Skip Navigation

This Article
Right arrow Print PDF (153K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Hori, H.
Right arrow Articles by Ishikura, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hori, H.
Right arrow Articles by Ishikura, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1980, Vol. 8, No. 22 5423-5426
© 1980

MOLECULAR BIOLOGY

The nucleotide sequence of 5S ribosomal RNA from Micrococcus Iysodeikticus

Hiroshi Hori{dagger}, Syozo Osawa{dagger}, Katsutoshi Murao{dagger}{dagger} and Hisayuki Ishikura{dagger}{dagger}

{dagger}Departrnent of Biochemistry and Biophysics, Research Institute for Nuclear Medicine and Biology, Hiroshima University Kasumi 1-2-3, Hiroshima, 734 {dagger}{dagger}Department of Chemistry, Jichi Medical School Minamikawachi-machi, Tochigi, 329-04, Japan

Received August 11, 1980. The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGA0H. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.