Skip Navigation

This Article
Right arrow Print PDF (163K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Kilpatrick, M.W.
Right arrow Articles by Walker, R.T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kilpatrick, M.W.
Right arrow Articles by Walker, R.T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1981, Vol. 9, No. 17 4387-4390
© 1981

MOLECULAR BIOLOGY

The nucleotide sequence of the tRNAMMetet from the archaebacterium Thermoplasma acidophilum

M.W. Kilpatrick and R.T. Walker

Chemistry Department, Birmingham University Birmingham B15 2TT, UK

Received July 3, 1981. Using in vitro labelling techniques, a tRNAMMet from Thermoplasma acidophilum, a member of the Archaebacteriae, has been shown to have the sequence: pGCCGGG Gs4 UGGCUCANCUGGAGGAGC m22 GCCGGAC mUCAUt6AAUCCGGAGGUCUCGGG {Phi}{Phi}Cm GAUCCCCGAUCCCGGCACCAOH. Despite the small genome size of this nonparasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria. There is no close sequence homology between this tRNA and that of any other methionine tRNA so far sequenced (<70%) but it has almost 90% homology with the nucleotide sequence proposed by Eigen and Oswatitsch for the ancestral quasispecies.1


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.