Skip Navigation

This Article
Right arrow Print PDF (2142K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Brennan, V. E.
Right arrow Articles by Bruenn, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brennan, V. E.
Right arrow Articles by Bruenn, J. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1981, Vol. 9, No. 19 5049-5060
© 1981

MOLECULAR BIOLOGY

Yeast dsRNA viral transcriptase pause products: identification of the transcript strand

Victoria E. Brennan, Libuse A. Bobek and Jeremy A. Bruenn

Division of Cell and Molecular Biology, State University of New York at Buffalo Buffalo, NY 14260, USA

Received June 11, 1981. ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominant product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.