Skip Navigation

This Article
Right arrow Print PDF (1890K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Hershey, N.D.
Right arrow Articles by Davidson, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hershey, N.D.
Right arrow Articles by Davidson, N.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1980, Vol. 8, No. 21 4899-4910
© 1980

MOLECULAR BIOLOGY

Two Drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F

N.Davis Hershey and Norman Davidson

Department of Chemistry, California Institute of Technology Pasadena, CA 91125, USA

Received September 3, 1980. One Drosophila melanogaster tRNAGly gene occurs on each 1.1 – 2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.