Skip Navigation

This Article
Right arrow Full Text Freely available
Right arrow Print PDF (834K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (32)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Shi, H.
Right arrow Articles by Teng, C. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, H.
Right arrow Articles by Teng, C. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, Vol 27, Issue 24 4807-4815, Copyright © 1999 by Oxford University Press


ARTICLES

Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter

H Shi, Z Zhang, X Wang, S Liu and CT Teng
Gene Regulation Group, Laboratory of Reproductive and Development Toxicology, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC 27709, USA.

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C- terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'- UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto- ferrin gene promoter activity.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
P. Guo, X.-Y. Dong, X. Zhang, K.-W. Zhao, X. Sun, Q. Li, and J.-T. Dong
Pro-proliferative Factor KLF5 Becomes Anti-proliferative in Epithelial Homeostasis upon Signaling-mediated Modification
J. Biol. Chem., March 6, 2009; 284(10): 6071 - 6078.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. X. Du, A. B. Bialkowska, B. B. McConnell, and V. W. Yang
SUMOylation Regulates Nuclear Localization of Kruppel-like Factor 5
J. Biol. Chem., November 14, 2008; 283(46): 31991 - 32002.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Suzuki, T. Nishi, T. Nagino, K. Sasaki, K. Aizawa, N. Kada, D. Sawaki, Y. Munemasa, T. Matsumura, S. Muto, et al.
Functional Interaction between the Transcription Factor Kruppel-like Factor 5 and Poly(ADP-ribose) Polymerase-1 in Cardiovascular Apoptosis
J. Biol. Chem., March 30, 2007; 282(13): 9895 - 9901.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. X. Du, C. C. Yun, A. Bialkowska, and V. W. Yang
Protein Inhibitor of Activated STAT1 Interacts with and Up-regulates Activities of the Pro-proliferative Transcription Factor Kruppel-like Factor 5
J. Biol. Chem., February 16, 2007; 282(7): 4782 - 4793.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Tong, K. Czerwenka, G. Heinze, M. Ryffel, E. Schuster, A. Witt, S. Leodolter, and R. Zeillinger
Expression of KLF5 is a Prognostic Factor for Disease-Free Survival and Overall Survival in Patients with Breast Cancer
Clin. Cancer Res., April 15, 2006; 12(8): 2442 - 2448.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Suzuki, K. Aizawa, T. Matsumura, and R. Nagai
Vascular Implications of the Kruppel-Like Family of Transcription Factors
Arterioscler Thromb Vasc Biol, June 1, 2005; 25(6): 1135 - 1141.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Matsumura, T. Suzuki, K. Aizawa, Y. Munemasa, S. Muto, M. Horikoshi, and R. Nagai
The Deacetylase HDAC1 Negatively Regulates the Cardiovascular Transcription Factor Kruppel-like Factor 5 through Direct Interaction
J. Biol. Chem., April 1, 2005; 280(13): 12123 - 12129.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. W. Bateman, D. Tan, R. G. Pestell, J. D. Black, and A. R. Black
Intestinal Tumor Progression Is Associated with Altered Function of KLF5
J. Biol. Chem., March 26, 2004; 279(13): 12093 - 12101.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Aizawa, T. Suzuki, N. Kada, A. Ishihara, K. Kawai-Kowase, T. Matsumura, K. Sasaki, Y. Munemasa, I. Manabe, M. Kurabayashi, et al.
Regulation of Platelet-derived Growth Factor-A Chain by Kruppel-like Factor 5: NEW PATHWAY OF COOPERATIVE ACTIVATION WITH NUCLEAR FACTOR-{kappa}B
J. Biol. Chem., January 2, 2004; 279(1): 70 - 76.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Miyamoto, T. Suzuki, S. Muto, K. Aizawa, A. Kimura, Y. Mizuno, T. Nagino, Y. Imai, N. Adachi, M. Horikoshi, et al.
Positive and Negative Regulation of the Cardiovascular Transcription Factor KLF5 by p300 and the Oncogenic Regulator SET through Interaction and Acetylation on the DNA-Binding Domain
Mol. Cell. Biol., December 1, 2003; 23(23): 8528 - 8541.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
X. O. Yang, R. T. Doty, J. S. Hicks, and D. M. Willerford
Regulation of T-cell receptor D{beta}1 promoter by KLF5 through reiterated GC-rich motifs
Blood, June 1, 2003; 101(11): 4492 - 4499.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Z. Zhang and C. T. Teng
Phosphorylation of Kruppel-like factor 5 (KLF5/IKLF) at the CBP interaction region enhances its transactivation function
Nucleic Acids Res., April 15, 2003; 31(8): 2196 - 2208.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. T. Dang, W. Zhao, C. S. Mahatan, D. E. Geiman, and V. W. Yang
Opposing effects of Kruppel-like factor 4 (gut-enriched Kruppel-like factor) and Kruppel-like factor 5 (intestinal-enriched Kruppel-like factor) on the promoter of the Kruppel-like factor 4 gene
Nucleic Acids Res., July 1, 2002; 30(13): 2736 - 2741.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. A. Miller, E. A. Eklund, M. L. Peddinghaus, Z. Cao, N. Fernandes, P. W. Turk, B. Thimmapaya, and S. A. Weitzman
Kruppel-like Factor 4 Regulates Laminin alpha 3A Expression in Mammary Epithelial Cells
J. Biol. Chem., November 9, 2001; 276(46): 42863 - 42868.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Sun, X. Chen, and V. W. Yang
Intestinal-enriched Kruppel-like Factor (Kruppel-like Factor 5) Is a Positive Regulator of Cellular Proliferation
J. Biol. Chem., March 2, 2001; 276(10): 6897 - 6900.
[Abstract] [Full Text] [PDF]



Disclaimer: Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.