Nucleic Acids Research, 1981, Vol. 9, No. 23 6627-6633
© 1981
MOLECULAR BIOLOGY |
The SS ribosomai RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the SS RNA of the trypanosomatid protozoa
Department of Microbiology, School of Medicine, State University of New York Stony Brook, NY 11794, USA
*Department of Anatomical Sciences, School of Medicine, State University of New York Stony Brook, NY 11794, USA
Received August 17, 1981. The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5'GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUACUGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUU0H3'This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomai RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasiculata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomai RNAs.