 5'-end of the template using primer carrying T7 sequence and, similarly, a (TG)8 repeated sequence was used to tag the 3'-end. Every time, 5 µg of DNA template was used in a 60 µl T7 polymerase (Stratagene) transcription reaction. The RNA was then purified using standard Acid–Phenol purification method followed by Ethanol precipitation. Synthetic RNA oligos corresponding to Mouse 17–38, Human 17–38, Mouse 63–81 and Human 63–81 sequences were purchased from Eurofins MWG Operon, Germany.
Affinity purification of RNA binding proteins and western blot analysis
Ten micrograms of synthetic RNA oligo or 15 µg of transcribed RNA were oxidized in the dark for an hour with sodium m-periodate in a 400 µl reaction mixture (100 mM Sodium acetate pH 5.2 and 5 mM Sodium m-periodate). RNA was then ethanol precipitated and resuspended in 200 µl of 100 mM sodium acetate. Approximately 350 µl of prewashed equilibrated adipic acid dehydrazide-agarose beads (50% slurry; Sigma) were added to each oxidized RNA volume and placed in the rotor at 4°C for overnight incubation. This RNA-Bead covalent link formation was also performed in the dark. The immobilized RNA were then washed once with 1 ml of 2 M NaCl and twice using washing buffer (5.2 mM HEPES pH 7.5, 1 mM MgCl2, 0.8 mM Mg acetate). Meanwhile, 200 µl of nuclear extract was mixed with 900 µl RNAse free water, 1x binding buffer (5.2 mM HEPES pH 7.9, 1 mM MgCl2, 0.8 mM Mg acetate, 0.52 mM dithiothreitol, 3.8% glycerol, 0.75 mM ATP, 1 mM GTP and Heparin at the final concentration of 0.5 µg/µl). The RNA-bound beads were then equilibrated in 300 µl of NE mix and incubated for 25 min on a rotor at room temperature. Beads were then washed four times with 1.5 ml washing buffer. In every washing step beads were gently precipitated by gravity on ice. Finally, 50 µl of 3x SDS loading buffer was added and samples were heated for 5 min before loading on a 10% SDS–polyacrylamide denaturing gel. The gel was then electroblotted onto a polyvinylidene difluoride membrane according to standard protocols (Amersham Biosciences) and blocked with 10% skimmed milk (Non fat dry milk in 1x PBS). Membranes targeted for SR protein recognition were blocked using Western blocking reagent (Roche). Proteins were probed with different antibodies and detected with a chemiluminescence kit (ECL; Pierce Biotechnology). Antibodies against hnRNP U and Tra2 β were kind gifts from G. Dreyfuss and I.C Eperon, respectively. Monoclonal Anti-ASF/SF2, SC35 and 1H4 (against SRp 75, 55, 40) antibodies were purchased from Zymed Laboratories Inc. Changes of protein binding levels have been quantified relative to TDP-43 using an Ultro Scan XL, Pharmacia LKB—laser densitometer at 633 nM wavelength according to manufacturers instructions.
siRNA knockdown of splicing factors
siRNA sense sequences used for silencing the different target proteins were the following: human hnRNPA1—cagcugaggaagcucuuca (Sigma), and human hnRNPA2—ggaacaguuccguaagcuc (Sigma); human hnRNP C1/C2- gcaaacaagcaguagagau (Sigma), human DAZAP1-gagacucugcgcagcuacu (Dharmacon) and luciferase no. 2 gene control, gccauucuauccucuagaggaug (Dharmacon). HeLa cells were plated at 0.7 x 105 cells per well in 35-mm plates to achieve 30–40% confluence. The next day, 3 µl Oligofectamine (Invitrogen) was combined with 15 µl of Opti-MEM medium (Invitrogen) and 3 µl of 40 µM siRNA duplex oligonucleotides was diluted in a final volume of 180 µl of Opti-MEM medium. The two mixtures were combined and left for 20 min at room temperature. Finally, this mixture was added to the cells, which were mantained in 0.9 ml of Opti-MEM only. After 6 h, 500 µl of 30% FBS (Foetal bovine serum, Invitrogen) was added. Six to eight hours later Opti-MEM was exchanged with Dulbeccos modified Eagle medium and the cells were transfected with the minigene of interest (500 ng) using Qiagen Effectene transfection reagents. On the third day, HeLa cells were harvested for protein and RNA extractions. RT–PCR from total RNA was performed as for the transfection protocol described above. Whole-protein extracts were obtained by cell sonication in lysis buffer (1x PBS and 1x Protease inhibitor cocktail) and analyzed for hnRNPA1, A2, C1/C2 and DAZAP1 endogenous protein expression by immunoblotting using the antibodies described above. Tubulin was used as total protein loading control.
| RESULTS |
|---|
|
|
|---|
In order to better characterize the CERES2 element in CFTR exon 12 we selected two pathological missense mutations (G48C, A51T) and three samesense substitutions (T40C, A49G and C52T) that were already known to affect CFTR exon 12 splicing when inserted in the pTB minigene (Figure 1). In particular, transfection in HeLa cells of the G48C and A49G substitutions caused exon skipping in the full exon 12 context whilst A51T caused full exon inclusion, as previously reported (44). In addition, to widen the number of mutations under study we also chose the T40C and C52T synonymous substitutions that were already known to cause total exon skipping when inserted in the human context (40). These substitutions are particularly interesting form an evolutionary point of view as they are naturally present in the mouse CFTR exon 12 sequence and C52T has also been reported as a human polymorphism/possible mutation in the Cystic Fibrosis Mutation Database (www.genet.sickkids.on.ca). The position and consequences of all these substitutions when inserted in a CFTR exon 12 minigene are summarized in Figure 1A and B, respectively.
|
First of all, we were interested to see whether the functional effects of these substitutions were dependent on the context provided by the rest of the exon sequence. To study this, we have analyzed their functional effect in a shortened CFTR exon 12 sequence obtained by removing the regions near the 3 and 5's and downstream regions but maintaining 4 and 3 nts close to the 3' intron-exon and exon-5' intron junctions, respectively. We called this construct mini exon 12 (Figure 1C, upper panel). When all the mutations analyzed in Figure 1B were inserted in this reduced context both the G48C and A49G were still capable of inducing exon skipping as observed in the full length exon 12, whilst the enhancing effect of A51T could not be observed owing to the fact that the wild-type mini exon 12 is fully included in the spliced transcript (as opposed to only 80% inclusion of the full length exon 12) (Figure 1C, lower panel). Interestingly, both mouse-specific T40C and C52T substitutions lost the ability to induce exon skipping, suggesting that their effect on the CFTR exon 12 splicing process necessitated the presence of either one or both human flanking regions (Figure 1C, lower panel and Figure 6).
|
|
|
|
|
Identifying the trans-acting factors whose binding is affected by these substitutions
Considering that overexpression of the classical splicing factors hnRNP A1 and SF2/ASF was already described to affect CFTR exon 12 splicing (44) it was decided to better characterize the effect of these substitutions in terms of binding to a wide range of SR and hnRNP splicing factors. To achieve this, we have used a pulldown system previously used in our lab to identify specific RNA binding proteins in a variety of exonic/intronic contexts (46,47). The transcribed RNAs carry a (UG)8 tail that functions as a loading control for the TDP-43 protein (48) (Figure 2A).
In the first analysis, we tested the mini wild-type CFTR exon 12 sequence and two versions carrying the two missense mutations G48C and A51T for binding to the following proteins: hnRNP U, PTB, hnRNP H, DAZAP1, hnRNP C2, A1, A2 and SRp75, SRp55, SRp40, SF2/ASF and Tra2β. The results of this analysis are reported in Figure 2B. This figure shows that no binding could be observed for the hnRNP H, PTB, SRp75, SRp40, SC35 and Tra2β proteins to the mini-exon 12 sequence, both in its wild-type form and carrying either the G48C or the A51T mutations. On the other hand, some of the proteins tested could bind all these sequences, irrespectively of the presence or absence of mutations (hnRNP U and SRp55). Interestingly, a few displayed a differential binding ability in the wild-type sequence with respect to these mutations. In particular, the most striking change could be observed for the SF2/ASF protein that could better bind the A51T mutant with respect to the wild-type sequence. At the same time, it could also bind less efficiently to the G48C mutant than to the wild-type. Finally, hnRNP C2 could also bind less efficiently to the A51T mutant. It is worth noting that these changes are not all or nothing effects, but they are small changes then amplified by the combinatorial effect of all the other elements involved. On the other hand, the A51T mutant that in the whole exon 12 context has an exon inclusion enhancing effect, displayed increased SF2/ASF binding levels than the wild-type sequence. Quantification of hnRNP C2 and SF2/ASF binding levels in these experiments (normalized against TDP-43) are reported in Figure 2C as determined using densitometric analysis from three independent experiments.
In the case of the three synonymous mutations (T40C, A49G and C52T), the pulldown experiments yielded less varied results (Figure 3B). In fact, no changes could be observed in the binding profiles of RNAs carrying the T40C and C52T substitutions with respect to the wild-type sequence. However, in the case of the A49G mutation we observed less binding of the SF2/ASF protein than in the wild-type sequence and increased binding of hnRNP C2 (quantification of these proteins are reported in Figure 3C), a situation that made the effects of this mutation very similar to those observed for G48C (Figure 2B). Furthermore, it was also consistent with its inhibitory effect in the mini-exon 12 minigene (Figure 1C). In this respect, the observation that no changes could be observed for any of these proteins in the case of T40C and C52T was also consistent with the functional assays demonstrating that these two substitutions were neutral in the human mini-context (Figure 1C).
Validating the role played by SR factors in CFTR exon 12 splicing
In order to validate the role played by the SR proteins, we tested the response of both the G48C and A49G minigenes to overexpression of the specific interactors of the mini-exon 12 sequence, SF2/ASF and SRp55 and of SC35 (as an example of a SR protein not interacting with the mini exon). The results shown in Figure 4A demonstrate that both SF2/ASF and SRp55 consistently have a higher enhancing effect on the mini exon 12 inclusion levels than SC35, suggesting that direct interaction provides an advantage over the well known generalized enhancing effect of SR proteins. Interestingly, however, the enhancement observed for the two mutants was not the same, with A49G being less responsive especially for SRp55 overexpression than G48C. Finally, it should be noted that deletion of the central CERES2 region also abolished completely the response of the mini-exon 12 to all SR protein overexpression, demonstrating that their action in the mini-exon context is mediated only through the CERES2 sequence. In parallel, to further rule out non-specific effects of SF2/ASF overexpression, we also performed overexpression analysis of a series of deletion mutants (Figure 4B). Also in this case, mutants lacking either the RRM2 region (
RRM2) or the RS domain (
RS) could not enhance inclusion, further supporting the specificity of this SR protein functional interaction with the CERES2 sequence.
Validating the role played by hnRNP factors in CFTR exon 12 splicing
Because of their abundance in the nuclear extract, overexpression studies for the different hnRNP proteins did not yield satisfactory results (data not shown). For this reason, in order to test effectively the functional effects of the hnRNP interactors found in pulldown analysis we performed individual siRNA-mediated knockdown of the well known hnRNP A1, A2 and C2 proteins (Figure 5A). As shown in Figure 5B, the only siRNA knockdown that could rescue both the G48C and A49G mini-exons inclusion was hnRNP A1. Importantly, knockdown of this protein had no effect on the CERESdel minigene. Finally, no effect could be detected following hnRNP C2 knockdown which is rather surprising considering that the role of this protein in the regulation of splicing control has been recently re-evaluated in high-throughput studies (23). In addition, as there are many hnRNPs with redundant functions we have also tried the simultaneous depletion of A1, A2 and C2 in different combinations but could not confirm their role in the splicing regulation of CFTR exon 12 (data not shown). It should be noted, however, that these results do not mean that only hnRNP A1 can modulate CFTR exon 12 splicing. In fact, some of these proteins could still play an active role in the presence of reduced amounts of positive factors (i.e. SF2/ASF or SRp55) and further work will be needed to clarify this issue.
Recovery of the T40C and C52T inhibitory action through the add back of human and mouse flanking CFTR exon 12 sequences
In order to better characterize the mode of action of these substitutions to the mini-exon 12 minigene, we selectively added back the missing upstream and downstream sequences (both in their human and mouse forms) and observed which mutant was able to recover the inhibitory effect of the T40C/C52T substitutions (Figure 6A). As shown in Figure 6B, right panel, the wild type exon 12 constructs that contain the added-back human and mouse upstream regions display full inclusion (constructs A and D). However, when we inserted back the T40C and C52T mutations the inhibitory effect could be detected only in the constructs with the added back human sequence but not with those with the mouse sequence (compare constructs B–C with E–F). A similar situation could also be observed with the downstream regions. In fact, Figure 6B, middle panel, shows that wild-type exon 12 sequences with the added-back human and mouse downstream region display full inclusion (constructs G and J). However, when T40C and C52T were inserted back it was observed that the inhibitory effect could be detected only in the constructs with the human but not with the mouse downstream sequence (compare constructs H–I with K–L). Interestingly, the integrity of maintaining the mouse polypurinic GAAGAACAAG motif present in the mouse sequence (underlined in Figure 6A, bottom) is particularly important. In fact, the majority of substitutions that tend to restore the mouse sequence can successfully withstand the inhibitory action of the C52T substitution (construct N-O as opposed to M).
Taken together, these results suggest that the human and mouse flanking regions have different splicing regulatory properties: human sequences, both upstream and downstream of the central exon 12 region containing CERES2, may be predominantly inhibitory. On the other hand, the mouse upstream and downstream sequences seem to enhance exon recognition.
The hypothesis that mouse sequences enhanced exon recognition was thus tested at the functional level by amplifying a mouse CFTR exon 12 sequence and inserting it in the pTB minigene system (Figure 7A). In this sequence, we then deleted the upstream and downstream regions, either separately or in combination (mutants A–C). The results of this analysis are reported in Figure 7B and show that deleting only the upstream sequence (mutant A) had no effect of mouse CFTR exon 12 inclusion levels. On the other hand, deletion of the downstream sequence (mutant B) resulted in
15% exon skipping. Interestingly, if both regions are deleted at the same time (mutant C) the levels of exon skipping increase to 25%, indicating that also the polypurinic downstream sequence can function as an ESE once the upstream ESE sequence is absent.
|
Trans-acting factors binding to the human and mouse 17–38 and 63–81 sequences
Based on these results, it was thus likely that mouse and human flanking sequences could bind a different set of proteins. For this reason, we selected the 17–38 and 63–81 mouse and human regions (Figure 8A) to perform pulldown assays as previously described for the central region (Figures 2–3). The Western blot analysis to check for SR protein binding showed that both mouse sequences could bind SF2/ASF, SRp75 and SRp55 more efficiently than the respective human sequences. In addition, mouse nucleotide stretch 64–82 is also capable of binding SRp40 whilst the human 64–82 sequence is not (Figure 8C). As control, the recognition with antibodies against hnRNP proteins A1 and U showed that both these factors could bind with equally well with the mouse and human sequences. Unfortunately, using this approach we were unable to determine which factors are responsible for the ESS activity of the human 18–39 and 64–82 sequences. Of course, the most probable reason is that we have tested only a fraction of the candidates and there are many potential known or unknown proteins that could exert an effect on splicing regulation. Further work is currently under way to better define this point. In any case, these results were consistent with the in vivo results that detected different functional properties between the mouse and human flanking regions.
|
| DISCUSSION |
|---|
|
|
|---|
Missense mutations in human CFTR exon 12 have been described to be the causative agent of Cystic Fibrosis through the inactivation of a highly conserved region that encodes part of the first nucleotide binding fold of the protein (49). In particular, among all disease-causing mutations known to affect this exon, several have been described to induce its skipping during the splicing process (50–52). In our lab, we originally defined within CFTR exon 12 two regions, named CERES1 and CERES2 (Figure 9), that functioned in a highly context-dependent manner to regulate the splicing process of this exon (44). In fact, the effect of natural and artificial mutations within these regions could not be predicted easily using current bioinformatics approaches (44), highlighting recent recommendations that these programs should be used with caution when they are used as a diagnostic tool (53,54). Indeed, successive experimental comparison between human and mouse CFTR exon 12 sequences demonstrated that about one quarter of all artificial combinations of mouse–human same sense substitutions resulted in exon skipping (40). Taken together, these findings suggested that the whole coding sequence of CFTR exon 12 is under strong selective pressures not only for functional reasons at the protein level, but also for the maintenance of proper exon recognition by the splicing machinery.
|
Up to now, however, the detailed molecular bases of CERES action were not known. We have performed an analysis of the trans-acting factors that bind the CERES2 element localized in CFTR exon 12. Our analysis was preliminarily focused at characterizing the binding properties of the most common splicing regulators, and in particular those belonging to either the SR or the hnRNP class of trans-acting factors. The results of our analysis have demonstrated that in normal conditions human CERES2 can bind a substantial number of these proteins, something that may be rather surprising since the core CERES2 element represents a very short stretch of RNA sequence (<10 nucleotides). Among SR proteins, we have found SF2/ASF and SRp55 whilst regarding hnRNP proteins specific binding could be detected for most hnRNP A/B family members. Most importantly, the relative binding capacity of some of the factors was modified following the introduction of disease-associated missense mutations or of samesense substitutions that were already known to affect CFTR exon 12 inclusion levels. From a basic RNA binding protein point of view, this finding highlights the great flexibility provided by RRM motifs that can recognize a few specific bases at selected positions using their main chains and then use side-chain interactions to stabilize binding (55). This probably explains why the CERES2 sequence rather than functioning as a binding site for a single protein only can function as a kind of aggregation site for many SR/hnRNP factors. Evidence of a functional interaction was confirmed only for SF2/ASF, SRp55 and hnRNP A1. However, it should be noted that these experiments were performed in a severely reduced context (mini-exon 12) and that in a more natural setting many of these proteins will be able to play a role, especially considering the fact that the exonic flanking regions also can bind several SR/hnRNP factors (see below). At the moment, of course, we have tested only few regulatory proteins and hence cannot rule out the presence of additional yet unknown factors that might also contribute to define/hinder CFTR exon 12. Another possibility is that our substitutions may affect the RNA secondary structure of CFTR exon 12. However, an evolutionary-based model of CFTR exon 12 RNA secondary structure has already been previously published by Meyer and Miklos (56). In their work, they have also analyzed the potential impact of some splicing mutations including substitutions in the 40T and 52C positions. The conclusion is that there are only marginally significant changes in the RNA structure of the mutants with respect to the predicted wild-type sequence. It is for this reason that we decided to concentrate on analyzing trans-acting factors rather than taking into consideration structural changes following our substitutions.
Taken together, our results suggest that this crowding together of many different proteins (both positive and negative in terms of their effect on splicing) may explain why single-point substitutions within the CERES2 element have such an unpredictable effect on the exon recognition levels. Up to now, on a slightly wider scale the CERES sequence situation is similar to what has already been found in several small exons, such as SMN exon 7, where trans-acting factors (SF2/ASF and hnRNP A1) binding to the same exonic region contribute to exon inclusion/skipping (57,58). Other examples of very complex systems include the human c-src exon N1 (59,60), CD44 exon v5 (61–63), HipK3 T exon (64), and chicken cTNT exon 5 (65) where numerous factors have been shown to participate in splicing regulation in close spatial proximity to each other. Indeed, for SMN exon 7 it has been hypothesized the existence of an Extended Inhibitory Context (Exinct) that is caused by overlapping regulatory motifs not all of which have still been characterized in depth (66).
On a more general note, the existence of these numerous splicing factor binding sites co-existing together on the same exon has very important implications with regards to evolutionary constraints in codon composition. For example, our results have shown very clearly that the inhibitory effect of some synonymous nucleotide substitutions (A40T and C52T) naturally occurring in the mouse sequence can be explained by the different splicing regulatory properties of the human and mouse flanking exonic sequences (summarized in Figure 9). In particular, by comparing the ESE, ESS, and CERES elements several considerations can be made with regards to the sequence changes that have occurred in the mouse to human transition during the course of evolution. In fact, as shown in Figure 9 it can be hypothesized that the creation of the human CERES2 element in CFTR exon 12 has relieved the pressure to keep the two weak ESE elements loosely localized in the mouse 18–39 and 64–82 flanking regions. Only after the creation of CERES2 element these two regions could thus undergo nucleotide substitutions that either weakened these elements (i.e. in the Ground squirrel and Guinea pig 64–82 region) or even changed them to functional silencer sequences (in human 18–39 and 64–82 region). The advantage of these coding region changes can be only hypothesized at this stage, but it may involve further steps beyond mRNA processing such as enzymatic activity or protein stability. Irrespective of their significance, however, the important issue is that sequence changes could only be introduced through the creation of the CERES2 element (the importance of which is highlighted by the observation that many of the mouse to human substitutions analyzed in this study lead directly to total exon skipping). It is also interesting to note that a comparison of these sequence elements also in other species (Figure 9) does not contradict the conclusions we have drawn from mouse versus humans. In fact, for example, both cows and rabbits that do not contain the CERES2 element have absolutely conserved ESE sequences. Of course, additional experiments will need to be performed before we can draw firm conclusions on this issue. Nonetheless, in our work, we show that an integrated analysis of cis- and trans-acting factors binding to exonic elements can provide a substantial wealth of information on potential evolutionary mechanisms.
Looking at the splicing regulatory elements in Figure 9 it is also possible to draw some additional conclusions with regards to our understanding of splicing regulation in general. It is clear that, the CFTR exon 12 sequence is literally covered by regulatory elements that we probably still consider (rather mistakenly) as separate elements. Proof of this is the observation that the activity of many of these splicing regulatory elements (especially CERES) cannot be exported in different contexts (44). Indeed, our results point towards a situation where in exons like CFTR exon 12 we should virtually consider every nucleotide as potentially capable of affecting splicing inclusion levels. The only question that might then remain to us is the direction of this change (whether increased inclusion/skipping) and its extent. It is very probable that as our knowledge of splicing systems increases this kind of situations will be more and more common. From a practical point of view, this will have several consequences. From a clinical point of view, increased importance have to be given at analyzing RNA transcripts directly from patient tissues or, routinely, through minigene based systems that will mimic this kind of global splicing regulatory networks (67). Second, this increased awareness will be useful for the development of novel bioinformatics methods aimed at predicting splicing outcomes that, until now, have been primarily focused at considering enhancer and silencer elements as well distinct entities with rather limited success (53,54). Finally, it should gradually shift our view of splicing where exon inclusion levels should not always be viewed as the straightforward algebraic sum of enhancer/silencer elements but as rather as an integrated unit, where silencing and enhancing functions may functionally overlap to a degree that has often been underestimated.
| FUNDING |
|---|
|
|
|---|
Telethon Onlus Foundation (grant no. GGP06147 to F.E.B.); European community grant (EURASNET- LSHG-CT-2005-518238 to F.E.B.). Funding for open access charge: ICGEB core funding.
Conflict of interest statement. None declared.
| Footnotes |
|---|
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.
| REFERENCES |
|---|
|
|
|---|
- Pagani F, Baralle FE. Genomic variants in exons and introns: identifying the splicing spoilers. Nat. Rev. Genet. (2004) 5:389–396.[CrossRef][Web of Science][Medline]
- Parmley JL, Hurst LD. How do synonymous mutations affect fitness? Bioessays (2007) 29:515–519.[CrossRef][Web of Science][Medline]
- Chamary JV, Parmley JL, Hurst LD. Hearing silence: non-neutral evolution at synonymous sites in mammals. Nat. Rev. Genet. (2006) 7:98–108.[CrossRef][Web of Science][Medline]
- Black DL. Mechanisms of alternative pre-messenger RNA splicing. Annu. Rev. Biochem. (2003) 72:291–336.[CrossRef][Web of Science][Medline]
- Mardon HJ, Sebastio G, Baralle FE. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Res. (1987) 15:7725–7733.
[Abstract/Free Full Text] - Reed R, Maniatis T. A role for exon sequences and splice-site proximity in splice-site selection. Cell (1986) 46:681–690.[CrossRef][Web of Science][Medline]
- Breathnach R, Benoist C, O'H;are K, Gannon F, Chambon P. Ovalbumin gene: evidence for a leader sequence in mRNA and DNA sequences at the exon-intron boundaries. Proc. Natl Acad. Sci. USA (1978) 75:4853–4857.
[Abstract/Free Full Text] - Ben-Dov C, Hartmann B, Lundgren J, Valcarcel J. Genome-wide analysis of alternative pre-mRNA splicing. J. Biol. Chem. (2008) 283:1229–1233.
[Abstract/Free Full Text] - Moore MJ, Silver PA. Global analysis of mRNA splicing. RNA (2008) 14:197–203.
[Abstract/Free Full Text] - Buratti E, Baralle FE. Another step forward for SELEXive splicing. Trends Mol. Med. (2005) 11:5–9.[CrossRef][Web of Science][Medline]
- Chasin LA. Searching for splicing motifs. Adv. Exp. Med. Biol. (2007) 623:85–106.[Web of Science][Medline]
- Wang J, Smith PJ, Krainer AR, Zhang MQ. Distribution of SR protein exonic splicing enhancer motifs in human protein-coding genes. Nucleic Acids Res. (2005) 33:5053–5062.
[Abstract/Free Full Text] - Pozzoli U, Sironi M. Silencers regulate both constitutive and alternative splicing events in mammals. Cell. Mol. Life Sci. (2005) 62:1579–1604.[CrossRef][Web of Science][Medline]
- Cartegni L, Chew SL, Krainer AR. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat. Rev. Genet. (2002) 3:285–298.[CrossRef][Web of Science][Medline]
- Blencowe BJ. Exonic splicing enhancers: mechanism of action, diversity and role in human genetic diseases. Trends Biochem. Sci. (2000) 25:106–110.[CrossRef][Web of Science][Medline]
- Venables JP. Downstream intronic splicing enhancers. FEBS Lett. (2007) 581:4127–4131.[CrossRef][Web of Science][Medline]
- Wang Z, Rolish ME, Yeo G, Tung V, Mawson M, Burge CB. Systematic identification and analysis of exonic splicing silencers. Cell. (2004) 119:831–845.[CrossRef][Web of Science][Medline]
- Wang Z, Burge CB. Splicing regulation: from a parts list of regulatory elements to an integrated splicing code. RNA (2008) 14:802–813.
[Abstract/Free Full Text] - Lin S, Fu XD. SR proteins and related factors in alternative splicing. Adv. Exp. Med. Biol. (2007) 623:107–122.[Web of Science][Medline]
- Huang Y, Steitz JA. SRprises along a messenger's; journey. Mol. Cell. (2005) 17:613–615.[CrossRef][Web of Science][Medline]
- Long JC, Caceres JF. The SR protein family of splicing factors: master regulators of gene expression. Biochem. J. (2009) 417:15–27.[CrossRef][Web of Science][Medline]
- Martinez-Contreras R, Cloutier P, Shkreta L, Fisette JF, Revil T, Chabot B. hnRNP proteins and splicing control. Adv. Exp. Med. Biol. (2007) 623:123–147.[Web of Science][Medline]
- Venables JP, Koh CS, Froehlich U, Lapointe E, Couture S, Inkel L, Bramard A, Paquet ER, Watier V, Durand M, et al. Multiple and specific mRNA processing targets for the major human hnRNP proteins. Mol. Cell. Biol. (2008) 28:6033–6043.
[Abstract/Free Full Text] - Jurica MS, Moore MJ. Pre-mRNA splicing: awash in a sea of proteins. Mol. Cell. (2003) 12:5–14.[CrossRef][Web of Science][Medline]
- Zhu J, Mayeda A, Krainer AR. Exon identity established through differential antagonism between exonic splicing silencer-bound hnRNP A1 and enhancer-bound SR proteins. Mol. Cell. (2001) 8:1351–1361.[CrossRef][Web of Science][Medline]
- Eperon IC, Makarova OV, Mayeda A, Munroe SH, Caceres JF, Hayward DG, Krainer AR. Selection of alternative 5' splice sites: role of U1 snRNP and models for the antagonistic effects of SF2/ASF and hnRNP A1. Mol. Cell. Biol. (2000) 20:8303–8318.
[Abstract/Free Full Text] - Caceres JF, Stamm S, Helfman DM, Krainer AR. Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science (1994) 265:1706–1709.
[Abstract/Free Full Text] - Relogio A, Ben-Dov C, Baum M, Ruggiu M, Gemund C, Benes V, Darnell RB, Valcarcel J. Alternative splicing microarrays reveal functional expression of neuron-specific regulators in Hodgkin lymphoma cells. J. Biol. Chem. (2005) 280:4779–4784.
[Abstract/Free Full Text] - Grosso AR, Gomes AQ, Barbosa-Morais NL, Caldeira S, Thorne NP, Grech G, von Lindern M, Carmo-Fonseca M. Tissue-specific splicing factor gene expression signatures. Nucleic Acids Res. (2008) 36:4823–4832.
[Abstract/Free Full Text] - Shin C, Feng Y, Manley JL. Dephosphorylated SRp38 acts as a splicing repressor in response to heat shock. Nature (2004) 427:553–558.[CrossRef][Medline]
- Blaustein M, Pelisch F, Srebrow A. Signals, pathways and splicing regulation. Int. J. Biochem. Cell. Biol. (2007) 39:2031–2048.[CrossRef][Web of Science][Medline]
- Huang Y, Yario TA, Steitz JA. A molecular link between SR protein dephosphorylation and mRNA export. Proc. Natl Acad. Sci. USA (2004) 101:9666–9670.
[Abstract/Free Full Text] - Misteli T, Caceres JF, Clement JQ, Krainer AR, Wilkinson MF, Spector DL. Serine phosphorylation of SR proteins is required for their recruitment to sites of transcription in vivo. J. Cell. Biol. (1998) 143:297–307.
[Abstract/Free Full Text] - Buratti E, Dhir A, Lewandowska MA, Baralle FE. RNA structure is a key regulatory element in pathological ATM and CFTR pseudoexon inclusion events. Nucleic Acids Res. (2007) 35:4369–4383.
[Abstract/Free Full Text] - Buratti E, Muro AF, Giombi M, Gherbassi D, Iaconcig A, Baralle FE. RNA folding affects the recruitment of SR proteins by mouse and human polypurinic enhancer elements in the fibronectin EDA exon. Mol. Cell. Biol. (2004) 24:1387–1400.
[Abstract/Free Full Text] - Hiller M, Zhang Z, Backofen R, Stamm S. Pre-mRNA secondary structures influence exon recognition. PLoS Genet. (2007) 3:e204.[CrossRef][Medline]
- Shepard PJ, Hertel KJ. Conserved RNA secondary structures promote alternative splicing. RNA (2008) 14:1463–1469.
[Abstract/Free Full Text] - Cheah MT, Wachter A, Sudarsan N, Breaker RR. Control of alternative RNA splicing and gene expression by eukaryotic riboswitches. Nature (2007) 447:497–500.[CrossRef][Medline]
- Graveley BR. Mutually exclusive splicing of the insect Dscam pre-mRNA directed by competing intronic RNA secondary structures. Cell. (2005) 123:65–73.[CrossRef][Web of Science][Medline]
- Pagani F, Raponi M, Baralle FE. Synonymous mutations in CFTR exon 12 affect splicing and are not neutral in evolution. Proc. Natl Acad. Sci. USA (2005) 102:6368–6372.
[Abstract/Free Full Text] - Parmley JL, Chamary JV, Hurst LD. Evidence for purifying selection against synonymous mutations in mammalian exonic splicing enhancers. Mol. Biol. Evol. (2006) 23:301–309.
[Abstract/Free Full Text] - Parmley JL, Hurst LD. Exonic splicing regulatory elements skew synonymous codon usage near intron-exon boundaries in mammals. Mol. Biol. Evol. (2007) 24:1600–1603.
[Abstract/Free Full Text] - Irimia M, Rukov JL, Roy SW. Evolution of alternative splicing regulation: changes in predicted exonic splicing regulators are not associated with changes in alternative splicing levels in primates. PLoS ONE (2009) 4:e5800.[CrossRef][Medline]
- Pagani F, Stuani C, Tzetis M, Kanavakis E, Efthymiadou A, Doudounakis S, Casals T, Baralle FE. New type of disease causing mutations: the example of the composite exonic regulatory elements of splicing in CFTR exon 12. Hum. Mol. Genet. (2003) 12:1111–1120.
[Abstract/Free Full Text] - Pagani F, Buratti E, Stuani C, Baralle FE. Missense, nonsense, and neutral mutations define juxtaposed regulatory elements of splicing in cystic fibrosis transmembrane regulator exon 9. J. Biol. Chem. (2003) 278:26580–26588.
[Abstract/Free Full Text] - Buratti E, Baralle M, De Conti L, Baralle D, Romano M, Ayala YM, Baralle FE. hnRNP H binding at the 5' splice site correlates with the pathological effect of two intronic mutations in the NF-1 and TSHbeta genes. Nucleic Acids Res. (2004) 32:4224–4236.
[Abstract/Free Full Text] - Buratti E, Dork T, Zuccato E, Pagani F, Romano M, Baralle FE. Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping. EMBO J. (2001) 20:1774–1784.[CrossRef][Web of Science][Medline]
- Buratti E, Baralle FE. Characterization and functional implications of the RNA binding properties of nuclear factor TDP-43, a novel splicing regulator of CFTR exon 9. J. Biol. Chem. (2001) 276:36337–36343.
[Abstract/Free Full Text] - Delaney SJ, Rich DP, Thomson SA, Hargrave MR, Lovelock PK, Welsh MJ, Wainwright BJ. Cystic fibrosis transmembrane conductance regulator splice variants are not conserved and fail to produce chloride channels. Nat. Genet. (1993) 4:426–431.[CrossRef][Web of Science][Medline]
- Hull J, Shackleton S, Harris A. Abnormal mRNA splicing resulting from three different mutations in the CFTR gene. Hum. Mol. Genet. (1993) 2:689–692.
[Abstract/Free Full Text] - Zielenski J, Markiewicz D, Lin SP, Huang FY, Yang-Feng TL, Tsui LC. Skipping of exon 12 as a consequence of a point mutation (1898 + 5G
T) in the cystic fibrosis transmembrane conductance regulator gene found in a consanguineous Chinese family. Clin. Genet. (1995) 47:125–132.[Web of Science][Medline] - Strong TV, Smit LS, Nasr S, Wood DL, Cole JL, Iannuzzi MC, Stern RC, Collins FS. Characterization of an intron 12 splice donor mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Hum. Mutat. (1992) 1:380–387.[CrossRef][Medline]
- Hartmann L, Theiss S, Niederacher D, Schaal H. Diagnostics of pathogenic splicing mutations: does bioinformatics cover all bases? Front Biosci. (2008) 13:3252–3272.[Web of Science][Medline]
- Houdayer C, Dehainault C, Mattler C, Michaux D, Caux-Moncoutier V, Pages-Berhouet S, d'E;nghien CD, Lauge A, Castera L, Gauthier-Villars M, et al. Evaluation of in silico splice tools for decision-making in molecular diagnosis. Hum. Mutat. (2008) 29:975–982.[CrossRef][Web of Science][Medline]
- Auweter SD, Oberstrass FC, Allain FH. Sequence-specific binding of single-stranded RNA: is there a code for recognition? Nucleic Acids Res. (2006) 34:4943–4959.
[Abstract/Free Full Text] - Meyer IM, Miklos I. Statistical evidence for conserved, local secondary structure in the coding regions of eukaryotic mRNAs and pre-mRNAs. Nucleic Acids Res. (2005) 33:6338–6348.
[Abstract/Free Full Text] - Cartegni L, Hastings ML, Calarco JA, de Stanchina E, Krainer AR. Determinants of exon 7 splicing in the spinal muscular atrophy genes, SMN1 and SMN2. Am. J. Hum. Genet. (2006) 78:63–77.[CrossRef][Web of Science][Medline]
- Kashima T, Rao N, David CJ, Manley JL. hnRNP A1 functions with specificity in repression of SMN2 exon 7 splicing. Hum. Mol. Genet. (2007) 16:3149–3159.
[Abstract/Free Full Text] - Sharma S, Falick AM, Black DL. Polypyrimidine tract binding protein blocks the 5' splice site-dependent assembly of U2AF and the prespliceosomal E complex. Mol. Cell. (2005) 19:485–496.[CrossRef][Web of Science][Medline]
- Chou MY, Underwood JG, Nikolic J, Luu MH, Black DL. Multisite RNA binding and release of polypyrimidine tract binding protein during the regulation of c-src neural-specific splicing. Mol. Cell. (2000) 5:949–957.[CrossRef][Web of Science][Medline]
- Matter N, Herrlich P, Konig H. Signal-dependent regulation of splicing via phosphorylation of Sam68. Nature (2002) 420:691–695.[CrossRef][Medline]
- Matter N, Marx M, Weg-Remers S, Ponta H, Herrlich P, Konig H. Heterogeneous ribonucleoprotein A1 is part of an exon-specific splice-silencing complex controlled by oncogenic signaling pathways. J. Biol. Chem. (2000) 275:35353–35360.
[Abstract/Free Full Text] - Cheng C, Sharp PA. Regulation of CD44 alternative splicing by SRm160 and its potential role in tumor cell invasion. Mol. Cell. Biol. (2006) 26:362–370.
[Abstract/Free Full Text] - Venables JP, Bourgeois CF, Dalgliesh C, Kister L, Stevenin J, Elliott DJ. Up-regulation of the ubiquitous alternative splicing factor Tra2beta causes inclusion of a germ cell-specific exon. Hum. Mol. Genet. (2005) 14:2289–2303.
[Abstract/Free Full Text] - Ladd AN, Stenberg MG, Swanson MS, Cooper TA. Dynamic balance between activation and repression regulates pre-mRNA alternative splicing during heart development. Dev. Dyn. (2005) 233:783–793.[CrossRef][Web of Science][Medline]
- Singh NN, Androphy EJ, Singh RN. An extended inhibitory context causes skipping of exon 7 of SMN2 in spinal muscular atrophy. Biochem. Biophys. Res. Commun. (2004) 315:381–388.[CrossRef][Web of Science][Medline]
- Baralle D, Lucassen A, Buratti E. Missed threads. The impact of pre-mRNA splicing defects on clinical practice. EMBO Rep. (2009) 10:810–816.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








