Skip Navigation

This Article
Right arrow Print PDF (199K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Kumagai, I.
Right arrow Articles by Oshima, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kumagai, I.
Right arrow Articles by Oshima, T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1981, Vol. 9, No. 19 5159-5162
© 1981

MOLECULAR BIOLOGY

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Izumi Kumagai, Martin Digweed, Volker A. Erdmann, Kimitsuna Watanabe and Tairo Oshima

Max-Planck-Institut für Molekulare Genetik, Abt. Wittmann Ihnestrasse 63-73, and Institut für Biochemie, Freie Universität Berlin, Thielallee 69-73, D-1000 Berlin 33 (Dahlem), GFR Mitsubishi-kasei Institute of Life Sciences Minamiooya, 11, Machida-shi, Tokyo 194, Japan

Received July 20, 1981. Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermus thermophilus HB8 5S RNA could be determined : pAA(U)CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCCGAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGG UGCGGGGGAOH. This sequence is most similar to Thermus aquaticus 5S RNA with which it shows 85% homology.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.