Nucleic Acids Research, Vol 27, Issue 24 4807-4815, Copyright © 1999 by Oxford University Press
H Shi, Z Zhang, X Wang, S Liu and CT Teng
The mouse lactoferrin gene promoter includes a CAAT/GT box,
GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor
response element (EGFRE) in human endometrial carcinoma RL95-2 cells
(RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an
expression library of RL95 cells with a multimer of the EGFRE sequence. In
this work, we have identified that EGFREB encodes the C- terminus of
Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and
small intestine. A full-length cDNA clone was isolated from a human colon
library using EGFREB as the hybridization probe. The full-length cDNA
consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'- UTR, and a 1371 bp
sequence coding for a 457 amino acid polypeptide. Based on its tissue
distribution and sequence homology to the mouse IKLF, we renamed this
protein IKLF. DNase I footprinting and electrophoresis mobility shift assay
confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans
>20 kb in length and is organized into four exons, whose intron/exon
junctions follow the GT/AG rule. The three zinc fingers are encoded by
three exons. Nuclear localization of IKLF was demonstrated by green
fluorescence protein (GFP)-tagged IKLF in transfection experiments and
western analysis. Overexpression of IKLF in RL95 cells represses the
activity of reporter constructs containing the CAAT/GT box of the mouse
lactoferrin gene. These findings imply that IKLF is a nuclear transcription
factor that binds to the CAAT/GT box, and functions as a modulator of the
mouse lacto- ferrin gene promoter activity.
ARTICLES
Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter
Gene Regulation Group, Laboratory of Reproductive and Development Toxicology, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC 27709, USA.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
P. Guo, X.-Y. Dong, X. Zhang, K.-W. Zhao, X. Sun, Q. Li, and J.-T. Dong Pro-proliferative Factor KLF5 Becomes Anti-proliferative in Epithelial Homeostasis upon Signaling-mediated Modification J. Biol. Chem., March 6, 2009; 284(10): 6071 - 6078. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. X. Du, A. B. Bialkowska, B. B. McConnell, and V. W. Yang SUMOylation Regulates Nuclear Localization of Kruppel-like Factor 5 J. Biol. Chem., November 14, 2008; 283(46): 31991 - 32002. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Suzuki, T. Nishi, T. Nagino, K. Sasaki, K. Aizawa, N. Kada, D. Sawaki, Y. Munemasa, T. Matsumura, S. Muto, et al. Functional Interaction between the Transcription Factor Kruppel-like Factor 5 and Poly(ADP-ribose) Polymerase-1 in Cardiovascular Apoptosis J. Biol. Chem., March 30, 2007; 282(13): 9895 - 9901. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. X. Du, C. C. Yun, A. Bialkowska, and V. W. Yang Protein Inhibitor of Activated STAT1 Interacts with and Up-regulates Activities of the Pro-proliferative Transcription Factor Kruppel-like Factor 5 J. Biol. Chem., February 16, 2007; 282(7): 4782 - 4793. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Tong, K. Czerwenka, G. Heinze, M. Ryffel, E. Schuster, A. Witt, S. Leodolter, and R. Zeillinger Expression of KLF5 is a Prognostic Factor for Disease-Free Survival and Overall Survival in Patients with Breast Cancer Clin. Cancer Res., April 15, 2006; 12(8): 2442 - 2448. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Suzuki, K. Aizawa, T. Matsumura, and R. Nagai Vascular Implications of the Kruppel-Like Family of Transcription Factors Arterioscler Thromb Vasc Biol, June 1, 2005; 25(6): 1135 - 1141. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsumura, T. Suzuki, K. Aizawa, Y. Munemasa, S. Muto, M. Horikoshi, and R. Nagai The Deacetylase HDAC1 Negatively Regulates the Cardiovascular Transcription Factor Kruppel-like Factor 5 through Direct Interaction J. Biol. Chem., April 1, 2005; 280(13): 12123 - 12129. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. W. Bateman, D. Tan, R. G. Pestell, J. D. Black, and A. R. Black Intestinal Tumor Progression Is Associated with Altered Function of KLF5 J. Biol. Chem., March 26, 2004; 279(13): 12093 - 12101. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Aizawa, T. Suzuki, N. Kada, A. Ishihara, K. Kawai-Kowase, T. Matsumura, K. Sasaki, Y. Munemasa, I. Manabe, M. Kurabayashi, et al. Regulation of Platelet-derived Growth Factor-A Chain by Kruppel-like Factor 5: NEW PATHWAY OF COOPERATIVE ACTIVATION WITH NUCLEAR FACTOR-{kappa}B J. Biol. Chem., January 2, 2004; 279(1): 70 - 76. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Miyamoto, T. Suzuki, S. Muto, K. Aizawa, A. Kimura, Y. Mizuno, T. Nagino, Y. Imai, N. Adachi, M. Horikoshi, et al. Positive and Negative Regulation of the Cardiovascular Transcription Factor KLF5 by p300 and the Oncogenic Regulator SET through Interaction and Acetylation on the DNA-Binding Domain Mol. Cell. Biol., December 1, 2003; 23(23): 8528 - 8541. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. O. Yang, R. T. Doty, J. S. Hicks, and D. M. Willerford Regulation of T-cell receptor D{beta}1 promoter by KLF5 through reiterated GC-rich motifs Blood, June 1, 2003; 101(11): 4492 - 4499. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang and C. T. Teng Phosphorylation of Kruppel-like factor 5 (KLF5/IKLF) at the CBP interaction region enhances its transactivation function Nucleic Acids Res., April 15, 2003; 31(8): 2196 - 2208. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Dang, W. Zhao, C. S. Mahatan, D. E. Geiman, and V. W. Yang Opposing effects of Kruppel-like factor 4 (gut-enriched Kruppel-like factor) and Kruppel-like factor 5 (intestinal-enriched Kruppel-like factor) on the promoter of the Kruppel-like factor 4 gene Nucleic Acids Res., July 1, 2002; 30(13): 2736 - 2741. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Miller, E. A. Eklund, M. L. Peddinghaus, Z. Cao, N. Fernandes, P. W. Turk, B. Thimmapaya, and S. A. Weitzman Kruppel-like Factor 4 Regulates Laminin alpha 3A Expression in Mammary Epithelial Cells J. Biol. Chem., November 9, 2001; 276(46): 42863 - 42868. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sun, X. Chen, and V. W. Yang Intestinal-enriched Kruppel-like Factor (Kruppel-like Factor 5) Is a Positive Regulator of Cellular Proliferation J. Biol. Chem., March 2, 2001; 276(10): 6897 - 6900. [Abstract] [Full Text] [PDF] |
||||





