Nucleic Acids Research Advance Access published online on September 18, 2009
Nucleic Acids Research, doi:10.1093/nar/gkp762
Nucleic Acid Enzymes |
Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions
1Laboratorio de Genética Molecular, 2Laboratorio de Moléculas Orgánicas, Centro de Investigación Príncipe Felipe, 46012-Valencia, 3Fundación Aragón I + D and Institute of Biocomputation and Physics of Complex Systems (BIFI), Universidad de Zaragoza, 50009-Zaragoza, Spain and 4Department of Molecular Biology, Umeå University, S90187, Sweden
*To whom correspondence should be addressed. Tel: +34 96 328 9680; Fax: +34 96 328 9701; Email: armengod{at}cipf.es
Received June 27, 2009. Revised August 25, 2009. Accepted August 31, 2009.
| ABSTRACT |
|---|
|
|
|---|
The wobble uridine of certain bacterial and mitochondrial tRNAs is modified, at position 5, through an unknown reaction pathway that utilizes the evolutionarily conserved MnmE and GidA proteins. The resulting modification (a methyluridine derivative) plays a critical role in decoding NNG/A codons and reading frame maintenance during mRNA translation. The lack of this tRNA modification produces a pleiotropic phenotype in bacteria and has been associated with mitochondrial encephalomyopathies in humans. In this work, we use in vitro and in vivo approaches to characterize the enzymatic pathway controlled by the Escherichia coli MnmEGidA complex. Surprisingly, this complex catalyzes two different GTP- and FAD-dependent reactions, which produce 5-aminomethyluridine and 5-carboxymethylamino-methyluridine using ammonium and glycine, respectively, as substrates. In both reactions, methylene-tetrahydrofolate is the most probable source to form the C5-methylene moiety, whereas NADH is dispensable in vitro unless FAD levels are limiting. Our results allow us to reformulate the bacterial MnmEGidA dependent pathway and propose a novel mechanism for the modification reactions performed by the MnmE and GidA family proteins.
| INTRODUCTION |
|---|
|
|
|---|
Transfer RNAs (tRNAs) are by far the most heavily and diversely modified of all cellular RNAs (1). Modifications are introduced posttranscriptionally by specific enzymes and are critical for the fine-tuning of tRNA functions. Many of these modifications frequently appear in the anticodon wobble position (position 34) and are pivotal in the mRNA decoding process by stabilizing correct codon–anticodon interactions (1,2). Modifications at wobble uridines are classified into two groups according to their chemical structures and decoding properties: 5-hydroxyuridine derivatives (xo5U) with an oxygen atom directly bonded to the C5 atom of the uracil base, and 5-methyluridine derivatives (xm5U) with a methylene carbon directly bonded to the C5 atom. The last ones are mostly found in tRNAs that decode two-family box triplets ending in A or G, and include 2-thiouridine derivatives (xm5s2U) and 2'-O-methyluridine derivatives (xm5Um). Modified nucleosides of the xm5s2U type restrict the wobble capacity of uridine because the thiolation at position 2 of U34 stabilize the C3'-endo puckering conformation of the ribose, which facilitates the base paring with purines (A or G) and prevents misreading of codons ending in U or C (3). The xm5 modification seems to be critical for decoding NNG/A codons by stabilizing UG pairing at the wobble position as well as improving reading of the NNA codons (3–9). The lack of these modifications produces translational frameshifting and a pleiotropic phenotype in bacteria (1), whereas it has been associated with mitochondrial encephalomyopathies in humans (10) and mitochondrial dysfunction in a human cell line (11). Interestingly, some proteins involved in the biosynthesis of the xm5(s2)U type nucleosides are evolutionarily conserved from bacteria to humans, so that the use of Escherichia coli to ascertain the biochemical and functional roles of such proteins may guide the study of their eukaryotic counterparts (11).
In E. coli, proteins MnmE and GidA form an
2β2 heterotetrameric complex that controls the formation of 5-carboxymethylaminomethyluridine (cmnm5U) in the wobble position of
,
,
,
,
and
(Figure 1) (12–14). In certain tRNAs (
,
and
), the cmnm5 group may be demodified to 5-aminomethyl (nm5) and subsequently methylated in an S-adenosyl-L-methionine (AdoMet) dependent step to produce methylaminomethyl (mnm5). Both reactions are carried out by the same enzyme called MnmC (13,15,16). Protein MnmA, together with the cysteine desulfurase IscS and sulfur transfer mediators TusA-E, is required for the thiolation at position 2 of the uridine that occurs in
,
,
(17,18). Modifications at the 2- and 5-positions occur independently of each other. Meanwhile, the function of MnmA and MnmC in tRNA modification is rather well understood, the precise role of proteins MnmE and GidA remains unknown and it is unclear how many steps precede the formation of the cmnm5 group (Figure 1).
|
Results obtained in vivo have shown that both the MnmE GTPase activity as well as the GidA FAD-binding activity is necessary for tRNA modification (14,19–21). Biochemical and structural studies indicated that MnmE binds 5'-formyl-tetrahydrofolate, which was proposed to be the one-carbon group donor in the modification reaction (22). Data obtained from mutants where different steps of the tetrahydrofolate (THF) pathway were interrupted indicated that the C5-methylene moiety of mnm5U or cmnm5U is derived from this pathway, although apparently not from 5-formyl-THF or methyl-THF (T. Suzuki and T. Suzuki, 22nd tRNA workshop, Sweden, 2007). Therefore, the one-carbon group donor remains uncertain. In contrast, glycine was reported to be directly incorporated into the cmnm-group of cmnm5U in vivo (T. Suzuki and T. Suzuki, 22nd tRNA workshop, Sweden, 2007). Curiously, taurine (
) is incorporated into human mitochondrial tRNALys and tRNALeu(UUR) in place of cmnm (23). This led to the hypothesis that proteins of the MnmE and GidA families jointly catalyze the formation of an unknown intermediate in the modification pathway of the wobble uridine, whereas the subsequent activity of a taurine or glycine transferase would be responsible for construction of the
m5 group in humans, or the cmnm5 group in yeast and bacteria (14,23,24; Figure 1). However, there is no evidence for this independent, second step. For example, no bacterial or yeast mutants have been isolated where the putative intermediate produced by the MnmE and GidA proteins accumulates. Therefore, the possibility that the complex formed by these proteins drives all the reaction steps in the cmnm5/
m5-side chain synthesis cannot be ruled out. In this work, we use both in vitro and in vivo approaches to characterize the MnmEGidA-dependent pathway. Our results indicate that the MnmEGidA complex catalyzes two different tRNA modification reactions by which the nm and cmnm groups are incorporated into position 5 of the wobble uridine, without participation of any more proteins.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains, plasmids, growth conditions and protein techniques
Escherichia coli strains and plasmids used in this study are listed in Supplementary Table S1. Deletion of the mnmC and folE genes was performed by targeted homologous recombination as described (25) using primers shown in Supplementary Table S2. Deletion of the target gene was confirmed by PCR. The N-terminal FLAG-tagged mnmC gene was amplified by PCR from genomic DNA of MC1000 E. coli strain using the specific primers FLAG-MnmC(F) (GACTATAAAGACGACGACGACAAAAAACACTACTCCATACAACC, FLAG sequence underlined) and FLAG-MnmC(R) (TTACCCCGCCTTAACCGCTTTACCCTTCAAC), and cloned into pBAD TOPO TA under the ParaC promoter, producing pIC1253. LBT (Luria–Bertani broth containing 40 mg/ml thymine) and LAT (LBT containing 20 g of Difco agar per litre) were used for routine cultures and plating of E. coli. When required, antibiotics were added at the following concentrations: 100 µg/ml of ampicillin, 12.5 µg/ml of tetracycline, and 25 µg/ml of kanamycin. Cell growth was monitored by measuring the optical density (OD) of the cultures at 600 nm. Recombinant proteins were purified according to standard procedures. Unless otherwise specified, protein MnmE and FLAG-GidA was purified from a gidA::Tn10 mutant (strain IC5923) and mnmE::kan mutant (strain IC5924), respectively.
MnmEGidA heterotetramer formation
To obtain the MnmEGidA heterotetramer, 10 µM final concentration of the MnmE and FLAG-GidA proteins were mixed in 40 µl of the following buffer: 50 mM Tris–HCl (pH 7.5), 50 mM KCl, 10 mM magnesium acetate, 5 mM DTT, 5 mM MgCl2 and 3% glycerol. The mix was incubated at room temperature (20–22°C) for
2 h.
Isothermal titration calorimetry assay
Binding affinity of THF derivatives to MnmE was determined by isothermal titration calorimetry (ITC) in a MicroCal VP-ITC isothermal titration calorimeter (MicroCal, Northampton, MA, USA). Calorimetric experiments consisted of the titration of a 20–30 µM MnmE solution with a 300–450 µM solution of the THF derivative at 25°C in 50 mM Tris–HCl pH 7.5, 100 mM KCl, 5 mM MgCl2 and 2 mM β-mercaptoethanol. To obtain the Kd, the data were fitted using software developed at the BIFI and implemented in Origin 7.0 (OriginLab).
In vitro transcription of E. coli tRNALys
Unmodified E. coli tRNALys was prepared by in vitro transcription of BstNI-digested plasmid (pUC19-tRNALys, 26) using the Riboprobe T7-transcription kit (PROMEGA). Each reaction was performed in a final volume of 50 µl containing 40 mM Tris–HCl buffer, pH 7.9, 10 mM MgCl2, 2 mM spermidine, 10 mM NaCl, 10 mM DTT, 50 U of recombinant RNasin ribonuclease inhibitor, 2.5 mM each ribonucleotide (or 2.5 mM each rATP, rGTP and rCTP, 0.1 mM rUTP and 125 µCi [
-32P]-rUTP [20 µCi/µl, 800 mCi/mmol], when radiolabeled tRNA was required), 2 µg of BstNI-digested plasmid, 50 U of T7-RNA polymerase and RNase-free water. The mix was incubated under mild agitation for 3 h at 37°C. At the end of the incubation period, DNA template was digested by addition of a few units of RNase-free DNase Q1 followed by an extra incubation at 37°C for 5 min. Finally, 100 µl of 0.3 M sodium acetate were added to the tube, and the radiolabeled tRNA was extracted with an equal volume (150 µl) of water-saturated phenol–chloroform–isoamyl alcohol (25:24:1), ethanol-precipitated and dried. The transcribed tRNALys was resuspended in RNase-free water and the removal of unincorporated nucleotides was performed using Micro Bio-Spin 6 Chromatography Columns (Sephadex G25 column, BioRad).
Isolation of bulk tRNA from E. coli
Bacterial strains were grown in LBT broth at 37°C to about 5 x 108 cells/ml. The cells were lysed, and total RNA was prepared (27), dissolved in R200 buffer (100 mM Tris–H3PO4, pH 6.3, 15% ethanol, 200 mM KCl), and applied to a Nucleobond column (AX500) equilibrated with the same buffer. The column was washed with 6 ml of R200 and 2 ml of R650 buffer (same as R200 buffer except that the KCl concentration was 650 mM). tRNA was eluted with 7 ml of buffer R650 and precipitated with 0.7 volume of cold isopropanol, washed twice with 70% ethanol, dried, dissolved in water and quantified in a NanoDrop spectrophotometer. Note that LB broth is deficient in selenium; therefore, MnmE/GidA-specific tRNAs isolated from strains grown in this medium mostly carry sulphur at position 2.
Determination of the MnmEGidA enzymatic activity
To perform the modification in vitro of labelled tRNALys by the E. coli MnmEGidA complex, the following mix was made, unless otherwise specified, in 100 µl final volume: 30 000 c.p.m. (counts per minute) of radioactive tRNALys in Buffer A (100 mM Tris–HCl pH 8, 100 mM Ammonium acetate, 5 mM MgCl2, 5% Glycerol, 5 mM DTT, 0.5 mM FAD, 0.5 mM NADH, 0.5 mM NADPH, 2 mM GTP, 1 mM methylene-THF and 10 µg BSA). Glycine, alanine and serine were used at 2 mM. All cofactor solutions were freshly prepared just before use and protected from light. The enzymatic reaction was started by addition of the purified enzymes (2 µM final concentration, unless otherwise specified). A blank without enzymes was always included in each series of experiments. The reaction mixture was incubated at 37°C for 40 min with mild agitation. Then, the radiolabeled tRNA was phenol extracted, ethanol precipitated and digested with nuclease P1. The resulting nucleotides (1 µl portions) were analyzed by bidimensional thin layer chromatography (2D-TLC) on cellulose plates using isobutyric acid/concentrated ammonia/water (66:1:33 [v:v:v]) as the first dimension solvent (solvent A, 4 h), and 100 mM sodium phosphate buffer, pH 6.8/(NH4)2SO4/n-propanol (100/60/2, v/w/v) (solvent B, 4 h) or isopropanol/concentrated HCl/water (68/18/14, v/v/v) (solvent C, 6 h 30 min) as the second dimension solvent.
To perform the modification in vitro of total tRNA by MnmEGidA, we used the same procedure as above with the following modifications: the reaction mix was prepared in 200 µl of final volume and contained 40 µg of total tRNA purified from strain IC5653 (an mnmE gidA double mutant). At the end of the reaction, tRNA was phenol extracted, ethanol precipitated, degraded to nucleotides with nuclease P1 and, finally, treated with bacterial alkaline phosphatase. The resulting hydrolysate was analyzed by HPLC using a Develosil C30 column (250 x 4.6 mm; Phenomenex Ltd). The chromatographic conditions for gradient elution were essentially as described earlier (28). Given that total tRNA was extracted from a strain where the 2-thiouridylase MnmA protein is active, absorbance could be monitored at 314 nm to maximize the detection of thiolated nucleosides.
Determination of the MnmC enzymatic activity
The tRNA previously modified by MnmEGidA complex was phenolysed, ethanol precipitated and incubated with 2 µM FLAG-MnmC protein in 200 µl (total volume) of MnmC buffer {50 mM Tris–Cl (pH 8.0), 50 mM Ammonium acetate, 40 µM [methyl-14C]AdoMet (60 mCi/mmole) or 0.5 mM cold SAM, 0.5 mM FAD, 5% glycerol}. After 40 min of incubation at 37°C, the tRNA was recovered by phenolization and ethanol precipitation, and digested by nuclease P1 (and by E. coli alkaline phosphatase when appropriated). The resulting products were analyzed by 2D-TLC on a cellulose plate (or by reverse-phase HPLC) as described earlier.
| RESULTS |
|---|
|
|
|---|
Study of the MnmEGidA modification activity using in vitro synthesized tRNALys and TLC analysis
To determine whether the recombinant MnmEGidA complex displays tRNA modification activity, we developed an in vitro modification assay where the independent contribution of the MnmEGidA complex and its putative substrates and cofactors could be assessed. Basically, the reaction mix contained recombinant proteins, 32P-labeled tRNALys, GTP, FAD and NADH/NADPH. In addition, we included methylene-THF as the first-choice carbon donor because its affinity for MnmE, while similar to that of the remaining THF derivatives (Kd
1 µM) as determined by ITC, displays a slightly more favourable enthalpy, suggestive of a better interaction (Table 1). After incubation of the reaction mix, the tRNA was hydrolyzed by nuclease P1 and analyzed by 2D-TLC. Figure 2 shows that a major spot corresponding to nucleotide pU was obtained in the absence of any protein (panels A1 and B1), and that one additional compound (C1) appeared after addition of either MnmE or FLAG-GidA (Figure 2, panels A2 and B2). Interestingly, when the assay was performed in the presence of the MnmEGidA complex, a new compound, named C2, was also detected (Figure 2, panels A3 and B3). Formation of C2, but not C1, was absolutely dependent on the presence of FAD and GTP (Supplementary Figure S1), which suggests that only C2 is related to the MnmEGidA pathway.
|
|
Next, we analyzed the role of glycine in the in vitro modification reaction. Addition of this amino acid, but not alanine or serine, led to disappearance of C2 and production of a new compound, designated C3 (Figure 2, panels A4 and B4, and Supplementary Figure S2). Formation of C3 was also dependent on inclusion of both GTP and FAD in the reaction mix (Supplementary Figure S2). According to reference maps (29), C3 corresponds to cmnm5U 5'-monophosphate (pcmnm5U), but C2 cannot be assigned.
MnmC converts nucleotides C2 and C3 (pcmnm5U) to mnm5U 5'-monophosphate (pmnm5U)
MnmC is a bifunctional enzyme whose C-terminal domain catalyzes demodification of cmnm5(s2)U to nm5(s2)U, whereas its N-terminal domain independently methylates nm5(s2)U to form the final product mnm5(s2)U (16; Figure 1). Therefore, considering that cmnm5U and nm5U are substrates for MnmC, we decided to use this enzyme to investigate the nature of compounds C2 and C3 (pcmnm5U) generated by the MnmEGidA activity. tRNALys, previously modified in vitro by MnmEGidA (in the presence or not of glycine), was incubated with protein FLAG-MnmC, in a buffer containing FAD and SAM (Figure 3A). Subsequently, the tRNA was hydrolyzed using nuclease P1 and the resulting nucleotides were analyzed by TLC. Interestingly, C2 and most of C3 (pcmnm5U) disappeared, whereas two new compounds migrating as pmnm5U (C4) and pm5U (C5), according to previous chromatographic diagrams (29), were generated (Figure 3A, compare panels 2 and 3 with 4 and 5, respectively). Synthesis of m5U could be explained if our MnmC preparation contained traces of TrmA, which catalyzes the SAM-dependent methylation of the uracil in position 54 in all E. coli tRNAs. Note that the compound labeled with an asterisk in panel 4 of Figure 3A is already present in other chromatograms, with variable relative intensity. Thus, we think it is a product of either an unusual cleavage or tRNA degradation.
|
Conversion of C3 to pmnm5U (C4) by MnmC (Figure 3A, panels 3 and 5) is in agreement with our prediction that C3 is pcmnm5U. Conversion of C2 to pmnm5U (C4) (Figure 3A, panels 2 and 4) suggests that C2 is pnm5U since it works as a substrate for MnmC but does not exhibit the chromatographic mobility of pcmnm5U. If so, this is surprising because it has never before been reported that nm5U may be a direct product of the MnmEGidA complex activity.
To further explore the capability of MnmC to work on the C2 nucleotide produced by MnmEGidA, we proceeded as follows (Figure 3B). Five micrograms of unlabeled in vitro transcribed tRNALys were incubated in buffer A with MnmEGidA and [methyl-14C]AdoMet, in the absence of glycine, to form C2 (pnm5U), according to our previous results (Figure 3A, panel 2). In this case, production of pnm5U could not be detected (Figure 3B, panel 2) because the in vitro transcribed tRNA used as substrate was unlabelled, and [methyl-14C]AdoMet does not work as a methyl donor in the formation of nm5U by MnmEGidA. Then, the tRNA modified by the MnmEGidA complex was incubated with MnmC, FAD and [methyl-14C]AdoMet, hydrolyzed and analyzed by TLC. As shown in Figure 3B, panel 3, a radioactive compound whose migration characteristics correspond to those of pmnm5U could be detected. Moreover, 15 µg of total tRNA isolated from either an mnmE gidA double mutant (strain IC5653; Figure 3C) or a wild-type strain (MG1655; Figure 3D) were treated in the same way as in Figure 3B. Addition of MnmC, FAD, and 14C-radiolabeled SAM to total tRNA previously modified in vitro by the MnmEGidA complex (in the absence of glycine, i.e. under conditions where only the nucleotide corresponding to C2, pnm5U, is formed) produced compounds whose migration characteristics are those of pmnm5U and pmnm5s2U (Figure 3C and D). The tRNAs isolated from the wild-type strain that are substrates for MnmEGidA/MnmC are mostly modified, which may explain the less amount of labeled products obtained in this case (compare Figure 3C and D). Altogether these experiments support that MnmC transforms nucleotide C2 (pnm5U), produced by MnmEGidA in the absence of glycine, to pmnm5U.
Ammonium ion or glycine may be used by the MnmEGidA complex to synthesize nm5U or cmnm5U, respectively
If compound C2 is pnm5U, we wondered whether ammonium is the source of its amine group, given that the nucleotide is synthesized in the absence of glycine. Figure 4 shows that removal of ammonium acetate from the reaction buffer prevents formation of C2 (compare panels B and C). It is important to note that stimulation of the MnmE GTPase activity (which is essential for the modifying function of this protein; 20) requires potassium or ammonium ions (30). In the in vitro modification reaction, potassium ions are present, at least, 10 mM due to the addition of the MnmEGidA complex (whose formation is carried out in a buffer containing 50 mM KCl). This concentration might be suboptimal for efficient stimulation of the MnmE GTPase activity (31), explaining that elimination of ammonium from the reaction mix impairs the in vitro tRNA modification reaction. However, when ammonium acetate was substituted by potassium acetate, the modification reaction does not work either, given that C2 (pnm5U) is not produced (Figure 4D). The same result was obtained when sodium acetate was the substituent (Figure 4E). Interestingly, when ammonium ions are removed but glycine is added, C3 (pcmnm5U), but not C2 (pnm5U), is formed (Figure 4F). Considering that the synthesis of both nucleotides requires the presence of GTP (Supplementary Figures S1 and S2), we conclude that 10 mM KCl is enough to stimulate the MnmE activity and that ammonium may be used by the MnmEGidA complex to synthesize the nm5 group. Moreover, given that C3 (pcmnm5U) may be obtained when glycine, but not ammonium, is present in the buffer (Figure 4F), we propose that C2 (pnm5U) is not an intermediate in the C3 (pcmnm5U) formation and that synthesis of both compounds is mediated by MnmEGidA through different and independent pathways (Figure 5). Strikingly, only compound C3 (pcmnm5U) is produced when ammonium and glycine are simultaneously present in the reaction mix (Figure 2, panels A4 and B4). Therefore, we think that the glycine-dependent reaction is competitively more effective under the conditions used in these assays.
|
|
Reverse-phase HPLC analysis of total E. coli tRNA modified in vitro by the MnmEGidA complex
To confirm the TLC data and further investigate how proteins MnmE, GidA and MnmC work, we performed the in vitro modification assay using total tRNA purified from a double mutant mnmE gidA instead of the in vitro transcribed tRNALys. In this case, the resulting tRNA was analyzed, after digestion with nuclease P1 and alkaline phosphatase, by HPLC, using some purified nucleosides as controls (Figure 6A). Previous HPLC analysis of tRNA purified from null mnmE or gidA mutants (where protein MnmA is active) revealed accumulation of s2U and disappearance of mnm5s2U in the corresponding chromatograms (14). In this work, we observed that s2U remained accumulated after performing the in vitro modification reaction in the absence of the MnmEGidA complex (Figure 6B). However, when this complex was added to a reaction mix containing ammonium but not glycine, s2U was converted into nm5s2U (Figure 6C). Note that ammonium was indispensable for this conversion since s2U remained accumulated in the absence of the cation (Figure 6D). Moreover, when the reaction mix contained glycine but not ammonium, s2U was partially converted into cmnm5s2U, whereas no production of nm5s2U was observed (Figure 6E). Altogether these results support the idea that the MnmEGidA complex catalyzes the in vitro biosynthesis of nm5s2U and cmnm5s2U in E. coli tRNA through two independent reactions and without participation of other proteins.
|
Curiously, both cmnm5s2U and nm5s2U were detected after the simultaneous addition of ammonium and glycine to the reaction mix (Figure 6F). This result differs from that obtained when the MnmEGidA complex activity was analyzed using in vitro synthesized tRNALys and TLC. In such a case, pcmnm5U was the only product detected when both ammonium and glycine were included in the reaction (compound C3 in Figure 2, panels A4 and B4), in spite of we detected formation of pnm5U (C2) if only ammonium was present (Figure 2, panels A3 and B3). Thus, it seems that the glycine-dependent reaction is competitively more effective when the in vitro synthesized tRNALys is the substrate. Considering that this tRNA is completely unmodified, in contrast to the total tRNA purified from the mnmE gidA strain (Figure 6), it is tempting to speculate that some tRNA modification(s) outside the 5-position of U34 modulate the efficiency of the reactions mediated by the MnmEGidA complex.
To firmly establish the identities of the nucleosides resulting from the in vitro MnmEGidA activity, we again analyzed their ability to be used as substrates by the bifunctional enzyme MnmC. As expected, MnmC converted the peaks assigned to nm5s2U and cmnm5s2U into mnm5s2U (Supplementary Figure S3, compare panels B and D with C and E, respectively).
To further demonstrate that nm5U is not an intermediate in the synthesis of cmnm5U mediated by MnmEGidA, the bulk tRNA purified from an mnmC2 mutant (where nm5s2U accumulates) was used as substrate for an in vitro modification reaction mediated by MnmEGidA in the presence of glycine (with or without ammonium) and, as expected, no conversion of nm5s2U to cmnm5s2U was observed (Supplementary Figure S4). In addition, we used total tRNA extracted from an mnmE gidA mutant as substrate in a reaction catalyzed by MnmEGidA in the presence of ammonium (Figure 7). After phenol extraction and ethanol precipitation, the resulting tRNA, which carried nm5s2U (Figure 7B), was mixed with MnmEGidA and glycine (in the presence or absence of ammonium). The HPLC pattern of the tRNA remained unaltered after this second reaction (Figure 7C), supporting that nm5s2U is not a substrate for MnmEGidA.
|
Finally, we thought that if the MnmEGidA activity is able to introduce the nm5 group at the wobble uridine, the modified nucleoside should be found in the tRNA isolated from a null mnmC mutant. As expected, HPLC analysis of tRNA from an mnmC::kan strain revealed the presence of nm5s2U, in addition to cmnm5s2U, in the hydrolysates (Figure 6G). Curiously, this nucleoside was previously not identified in tRNA from an mnmC1 mutant (13), which we now know carries a nonsense mutation in the mnmC gene. Here, we have carefully analyzed the tRNA extracted from mutant mnmC1 and detected the presence of nm5s2U (Figure 6H). Whether such a discrepancy may be due to the different growth medium used in each case is a question that remains to be explored.
Involvement of FAD and NADH in the tRNA modification reaction
Mutations affecting the FAD-binding domain of GidA impair tRNA modification in vivo (14, 21). Here, we have shown that FAD is essential for the in vitro modification reaction (Supplementary Figures S1 and S2). It was previously postulated that GidA-bound reduced FAD is required for the last step in the synthesis of the cmnm5-group, and that GidA-bound FAD receives its electrons from NADH, given that GidA binds NADH but not NADPH (22,32). Curiously, we have found that NADH (or NADPH) does not seem to be necessary for the synthesis in vitro of nm5s2U and cmnm5s2U if FAD is present at a high concentration (1 mM) (Figure 8A and B). Note that appropriate control experiments indicate that nm5s2U and cmnm5s2U do not accumulate if FAD is removed, though NADH or NADPH remains in the reaction mix. Synthesis of nm5s2U and cmnm5s2U is drastically reduced when FAD is used at 2 µM (Figure 8C and D). However, under such conditions, the addition of NADH (but not NADPH) at 0.5 mM substantially improves the nm5s2U and cmnm5s2U synthesis, mainly of the last one (Figure 8C and D). These results suggest that NADH may play a critical role in tRNA modification depending on cell FAD concentrations.
|
Curiously, it has been reported that TrmFO, a GidA paralogue involved in the FAD-, NADPH- and methylene-THF-dependent methylation of uridine at position 54 of tRNAs, is able to catalyze the in vitro modification reaction in the absence of NADPH (33). Given that NADPH is thought to be required for FAD reduction, the mentioned finding was attributed to copurification of the enzyme with the oxidized and reduced forms of flavin. In this respect, it should be mentioned that we have used dialyzed proteins to perform the experiments shown in Figure 8. Considering the relatively low affinity of GidA for FAD (Kd
3 µM; our own unpublished results) and NADH (Kd
11 µM; 32), we find it unlikely that the dialyzed GidA protein used in our experiments carried these cofactors.
MnmEGidA uses methylene-THF to form the C5-methylene moiety of nm5U and cmnm5U
While studying the requirements for the in vitro synthesis of nm5U by MnmEGidA, we observed that removal of methylene-THF from the reaction mix did not affect the accumulation of the modified nucleoside. This suggests that MnmE copurifies with the one-carbon unit donor, a behavior that has also been observed for TrmFO (34,35). To overcome this difficulty and further investigate the carbon donor used by MnmEGidA, we first constructed a folE::cat mutant. folE encodes GTP cyclohydrolase I, which is the first enzyme of the de novo THF pathway (36). HPLC analysis of tRNAs purified from the folE::cat mutant revealed the disappearance of nucleoside mnm5s2U and accumulation of s2U, in relation to the wild-type strain (Table 2). This finding supports that THF works as the one-carbon unit donor in the MnmEGidA modification pathway. Then, strain folE::cat was independently transformed with plasmids expressing proteins GST-MnmE and FLAG-GidA with the aim to purify both proteins from cells where THF is presumably very limited, since only some folate-related salvage pathway may be active (36). Finally, an in vitro modification assay was performed with bulk tRNA extracted from an mnmE gidA double mutant and proteins purified from the folE::cat strain. The relative accumulation of nm5s2U and s2U observed under different concentrations of the MnmEGidA complex and folate derivatives is shown in Table 3. Curiously, when no external source of folate is included in the reaction mix (see entry Proteins/No folates in Table 3), nm5s2U still accumulates if the MnmEGidA complex is added to 2 µM (Table 3, column A). This suggests that the amount of protein MnmE that is added to the mix still provides a concentration of the one-carbon unit donor that is enough to lead the in vitro modification of tRNA. Accordingly, when the concentration of MnmEGidA in the mix is reduced from 2 to 0.35 µM (Table 3, column B), no significant conversion of s2U to nm5s2U is observed in the absence of exogenous folate. Moreover, if under such conditions, the folate derivative is added to 50 µM, major increases of nm5s2U are only seen with methylene-THF, THF or methyl-THF. These results help us to discard 5-formyl-, 10-formyl- and methenyl-THF as the one-carbon unit donor. However, given that no one-carbon unit is carried by THF, it is possible that our preparation of this compound contained traces of the true one-carbon unit donor, which may be methylene-THF or methyl-THF. We assume that traces of one of them are also present in the other one, explaining that the in vitro reaction works with both substrates. The use of the folate derivative at 1 µM (Table 3, column C) still led to the production of nm5s2U in the case of THF, methylene-THF and methyl-THF, with methylene-THF appearing to be slightly more effective. A further decrease in the concentration of these derivatives did not lead to conclusive results since the efficiency of the reaction was drastically reduced (data not shown), probably because the affinity of MnmE for them is in the low micromolar range (Table 1).
|
|
glyA and metF mutations block the synthesis of 5-formyl-THF and methyl-THF, respectively. Considering that the in vivo 13C incorporation from glycine to mnm5s2U takes place in glyA and metF mutants similarly to the wild-type strain, it was suggested that 5-formyl-THF and methyl-THF are not the direct substrates to form the C5-methylene moiety of mnm5s2U (T. Suzuki and T. Suzuki, 22nd tRNA workshop, Sweden, 2007). We have verified such a proposal, finding that mnm5s2U accumulates in glyA and metF null mutants at the wild-type level (Table 2). These results, together with those shown in Table 3, prompt us to conclude that methylene-THF is the one-carbon unit donor in the modification reaction catalyzed by MnmEGidA. If so, data from Table 3 also suggest that there is no substrate inhibition with THF and methyl-THF since nm5s2U accumulates even when both compounds are added at 1 mM (final concentration) and, according to our hypothesis, methylene-THF should be a minor contaminant in the respective preparations. This behaviour is different from that described for TrmFO, whose methylene-THF-dependent activity is inhibited by concentrations of THF higher than 2 µM (33). Given that the affinity of MnmE for all THF derivatives tested is similar (Table 1), we think that either the binding to methylene-THF is kinetically favored or the affinity for this derivative significantly increases when MnmE is bound to its partners.
| DISCUSSION |
|---|
|
|
|---|
To characterize the enzymatic pathway of mnm5U biosynthesis in E. coli, we have purified proteins MnmE, GidA and MnmC and checked their ability to modify tRNA in vitro. Our results show, for the first time, that the MnmEGidA complex catalyses the synthesis of nm5U and cmnm5U in tRNA through two independent reactions (Figures 3A and 6), in which ammonium and glycine are the source of the amino and carboxymethylamino moiety, respectively (Figure 5). The identity of the nucleosides synthesized by the MnmEGidA complex in vitro (nm5U and cmnm5U) was confirmed by the fact that, in a buffer containing FAD and SAM, they were transformed to mnm5U by a recombinant MnmC protein (Figure 3 and Supplementary Figure S3). In vivo results also indicated that nm5U is a direct product of the MnmEGidA activity because a peak corresponding to this nucleoside could be clearly identified in the HPLC analysis of total tRNA extracted from an mnmC mutant (Figure 6G and H). It should be emphasized that nm5U is a final product, and not a stable intermediate, of the MnmEGidA activity since it is not a substrate for this complex both in vitro (Figure 7 and Supplementary Figure S4) as well as in vivo (Figure 6G and H; note in these panels that nm5U accumulates in an mnmC mutant where the MnmEGidA complex is active). Therefore, the pathway controlled by MnmE and GidA may be reformulated as shown in Figure 5 and, more schematically, 9A.
We have previously shown that the GTPase activity of MnmE and the FAD-binding ability of GidA are required for tRNA modification in vivo (14, 19, 20). Here, we demonstrate that the two in vitro reactions catalyzed by MnmEGidA are GTP- and FAD-dependent (Supplementary Figures S1 and S2), suggesting that the synthesis of nm5U and cmnm5U share a similar mechanism.
Biochemical and structural studies previously indicated that MnmE binds 5'-formyl-THF (22). Consequently, a tRNA modification mechanism based on the formyl transfer onto C5 of the wobble uridine was proposed (22). However, we have found here that MnmE exhibits a similar affinity for different THF derivatives, including 5'-formyl-THF (Table 1), which questions the role of this compound as the one-carbon unit donor in the modification reaction. We have analyzed the nucleoside composition of tRNA extracted from mutants where the THF pathway is inactivated at different stages. Our data support the idea that the C5-methylene moiety of xm5(s2)U nucleosides is derived from the THF pathway, since s2U accumulates in a folE mutant, although not from 5-formyl- or methyl-THF, since the level of mnm5s2 in glyA and metF mutants is similar to that of the wild-type strain (Table 2). Moreover, we have performed in vitro modification assays in the presence of different THF derivatives (Table 3). Our data indicate that neither 5-formyl-, 10-formyl- or methenyl-THF is likely to be the one-carbon unit donor in the modification reaction. Altogether, these results prompt us to conclude that methylene-THF is the source of the C5 methylene moiety of nm5U and cmnm5U.
We have shown that NADH is dispensable for the in vitro function of MnmEGidA unless FAD levels are limiting (Figure 8). This suggests that FAD undergoes an oxidation-reduction cycle during synthesis of nm5U and cmnm5U (Figure 9B). In such a cycle, FAD receives electrons from other participant in the reaction and, subsequently, donates them to some reaction intermediate. Probably, there is a spontaneous oxidation of the reduced FAD during the in vitro modification that may explain, together with the low affinity of GidA for FAD (Kd
3 µM, our own unpublished results), the low efficiency of the reaction when FAD is used at 2 µM. Under these circumstances, addition of NADH would facilitate production of the reduced FAD, improving the second step of the FAD cycle associated with the reduction of some reaction intermediate. Based on these considerations, we propose a novel catalytic mechanism for the nm5U and cmnm5U modification process (Figure 9C), where a general acid of MnmEGidA converts the methylene-THF into a reactive iminium ion (step 1), in analogy to the reaction catalyzed by thymidylate synthase (37). This allows the addition of the amine or carboxymethylamine group to the methylene group at N5 of THF (step 2). Then, FAD-bound GidA performs a dehydrogenation reaction (step 3), facilitating the nucleophilic attack by the C5 atom of U34 (step 4), which has been activated, again in analogy with the thymidilate synthase reaction, through the attack at the C6 position of U34 by a general acid of the MnmEGidA complex. Later, FADH2 serves as the reducing agent of the Schiffs base (step 7). This step is followed by the liberation of the MnmEGidA complex and production of cmnm5U and nm5U. Our model involves that the THF-binding domain of MnmE and the FAD-binding domain of GidA should be close to the C5 position of the wobble uridine of tRNA. The structural rearrangements of the MnmEGidA heterotetramer that are coupled to the GTPase cycle of MnmE (32) and to the FAD binding of GidA (our own unpublished results) might help in the construction of the active center. Further biochemical and structural studies will be required to clarify the detailed mechanism of the MnmEGidA-dependent reactions.
|
MnmE and GidA, but not MnmC, are conserved proteins from bacteria to humans. The MnmE and GidA homologues in yeast (MSS1 and MTO1) and humans (GTPBP3 and MTO1) are nucleus-encoded proteins involved in modification of mitochondrial tRNAs (38–41). The lack of MnmC determines that, in yeast, the final product of the MSS1/MTO1 pathway is cmnm5U. In humans, taurine is incorporated into tRNAs in place of glycine, producing
m5U (23). Both nucleosides are probably synthesized in mitochondria by the MnmE and GidA homologues without the participation of other proteins, through a reaction similar to that described here. If so, the complex formed by the human homologues should be able to use taurine in place of glycine. It should be noted that GTPBP3 largely conserves the MnmE properties (11,42), which supports our proposal that the tRNA modification reaction catalyzed by the eukaryotic homologues should be basically similar to that performed by the E. coli proteins. The presence of nm5(s2)U in mitochondrial tRNA has not been reported so far. However, in the light of our results, we think this issue should be further explored. | SUPPLEMENTARY DATA |
|---|
|
|
|---|
Supplementary Data are available at NAR Online.
| FUNDING |
|---|
|
|
|---|
Ministerio de Ciencia e Innovación and Generalidad Valenciana (BFU2004-05819, BFU2007-66509, ACOMP/2009/348 and AP-079/09 to M.-E.A.); the Swedish Science Research Council (Project BU-2930); the Carl Trygger Foundation (to G.R.B.). Funding for open access charge: Ministerio de Ciencia e Innovación (grant BFU2007–66509 to M.-E.A.).
Conflict of interest statement. None declared.
| ACKNOWLEDGEMENTS |
|---|
We thank R. Moser (Merck-Eprova AG) and K. Tamura for their generous gifts of tetrahydrofolate derivatives and plasmid pUC-tRNALys, respectively. We also thank T. G. Hagervall, J. Näsvall and J. Timoneda for helpful discussions; and G. Jäger and K. Nilsson for their technical advices. I.M. was a recipient of a Bancaixa Research Contract and short-term fellowships from the Ministerio de Ciencia e Innovación and Generalidad Valenciana. S.P. and A.V.-C. were supported by a fellowship from the Ministerio de Ciencia e Innovación and a Research Contract from Fundación Aragón I + D, respectively.
| REFERENCES |
|---|
|
|
|---|
- Björk,G. and Hagervall,T. (2005) Transfer RNA modification. In Curtiss,R. III, Böck,A. Ingraham,J.I. Kaper,J.B. Maloy,S. Neidhardt,F.C. Riley,M.M. Squires, C.L. and Wanner,B.L. (eds), Escherichia coli and Salmonella: Cellular and Molecular Biology, [Online] http://www.ecosal.org. ASM Press, Washington DC.
- Agris PF. Bringing order to translation: the contributions of transfer RNA anticodon-domain modifications. EMBO Rep. (2008) 9:629–635.[CrossRef][Web of Science][Medline]
- Kurata S, Weixlbaumer A, Ohtsuki T, Shimazaki T, Wada T, Kirino Y, Takai K, Watanabe K, Ramakrishnan V, Suzuki T. Modified uridines with C5-methylene substituents at the first position of the tRNA anticodon stabilize UG wobble pairing during decoding. J. Biol. Chem. (2008) 283:18801–18811.
[Abstract/Free Full Text] - Hagervall TG, Pomerantz SC, McCloskey JA. Reduced misreading of asparagine codons by Escherichia coli tRNALys with hypomodified derivatives of 5-methylaminomethyl-2-thiouridine in the wobble position. J. Mol. Biol. (1998) 284:33–42.[CrossRef][Web of Science][Medline]
- Krüger MK, Pedersen S, Hagervall TG, Sørensen MA. The modification of the wobble base of tRNAGlu modulates the translation rate of glutamic acid codons in vivo. J. Mol. Biol. (1998) 284:621–631.[CrossRef][Web of Science][Medline]
- Urbonavicius J, Qian Q, Durand JM, Hagervall TG, Björk GR. Improvement of reading frame maintenance is a common function for several tRNA modifications. EMBO J. (2001) 20:4863–4873.[CrossRef][Web of Science][Medline]
- Kirino Y, Yasukawa T, Ohta S, Akira S, Ishihara K, Watanabe K, Suzuki T. Codon-specific translational defect caused by a wobble modification deficiency in mutant tRNA from a human mitochondrial disease. Proc. Natl Acad. Sci. USA (2004) 101:15070–15075.
[Abstract/Free Full Text] - Björk GR, Huang B, Persson OP, Byström AS. A conserved modified wobble nucleoside (mcm5s2U) in lysyl-tRNA is required for viability in yeast. RNA (2007) 13:1245–1255.
[Abstract/Free Full Text] - Johansson MJ, Esberg A, Huang B, Björk GR, Byström AS. Eukaryotic wobble uridine modifications promote a functionally redundant decoding system. Mol. Cell Biol. (2008) 28:3301–3312.
[Abstract/Free Full Text] - Kirino Y, Suzuki T. Human mitochondrial diseases associated with tRNA wobble modification deficiency. RNA Biol. (2005) 2:41–44.[Medline]
- Villarroya M, Prado S, Esteve JM, Soriano MA, Aguado C, Pérez-Martínez D, Martínez-Ferrandis JI, Yim L, Victor VM, Cebolla E, et al. Characterization of human GTPBP3, a GTP-binding protein involved in mitochondrial tRNA modification. Mol. Cell Biol. (2008) 28:7514–7531.
[Abstract/Free Full Text] - Elseviers D, Petrullo LA, Gallagher PJ. Novel E. coli mutants deficient in biosynthesis of 5-methylaminomethyl-2-thiouridine. Nucleic Acids Res. (1984) 12:3521–3534.
[Abstract/Free Full Text] - Hagervall TG, Edmonds CG, McCloskey JA, Björk GR. Transfer RNA(5-methylaminomethyl-2-thiouridine)-methyltransferase from Escherichia coli K-12 has two enzymatic activities. J. Biol. Chem. (1987) 262:8488–8495.
[Abstract/Free Full Text] - Yim L, Moukadiri I, Björk GR, Armengod M.-E. Further insights into the tRNA modification process controlled by proteins MnmE and GidA of Escherichia coli. Nucleic Acids Res. (2006) 34:5892–5905.
[Abstract/Free Full Text] - Bujnicki JM, Oudjama Y, Roovers M, Owczarek S, Caillet J, Droogmans L. Identification of a bifunctional enzyme MnmC involved in the biosynthesis of a hypermodified uridine in the wobble position of tRNA. RNA (2004) 10:1236–1242.
[Abstract/Free Full Text] - Roovers M, Oudjama Y, Kaminska KH, Purta E, Caillet J, Droogmans L, Bujnicki JM. Sequence-structure-function analysis of the bifunctional enzyme MnmC that catalyses the last two steps in the biosynthesis of hypermodified nucleoside mnm5s2U in tRNA. Proteins (2008) 71:2076–2085.[CrossRef][Web of Science][Medline]
- Kambampati R, Lauhon CT. MnmA and IscS are required for in vitro 2-thiouridine biosynthesis in Escherichia coli. Biochemistry (2003) 42:1109–1117.[CrossRef][Web of Science][Medline]
- Ikeuchi Y, Shigi N, Kato J, Nishimura A, Suzuki T. Mechanistic insights into sulfur relay by multiple sulfur mediators involved in thiouridine biosynthesis at tRNA wobble positions. Mol. Cell (2006) 21:97–108.[CrossRef][Web of Science][Medline]
- Yim L, Martínez-Vicente M, Villarroya M, Aguado C, Knecht E, Armengod M.-E. The GTPase activity and C-terminal cysteine of the Escherichia coli MnmE protein are essential for its tRNA modifying function. J. Biol. Chem. (2003) 278:28378–28387.
[Abstract/Free Full Text] - Martínez-Vicente M, Yim L, Villarroya M, Mellado M, Pérez-Payá E, Björk GR, Armengod M.-E. Effects of mutagenesis in the switch I region and conserved arginines of Escherichia coli MnmE protein, a GTPase involved in tRNA modification. J. Biol. Chem. (2005) 280:30660–30670.
[Abstract/Free Full Text] - Osawa T, Ito K, Inanaga H, Nureki O, Tomita K, Numata T. Conserved cysteine residues of GidA are essential for biogenesis of 5-carboxymethylaminomethyluridine at tRNA anticodon. Structure (2009) 17:713–724.[Medline]
- Scrima A, Vetter IR, Armengod M.-E, Wittinghofer A. The structure of the TrmE GTP-binding protein and its implications for tRNA modification. EMBO J. (2005) 24:23–33.[CrossRef][Web of Science][Medline]
- Suzuki T, Suzuki T, Wada T, Saigo K, Watanabe K. Taurine as a constituent of mitochondrial tRNAs: new insights into the functions of taurine and human mitochondrial diseases. EMBO J. (2002) 21:6581–6589.[CrossRef][Web of Science][Medline]
- Umeda N, Suzuki T, Yukawa M, Ohya Y, Shindo H, Watanabe K, Suzuki T. Mitochondria-specific RNA-modifying enzymes responsible for the biosynthesis of the wobble base in mitochondrial tRNAs: implications for the molecular pathogenesis of human mitochondrial diseases. J. Biol. Chem. (2005) 280:1613–1624.
[Abstract/Free Full Text] - Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl Acad. Sci. USA (2000) 97:6640–6645.
[Abstract/Free Full Text] - Tamura K, Himeno H, Asahara H, Hasegawa T, Shimizu M. In vitro study of E. coli tRNA(Arg) and tRNA(Lys) identity elements. Nucleic Acids Res. (1992) 9:2335–2339.
- Emilsson V, Kurland CG. Growth rate dependence of transfer RNA abundance in Escherichia coli. EMBO J. (1990) 9:4359–4366.[Web of Science][Medline]
- Gehrke CW, Kuo KC. Ribonucleoside analysis by reversed-phase high-performance liquid chromatography. J Chromatogr. (1989) 471:3–36.[CrossRef][Web of Science][Medline]
- Grosjean H, Droogmans L, Roovers M, Keith G. Detection of enzymatic activity of transfer RNA modification enzymes using radiolabeled tRNA substrates. Methods Enzymol. (2007) 425:55–101.[Medline]
- Scrima A, Wittinghofer A. Dimerisation-dependent GTPase reaction of MnmE: how potassium acts as GTPase-activating element. EMBO J. (2006) 25:2940–2951.[CrossRef][Web of Science][Medline]
- Yamanaka K, Hwang J, Inouye M. Characterization of GTPase activity of TrmE, a member of a novel GTPase superfamily, from Thermotoga maritima. J. Bacteriol. (2000) 182:7078–7082.
[Abstract/Free Full Text] - Meyer S, Scrima A, Versées W, Wittinghofer A. Crystal structures of the conserved tRNA-modifying enzyme GidA: implications for its interaction with MnmE and substrate. J. Mol. Biol. (2008) 380:532–547.[CrossRef][Web of Science][Medline]
- Nishimasu H, Ishitani R, Yamashita K, Iwashita C, Hirata A, Hori H, Nureki O. Atomic structure of a folate/FAD-dependent tRNA T54 methyltransferase. Proc. Natl Acad. Sci. USA (2009) 106:8180–8185.
[Abstract/Free Full Text] - Urbonavicius J, Skouloubris S, Myllykallio H, Grosjean H. Identification of a novel gene encoding a flavin-dependent tRNA:m5U methyltransferase in bacteria: evolutionary implications. Nucleic Acids Res. (2005) 33:3955–3964.
[Abstract/Free Full Text] - Urbonavicius J, Brochier-Armanet C, Skouloubris S, Myllykallio H, Grosjean H. In vitro detection of the enzymatic activity of folate-dependent tRNA (Uracil-54,-C5)-methyltransferase: evolutionary implications. Methods Enzymol. (2007) 425:103–119.[CrossRef][Web of Science][Medline]
- de Crécy-Lagard V, El Yacoubi B, de la Garza RD, Noiriel A, Hanson AD. Comparative genomics of bacterial and plant folate synthesis and salvage: predictions and validations. BMC Genomics (2007) 8:245.[CrossRef][Medline]
- Finer-Moore JS, Santi DV, Stroud RM. Lessons and conclusions from dissecting the mechanism of a bisubstrate enzyme: thymidylate synthase mutagenesis, function, and structure. Biochemistry (2003) 42:248–256.[CrossRef][Web of Science][Medline]
- Decoster E, Vassal A, Faye G. Mss1, a nuclear-encoded mitochondrial GTPase involved in the expression of cox1 subunit of cytochrome-coxidase. J. Mol. Biol. (1993) 232:79–88.[CrossRef][Web of Science][Medline]
- Colby G, Tu M, Tzagoloff A. MTO1 codes for a mitochondrial protein required for respiration in paromomycin-resistant mutants of Saccharomyces cerevisiae. J. Biol. Chem. (1998) 273:27945–27952.
[Abstract/Free Full Text] - Li X, Guan MX. A human mitochondrial GTP binding protein related to tRNA modification may modulate phenotypic expression of the deafness-associated mitochondrial 12S rRNA mutation. Mol. Cell Biol. (2002) 22:7701–7711.
[Abstract/Free Full Text] - Li X, Li R, Lin X, Guan MX. Isolation and characterization of the putative nuclear modifier gene MTO1 involved in the pathogenesis of deafness-associated mitochondrial 12 S rRNA A1555G mutation. J. Biol. Chem. (2002) 277:27256–27264.
[Abstract/Free Full Text] - Cabedo H, Macián F, Villarroya M, Escudero JC, Martínez-Vicente M, Knecht E, Armengod M.-E. The Escherichia coli trmE (mnmE) gene, involved in tRNA modification, codes for an evolutionarily conserved GTPase with unusual biochemical properties. EMBO J. (1999) 18:7063–7076.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








