Skip Navigation

This Article
Right arrow Print PDF (321K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Neimark, H.
Right arrow Articles by Wihas, N. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neimark, H.
Right arrow Articles by Wihas, N. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1983, Vol. 11, No. 21 7569-7557
© 1983


CHEMISTRY

Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris

Harold Neimark, Janet Andersen+ and Nicholas E. Wihas+

Department of Microbiology and Immunology, College of Medicine, State University of New York Brooklyn, NY 11203 +Department of Microbiology, Stale University of New York Stony Brook, NY 11794, USA

Received August 9, 1983. Revised October 10, 1983. Accepted October 10, 1983.

The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5' GGAGAUACACCUGUUCCCAUGAACACAGAAGUUAAGUCCAUCUACGGCGGAAGUACUUGGGGGUUGCCCCCUGGGAGAUAUGCGAGUGGCCAAGU OH 3'.Comparison of the S. cremoris 5S RNA sequence to an updated prokaryotic generalized 5S RNA structural model shows that this 5S RNA contains some unusual structural features. These features result largely from uncommon base substitutions in helices I, II and IV. Some of these unusual structural features are shared by several of the known 5S RNA sequences from mycoplasmas. However, the characteristic bloc of deletions found in helix V of these mycoplasma 5S RNAs is not present in the 5S RNA of S. cremoris.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.